ID: 1083397662

View in Genome Browser
Species Human (GRCh38)
Location 11:62402446-62402468
Sequence CGCTGTGGGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083397662_1083397672 18 Left 1083397662 11:62402446-62402468 CCCTCTTCCCTCTGCCCACAGCG No data
Right 1083397672 11:62402487-62402509 GACACCGATACAGCTCACTCAGG No data
1083397662_1083397673 19 Left 1083397662 11:62402446-62402468 CCCTCTTCCCTCTGCCCACAGCG No data
Right 1083397673 11:62402488-62402510 ACACCGATACAGCTCACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083397662 Original CRISPR CGCTGTGGGCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr