ID: 1083397838

View in Genome Browser
Species Human (GRCh38)
Location 11:62403508-62403530
Sequence AGGTGGTGATGGAGTTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083397838_1083397850 6 Left 1083397838 11:62403508-62403530 CCCTGTCAACTCCATCACCACCT No data
Right 1083397850 11:62403537-62403559 GGGGACTAAGGCCGGGACGGTGG No data
1083397838_1083397848 -1 Left 1083397838 11:62403508-62403530 CCCTGTCAACTCCATCACCACCT No data
Right 1083397848 11:62403530-62403552 TCAGAAAGGGGACTAAGGCCGGG No data
1083397838_1083397847 -2 Left 1083397838 11:62403508-62403530 CCCTGTCAACTCCATCACCACCT No data
Right 1083397847 11:62403529-62403551 CTCAGAAAGGGGACTAAGGCCGG No data
1083397838_1083397849 3 Left 1083397838 11:62403508-62403530 CCCTGTCAACTCCATCACCACCT No data
Right 1083397849 11:62403534-62403556 AAAGGGGACTAAGGCCGGGACGG No data
1083397838_1083397845 -6 Left 1083397838 11:62403508-62403530 CCCTGTCAACTCCATCACCACCT No data
Right 1083397845 11:62403525-62403547 CCACCTCAGAAAGGGGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083397838 Original CRISPR AGGTGGTGATGGAGTTGACA GGG (reversed) Intergenic
No off target data available for this crispr