ID: 1083399036

View in Genome Browser
Species Human (GRCh38)
Location 11:62411365-62411387
Sequence ATGAGCTCCCTCTGAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083399036_1083399041 -10 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399041 11:62411378-62411400 GGGAGCTCATCCCAGAGCAAAGG 0: 1
1: 0
2: 2
3: 25
4: 254
1083399036_1083399042 -9 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399042 11:62411379-62411401 GGAGCTCATCCCAGAGCAAAGGG 0: 1
1: 0
2: 2
3: 11
4: 192
1083399036_1083399043 -1 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399043 11:62411387-62411409 TCCCAGAGCAAAGGGCCTGCTGG 0: 1
1: 0
2: 1
3: 36
4: 369
1083399036_1083399049 18 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399049 11:62411406-62411428 CTGGTTCTGCCAGTGGCCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 229
1083399036_1083399050 22 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399050 11:62411410-62411432 TTCTGCCAGTGGCCTTGGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 285
1083399036_1083399048 17 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399048 11:62411405-62411427 GCTGGTTCTGCCAGTGGCCTTGG 0: 1
1: 1
2: 1
3: 23
4: 293
1083399036_1083399046 11 Left 1083399036 11:62411365-62411387 CCCACCCCTCAGAGGGAGCTCAT 0: 1
1: 0
2: 1
3: 27
4: 180
Right 1083399046 11:62411399-62411421 GGGCCTGCTGGTTCTGCCAGTGG 0: 1
1: 0
2: 2
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083399036 Original CRISPR ATGAGCTCCCTCTGAGGGGT GGG (reversed) Intronic