ID: 1083407951

View in Genome Browser
Species Human (GRCh38)
Location 11:62471776-62471798
Sequence GCCGGGATGCGGGTACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083407935_1083407951 28 Left 1083407935 11:62471725-62471747 CCCATGGCAGGTGAAGCCGGACA 0: 1
1: 0
2: 0
3: 12
4: 81
Right 1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1083407943_1083407951 3 Left 1083407943 11:62471750-62471772 CCCTGAGGCCTGGGTGTGGGAGA 0: 1
1: 0
2: 0
3: 60
4: 562
Right 1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1083407946_1083407951 -5 Left 1083407946 11:62471758-62471780 CCTGGGTGTGGGAGACTGGCCGG 0: 1
1: 0
2: 4
3: 22
4: 232
Right 1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1083407936_1083407951 27 Left 1083407936 11:62471726-62471748 CCATGGCAGGTGAAGCCGGACAT 0: 1
1: 0
2: 2
3: 3
4: 83
Right 1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1083407939_1083407951 12 Left 1083407939 11:62471741-62471763 CCGGACATGCCCTGAGGCCTGGG 0: 1
1: 0
2: 4
3: 58
4: 421
Right 1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1083407944_1083407951 2 Left 1083407944 11:62471751-62471773 CCTGAGGCCTGGGTGTGGGAGAC 0: 1
1: 0
2: 2
3: 29
4: 377
Right 1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083407951 Original CRISPR GCCGGGATGCGGGTACCCAC AGG Intronic
900245258 1:1633494-1633516 GCCGGGATGGGGGCTCCCACGGG - Intronic
900256489 1:1700653-1700675 GCCGGGATGGGGGCTCCCACGGG - Intronic
905448726 1:38044268-38044290 GCCGGGATGCGGGATGCCAGGGG - Exonic
911835600 1:102614809-102614831 GCATGCATGCAGGTACCCACTGG + Intergenic
914492249 1:148159857-148159879 GCTGGGATGCTGGAAGCCACTGG + Intergenic
916218506 1:162419893-162419915 GCCGGACTCCGGGTACCCTCTGG + Intergenic
919944011 1:202306937-202306959 CCCTGGATGTGGGTACTCACAGG - Exonic
924792582 1:247266458-247266480 GCCGGAATTGGGGTGCCCACTGG + Intergenic
1063464905 10:6236792-6236814 GCCGGGCTGTGGGGATCCACAGG + Intergenic
1065371488 10:24991519-24991541 GCCGGCATGCTGGTGCCCATTGG - Intronic
1075639694 10:124055990-124056012 GGCTGGATGCAGGTACCCGCAGG - Intronic
1083407951 11:62471776-62471798 GCCGGGATGCGGGTACCCACAGG + Intronic
1084557535 11:69883848-69883870 GCGGGGATGCTGCCACCCACAGG + Intergenic
1095095365 12:38145007-38145029 GCCGGACTCGGGGTACCCACTGG + Intergenic
1096556270 12:52406031-52406053 GCCTGGCTTCGGGTACCGACTGG - Exonic
1097182675 12:57180135-57180157 GCAGGGAAGCTCGTACCCACGGG - Exonic
1112693983 13:101927158-101927180 TCAGGGATGAGGGTACCCAATGG + Intronic
1115961205 14:38837479-38837501 GCAGGGAGGGAGGTACCCACCGG - Intergenic
1121457390 14:94047084-94047106 GCCAGGGTGTGGGTCCCCACTGG - Exonic
1126852474 15:52805679-52805701 GCCGGGATGTGGAGGCCCACTGG + Intergenic
1128741794 15:70088941-70088963 GCAGGGATGCAGGGAGCCACCGG + Intronic
1130541317 15:84822542-84822564 GCTGGGATCCAGGTCCCCACTGG + Intronic
1132081773 15:98872048-98872070 TTCAGGATGCAGGTACCCACTGG - Intronic
1132591390 16:727834-727856 GCCGGGGAGCGGGGACCCAGCGG - Intronic
1132851109 16:2025473-2025495 GCCGGGATATGGGCACCCAGGGG + Intronic
1143187417 17:5018962-5018984 GACGGGATGCGGGTGCCTAGAGG - Intronic
1151401538 17:73858896-73858918 GCCGGGATGTGGCTAGACACAGG - Intergenic
1151480455 17:74367541-74367563 GCAGGGAAGTGGGGACCCACTGG - Exonic
1151733573 17:75925126-75925148 TCTGGGATGGGGGTTCCCACTGG + Intronic
1152728070 17:81957431-81957453 GCTGGGATACAGGAACCCACAGG + Intronic
1152782132 17:82231238-82231260 GCCGGGAAGCCGGAACCCGCAGG + Intronic
1161027491 19:2043243-2043265 GCCGGGCAGCAGGTACCCAGGGG - Intronic
1162111673 19:8403130-8403152 GCGGGGAGGCGGGTAGCCTCAGG + Intronic
1163316188 19:16542202-16542224 CCGGGAATGCGGGGACCCACGGG + Intronic
1166549598 19:43656498-43656520 GCCTGGATGTGGTGACCCACTGG - Exonic
926683843 2:15683035-15683057 GCTGGGAAGCGGGGAACCACAGG - Intergenic
933066808 2:77808137-77808159 GCCGGACTTGGGGTACCCACTGG + Intergenic
936608454 2:113979518-113979540 GCCGGCATCCGGGCACCAACTGG + Intergenic
937715156 2:125024235-125024257 GCCGGACTCAGGGTACCCACTGG - Intergenic
939810831 2:146830201-146830223 GCTGAGATGTGGGTACCTACAGG + Intergenic
942047501 2:172108333-172108355 GGCGGGATGCGGGTGCCCCCTGG + Intergenic
946182096 2:217955023-217955045 GGCTGGGTGCAGGTACCCACGGG + Intronic
1180099898 21:45579364-45579386 CCTGGGATGCGGGTACCCCTGGG + Intergenic
1182355602 22:29721083-29721105 GCCGGGCTGGGGGTCCCCGCAGG - Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185045682 22:48527659-48527681 GGTGGGATGCGGCTTCCCACAGG - Intronic
1185329726 22:50246812-50246834 GCCAGGATAGGGGTGCCCACAGG + Intronic
950688774 3:14638962-14638984 GCCTGGATGTAGGTACCCAATGG + Intergenic
954468471 3:50672701-50672723 GGGGGGATGAGGGTACCAACAGG + Intergenic
961539487 3:127590225-127590247 CCCTGGATGTGGGAACCCACGGG - Intronic
962317733 3:134369198-134369220 GCTGGGAAGAGGGTCCCCACTGG + Intronic
962415374 3:135177239-135177261 GCCCAGATGCTGGGACCCACAGG - Intronic
968818986 4:2836134-2836156 GCTGGGCTTCGGGTAACCACAGG - Exonic
968916477 4:3499095-3499117 GCCGGGCAGCGGGTGGCCACAGG + Intronic
970878645 4:20902313-20902335 GCAGGGATGCTGGAAACCACAGG + Intronic
976306545 4:83565695-83565717 GCCGGACTCGGGGTACCCACCGG - Intronic
984811321 4:183798168-183798190 GCAGGGACGCGGGCACCCAGGGG - Intergenic
985913098 5:2898029-2898051 GCAGGGATGCAGGGACACACCGG - Intergenic
994613774 5:102078202-102078224 GCCAGCATGAAGGTACCCACAGG + Intergenic
1003420566 6:5954015-5954037 GCTGGGATGTGGGTGCCCTCTGG - Intergenic
1011620460 6:89237650-89237672 GCCAGGAGGCTGGTACCCTCGGG - Intergenic
1011789793 6:90885730-90885752 GCTGGGAGGCGGGTAGCCTCGGG - Intergenic
1029241242 7:99164699-99164721 GGCAGGATGCAGGTAGCCACTGG + Intergenic
1034233185 7:149548575-149548597 GCCGAGATGAGCGTTCCCACAGG - Intergenic
1043527491 8:81112194-81112216 GCCGGGCTGGGGGTGCACACGGG + Intergenic
1049639100 8:143706463-143706485 GCAGGGATGCGGGGTCCCAAAGG + Intronic
1057509651 9:95666744-95666766 TCCGGGATCCTGGTACACACAGG - Intergenic
1062426683 9:136509224-136509246 GCCGGGCCCCGGGTTCCCACTGG - Intronic