ID: 1083414139

View in Genome Browser
Species Human (GRCh38)
Location 11:62514355-62514377
Sequence TTGAGTGAAAGCAGCACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083414139 Original CRISPR TTGAGTGAAAGCAGCACCCC GGG Intronic
902585276 1:17435356-17435378 CTGTGTGAAAGCAGCCGCCCAGG - Intronic
902933971 1:19751043-19751065 TTGAGTTACAGCAGAATCCCTGG - Intronic
905566442 1:38969056-38969078 TTGAGGGCAAGTAGAACCCCTGG + Intergenic
907511299 1:54962852-54962874 TTGAGAGAATACAGCACACCAGG - Intergenic
908934504 1:69358163-69358185 TTGAGAGAATACAGCACTCCAGG + Intergenic
912070012 1:105797515-105797537 TAGAGTTAAAGGAGCATCCCAGG + Intergenic
913372955 1:118121072-118121094 AGGGGTGAGAGCAGCACCCCTGG + Intronic
915245686 1:154554925-154554947 CTGAGTGGAAGCAACAGCCCAGG + Intronic
918105293 1:181411306-181411328 CCAAGTGAAAGCAGCACTCCAGG - Intergenic
918465351 1:184816245-184816267 TTGAGAGAATACAGCACACCAGG - Intronic
919835915 1:201573250-201573272 TTCTGTGAAATCAGCACTCCAGG - Intergenic
921771474 1:219045711-219045733 TTGAGAGAATACAGCACACCAGG - Intergenic
921809246 1:219493126-219493148 ATGAGTGAAAGAAGCAGCCAAGG + Intergenic
924297089 1:242598594-242598616 TTGAGAGAATACAGCACACCAGG - Intergenic
1065387135 10:25144696-25144718 TTGAGTGAGAGCAGCAGCAGAGG + Intergenic
1067213879 10:44284475-44284497 TTGAAAGAATGTAGCACCCCTGG + Intergenic
1072158389 10:92744296-92744318 TGAAGGGAAAGCAGCAGCCCAGG - Intergenic
1072199220 10:93143772-93143794 TAGAGTAAAAGCAGCATTCCAGG + Intergenic
1073619615 10:105033322-105033344 TTGAGTGAAGTCAGGACCTCTGG + Intronic
1074394227 10:113084360-113084382 TTGAGCTAAAGCAGCATCTCTGG - Intronic
1075911764 10:126131195-126131217 TTGAGGGAAAACTGCACCCAGGG - Intronic
1076021285 10:127076109-127076131 TTGAGTCAAATCAGCATCCAAGG + Intronic
1076053214 10:127351655-127351677 TTGCCTGGAAGCAGAACCCCGGG - Intronic
1079902446 11:26204176-26204198 CTGAGTGTAAGCAGCCTCCCAGG - Intergenic
1082082432 11:48022597-48022619 AGGTGTGAAATCAGCACCCCAGG - Intronic
1083414139 11:62514355-62514377 TTGAGTGAAAGCAGCACCCCGGG + Intronic
1087464757 11:98490283-98490305 TTGAGAGAATACAGCACACCAGG + Intergenic
1090255445 11:125280615-125280637 TTGAGTGAAAGCAGGCAGCCTGG + Intronic
1091083196 11:132692573-132692595 TGCAGTGAAAGCACCTCCCCTGG - Intronic
1091277028 11:134359570-134359592 TTGCCTGCTAGCAGCACCCCTGG + Intronic
1091553649 12:1555332-1555354 TTGATAGCTAGCAGCACCCCAGG - Intronic
1092858993 12:12703164-12703186 TTGAGTGAATGAAGTACACCTGG + Intergenic
1093357035 12:18178668-18178690 CCAAGTGAAAGCACCACCCCTGG + Intronic
1096673728 12:53215161-53215183 CTGGGAGAAGGCAGCACCCCAGG + Intronic
1096994641 12:55830978-55831000 TTGACCGACAGCCGCACCCCCGG + Intergenic
1097406676 12:59197926-59197948 CTGATTGAAAGCAGCAGCCTTGG - Intergenic
1097581951 12:61468810-61468832 TTGCGTGAAAGTAGAACCACTGG - Intergenic
1098294452 12:68990433-68990455 TTGAGGGAATACAGCACACCAGG - Intergenic
1099328844 12:81255469-81255491 CTGAGGGAAAGCAGAACACCGGG + Exonic
1099542200 12:83926445-83926467 TTGGGAGACAGCAGCACCCTTGG - Intergenic
1100939169 12:99706599-99706621 TTGAGTGGAAGCAGAACCTCTGG + Intronic
1103761463 12:123253364-123253386 TTCTGAGAAAACAGCACCCCCGG + Intronic
1109207838 13:59501357-59501379 TGGAGTGGAATCAGCTCCCCAGG - Intergenic
1110050239 13:70887670-70887692 TTGAGAGAATACAGCACACCAGG - Intergenic
1110960138 13:81611044-81611066 TTGAGAGAATACAGCACACCAGG - Intergenic
1111442480 13:88298085-88298107 CTGAGCAAAAGCAGTACCCCAGG + Intergenic
1111594637 13:90396020-90396042 TTGAGAGAATACAGCACACCAGG - Intergenic
1114912186 14:27214142-27214164 TTGAGAGAATACAGCACACCAGG + Intergenic
1115543845 14:34447394-34447416 TTGAGAGAATACAGCACTCCAGG - Intronic
1116725593 14:48557968-48557990 TTGAGAGAATACAGCACACCAGG + Intergenic
1116746800 14:48830377-48830399 TTGAGTAAGAGCAGGAACCCAGG + Intergenic
1119617037 14:76105593-76105615 TGGAGTGAAAGGAACACTCCCGG - Intergenic
1120635987 14:86951606-86951628 TTGCCTGAAAGCTGCAGCCCAGG + Intergenic
1124624414 15:31299927-31299949 TTGTGTGAAAGCTGCGCTCCTGG + Intergenic
1128567303 15:68709942-68709964 TTGAGTGACAGAAGCCCACCAGG + Intronic
1133638205 16:7690555-7690577 TTGAGAGAAAGCAGCACACTAGG + Intronic
1136531929 16:30875570-30875592 CTGAGTGAAACCAGCCCCGCTGG - Intronic
1139963364 16:70730555-70730577 ATGAGTGAAATCGGAACCCCTGG - Intronic
1140031617 16:71343807-71343829 TTGACTGAAGACAACACCCCTGG - Intergenic
1140144225 16:72289981-72290003 CTGATTGAAAGCAGCCCCACTGG - Intergenic
1141005289 16:80346352-80346374 TTGAGTGCAAGCAGCATTCTAGG + Intergenic
1141663146 16:85452569-85452591 TTGAGATGCAGCAGCACCCCAGG - Intergenic
1144414157 17:15030714-15030736 TTGATTAAAATCTGCACCCCAGG - Intergenic
1145274384 17:21421173-21421195 TTGAGCCAGAGCAGCACCTCCGG - Intergenic
1145312242 17:21707077-21707099 TTGAGCCAGAGCAGCACCTCCGG - Intergenic
1146541087 17:33695603-33695625 TCCAGTGAAAGCAGCACTCTTGG - Intronic
1147463906 17:40595586-40595608 TTGAGAGAATACAGCACACCAGG - Intergenic
1149151438 17:53569048-53569070 TTGAGTAAATGCAGCACACCTGG - Intergenic
1152250212 17:79208600-79208622 TTGAGTGAAAGATGCCCACCTGG + Intronic
1156108993 18:33700619-33700641 TTCACTGAAAGCAGCACATCAGG + Intronic
1156386018 18:36606059-36606081 TTCAGGGAAAGCAGGACCCCAGG + Intronic
1158412113 18:57216017-57216039 TTGAGTGAAAGCTGCCCTGCTGG - Intergenic
1158869553 18:61671649-61671671 ATGAGTGAAAACATCAGCCCAGG + Intergenic
1159948104 18:74458262-74458284 TTCAGTGAATGCAGGAGCCCCGG - Intergenic
1161285783 19:3467579-3467601 TTGAGAGACAGCAGCATTCCAGG + Intronic
1162219387 19:9163335-9163357 TTGAGTGTCTGCAGCAGCCCTGG + Exonic
1162617490 19:11814156-11814178 CTGAGTGACAGCAGAAGCCCTGG - Intergenic
1162638290 19:11987527-11987549 CTGAGTGACAGCAGAAGCCCCGG - Intergenic
1162646379 19:12053062-12053084 CTGAGTGACAGCAGAAGCCCCGG + Intergenic
1162651483 19:12092180-12092202 CTGAGTGACAGCAGAAGCCCGGG - Intergenic
1163485051 19:17580539-17580561 TGGAGTGAATGCAGGAGCCCAGG - Intronic
1165057530 19:33187465-33187487 TGAAGTCAAAGCAGCAACCCCGG + Intronic
1166985622 19:46658881-46658903 TTGAGAGCAAGCAGGACCCAGGG + Intronic
1167859351 19:52270363-52270385 CAAAGTGAAAGAAGCACCCCAGG + Intronic
1168650186 19:58087508-58087530 TTCTGTGACAGCAGCACCCAAGG + Intronic
924994042 2:340639-340661 CTGAGTGAAAATAGCACACCTGG - Intergenic
927879752 2:26682103-26682125 TTGAGTTAAGGCAGGACTCCTGG - Intergenic
928818729 2:35333442-35333464 TTGACTGACAGCACCACCTCAGG - Intergenic
929118465 2:38464696-38464718 TGTAGTGGAAGCAGCACCCTTGG - Intergenic
929557923 2:42937026-42937048 TTGAGTGAGTGCCACACCCCAGG + Intergenic
932665741 2:73697339-73697361 TTGAGAGGATGCAGCACACCAGG - Intergenic
932712004 2:74073109-74073131 TTAAGTGAAAGAAGCCCTCCTGG - Intronic
937152754 2:119697120-119697142 TTGAGTGTGACCAGCACCTCTGG - Intergenic
940036519 2:149317894-149317916 TCAAATGAAAGCAGCACCACTGG + Intergenic
942380965 2:175390155-175390177 TTGTGTGAAAACAGTACCTCTGG - Intergenic
947379469 2:229531236-229531258 TTGATTGAGAGCAGCACTCCTGG - Intronic
1169452402 20:5723128-5723150 TTGATTAACAGCAGCACCTCAGG + Intergenic
1170677873 20:18499099-18499121 TTGAGAGAATACAGCACACCAGG - Intergenic
1171177140 20:23060952-23060974 TTGTGTGAAAGCAGCAAGCCTGG + Intergenic
1175893208 20:62324398-62324420 TTCAGTGAATGCTGCCCCCCTGG + Intronic
1176143418 20:63554853-63554875 TGGAGAGCAAGCCGCACCCCTGG - Exonic
1179547065 21:42119556-42119578 CGGAAAGAAAGCAGCACCCCTGG - Intronic
1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG + Exonic
1181562466 22:23713938-23713960 TAGAGTGAGAGCAGCACCGTGGG + Intergenic
1182665226 22:31953745-31953767 CAGAGTGGAGGCAGCACCCCTGG + Intronic
1184126388 22:42490413-42490435 TGTTGTGAAACCAGCACCCCGGG + Intergenic
950604748 3:14068512-14068534 TTGAGAGAATACAGCACACCGGG + Intronic
952250308 3:31647153-31647175 TTGGGAGGAAGCAGCAGCCCAGG + Intergenic
953971497 3:47352037-47352059 TGGAGTGAAATCAGAACCCAGGG - Intergenic
954308716 3:49747779-49747801 TTTAATGAAAGCAGCAGCCTTGG - Intronic
955933392 3:64079645-64079667 TTCAGGGAAAGCTCCACCCCAGG + Intergenic
957805546 3:85143864-85143886 TTGAGTGAAATGAGAACCTCTGG - Intronic
959712881 3:109402308-109402330 CTGAGAGACAGCAGCAGCCCTGG + Intergenic
962246109 3:133795323-133795345 TTGAGAGAATACAGCACACCAGG - Intronic
962737411 3:138338341-138338363 TTGAGTAAAAACAACACTCCGGG + Intergenic
964893331 3:161562928-161562950 TTGAGAAGAAGCAGCAGCCCTGG + Intergenic
964976074 3:162622296-162622318 TAGAGTGACACAAGCACCCCTGG + Intergenic
968701133 4:2058858-2058880 TTGTTTGAAAGCAGCGCCCGCGG - Intergenic
968704352 4:2071047-2071069 TGGCCTGAAAGCAGGACCCCGGG + Intergenic
968846914 4:3048417-3048439 TTGAGAGAATGCAGCGCACCAGG + Intergenic
969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG + Intergenic
969306106 4:6327179-6327201 TTGAGTCATAGTAGCCCCCCAGG + Intronic
970613265 4:17744988-17745010 TTGAGGAAAAGCAGCAGCTCCGG - Intronic
971572525 4:28231476-28231498 TTAATTGAAAGCAGCACCCAGGG - Intergenic
973676465 4:53268474-53268496 TTGAGTGACAACAACATCCCAGG + Intronic
973774215 4:54230483-54230505 CTGAGCGAAAGCAGAGCCCCCGG - Intronic
978025501 4:103868038-103868060 GTGAGTGAATGCATGACCCCAGG - Intergenic
980936933 4:139234495-139234517 TTGAGAGAAAACAGCTCACCAGG + Intergenic
981233976 4:142392998-142393020 TTGAGAGAATACAGCACACCAGG - Intronic
982080525 4:151785305-151785327 TTGATAGAAAGAAGGACCCCAGG + Intergenic
982202151 4:152971714-152971736 TTTTCTGAAAGCACCACCCCAGG - Intronic
983319557 4:166178539-166178561 ATGAGTGAAAACATCACCCCAGG + Intergenic
984759535 4:183351780-183351802 GTGAGTAAAAGCAGCGCTCCTGG + Intergenic
985961495 5:3306425-3306447 ATGCTTGAAAGCACCACCCCAGG + Intergenic
989093621 5:37759898-37759920 TTGAGAGAATACAGCACACCAGG + Intergenic
991217216 5:64169477-64169499 TTGAGAGAATGCAGCACACTAGG + Intronic
993671206 5:90763991-90764013 TTGAGTGGAAGCACCTGCCCTGG + Intronic
995833928 5:116381848-116381870 TTAAGGGACAGCAGCCCCCCTGG + Intronic
996789136 5:127273247-127273269 GTGAGTGAATGCACCACCCTGGG - Intergenic
997818170 5:137037837-137037859 GTGAATGAGACCAGCACCCCTGG - Intronic
1003201761 6:3967795-3967817 TTGAGGGAATACAGCACACCAGG - Intergenic
1003367882 6:5494275-5494297 TTCAAAGAAAGCAGCAGCCCTGG + Intronic
1011161469 6:84395450-84395472 TTAAGAGAAAGCAGAAACCCTGG + Intergenic
1011961623 6:93097868-93097890 TTGAGTGTAAGTTGCACACCAGG + Intergenic
1019070533 6:169341276-169341298 TTGAGGGAAAGCGACACCTCTGG - Intergenic
1019191992 6:170256841-170256863 TTGAGTTACAGCAGGCCCCCGGG - Intergenic
1019700943 7:2474851-2474873 CTGAGTGACACCTGCACCCCAGG - Exonic
1023120690 7:36905339-36905361 GTGCAAGAAAGCAGCACCCCAGG - Intronic
1023288782 7:38647199-38647221 TTGAGTGTCAGCAGCACCCCAGG + Intergenic
1024431872 7:49297779-49297801 TTCATTAAAAGCACCACCCCAGG + Intergenic
1025227325 7:57177109-57177131 TGGAGTGAGAGCAGCACCGTGGG + Intergenic
1025230428 7:57200547-57200569 TGGAGTGAGAGCAGCACCATGGG + Intergenic
1025730546 7:64103169-64103191 TGGAGTGACAGCAGCACCGTGGG - Intronic
1030356943 7:108553651-108553673 ATGTCTGAGAGCAGCACCCCTGG - Intronic
1030837531 7:114308058-114308080 TGGAGTGAAAGCAACAATCCCGG - Intronic
1030981997 7:116197209-116197231 TTTAGTGAAAGCAATACCACAGG + Intergenic
1031128512 7:117803729-117803751 TAGAGTTAAAGCATTACCCCAGG + Intronic
1034050878 7:147983244-147983266 TTGAGAGGAAGCAGCTCTCCAGG + Intronic
1034348817 7:150403616-150403638 TGCAGTGACACCAGCACCCCAGG - Intronic
1038217357 8:25574482-25574504 TTAAGTGGAAGCAGAACCCCAGG - Intergenic
1040444306 8:47478050-47478072 TAGAGTGCTAGCAGCACCCAGGG + Intronic
1041604815 8:59769078-59769100 TTGAGAGAATACAGCACACCAGG + Intergenic
1044023221 8:87133548-87133570 TTGAGTGAAGGGAACAACCCAGG - Intronic
1044464855 8:92490975-92490997 GTGAGTGAAGTCAGCACCACAGG + Intergenic
1050119370 9:2292634-2292656 TTGAGTGAAAACAGAAGCCTTGG + Intergenic
1050658115 9:7851947-7851969 TTGAGAGAATACAGCACACCAGG - Intronic
1051596445 9:18828948-18828970 TGGAATGGAAGCAGCAGCCCAGG - Intronic
1052156962 9:25203926-25203948 TTGAGAGAAGACAGCACACCAGG - Intergenic
1055010630 9:71561261-71561283 TTGAGGGCAAGCAGTCCCCCAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057781108 9:98051165-98051187 TTGAGAGAATACAGCACACCAGG + Intergenic
1058238847 9:102529654-102529676 TTTAGTTAAAGTAGCAACCCTGG + Intergenic
1059860583 9:118456476-118456498 TAGAGTGAAAGCAGAACCTGAGG + Intergenic
1060671839 9:125476642-125476664 GTGAGTGAAAGCAGCAGCGGTGG - Intronic
1061516253 9:131092224-131092246 GTGAGTGGATGTAGCACCCCAGG - Exonic
1186429811 X:9495508-9495530 TTTATAGAAAGCATCACCCCAGG + Intronic
1188657240 X:32713493-32713515 TTCAGTGAAAGCTGCACCAATGG - Intronic
1191117527 X:56867094-56867116 TTCTGAGAAAGCACCACCCCTGG - Intergenic
1192381845 X:70625455-70625477 TTCAGTGGAAGCAGCATCCTTGG - Intronic
1195558683 X:106257708-106257730 TTGAGAGAATACAGCACACCAGG + Intergenic
1196408971 X:115396004-115396026 TAGAGTGGAAACAGCACCCCTGG + Intergenic
1197076514 X:122360075-122360097 TTGAGTGAAACTTGCATCCCTGG + Intergenic
1197934549 X:131727328-131727350 TTGAGAGAACGCAGCACACCAGG - Intergenic
1198424769 X:136506137-136506159 TTGAGTCTAAGGATCACCCCAGG + Intronic
1198682412 X:139196975-139196997 TTGAGTGAAAGCTCTACCCCAGG + Intronic
1198831158 X:140752102-140752124 TTGAGGAAAAGCAGCACCACAGG - Intergenic
1201012042 Y:9556981-9557003 TTGAGTCCAAGCTGAACCCCAGG + Intergenic