ID: 1083414217

View in Genome Browser
Species Human (GRCh38)
Location 11:62514851-62514873
Sequence CGGTGAGGACAGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 201}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083414203_1083414217 30 Left 1083414203 11:62514798-62514820 CCATGGGCCACCCTTGAGCTCCA 0: 1
1: 0
2: 4
3: 32
4: 200
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414210_1083414217 3 Left 1083414210 11:62514825-62514847 CCCCAGAACACTGGCTCTGCTGG 0: 1
1: 0
2: 2
3: 31
4: 282
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414213_1083414217 1 Left 1083414213 11:62514827-62514849 CCAGAACACTGGCTCTGCTGGCC 0: 1
1: 0
2: 0
3: 22
4: 232
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414206_1083414217 19 Left 1083414206 11:62514809-62514831 CCTTGAGCTCCAAAACCCCCAGA 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414204_1083414217 23 Left 1083414204 11:62514805-62514827 CCACCCTTGAGCTCCAAAACCCC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414208_1083414217 10 Left 1083414208 11:62514818-62514840 CCAAAACCCCCAGAACACTGGCT 0: 1
1: 0
2: 1
3: 27
4: 256
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414209_1083414217 4 Left 1083414209 11:62514824-62514846 CCCCCAGAACACTGGCTCTGCTG 0: 1
1: 0
2: 2
3: 19
4: 238
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414212_1083414217 2 Left 1083414212 11:62514826-62514848 CCCAGAACACTGGCTCTGCTGGC 0: 1
1: 0
2: 1
3: 17
4: 234
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1083414205_1083414217 20 Left 1083414205 11:62514808-62514830 CCCTTGAGCTCCAAAACCCCCAG 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083414217 Original CRISPR CGGTGAGGACAGATGAAGCT AGG Intronic
901720471 1:11193342-11193364 GGGTGAGTGCACATGAAGCTTGG - Intronic
902387031 1:16081934-16081956 AGGTGAGGCCAGATGAGGCCAGG - Intergenic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
904409989 1:30319556-30319578 CTGTGGGGACATAGGAAGCTGGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905536170 1:38723588-38723610 GGGTGTGGAGAGATAAAGCTGGG - Intergenic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
907305637 1:53511514-53511536 CGCTGAGGACAGGGGAAGCAGGG + Intronic
907686612 1:56617875-56617897 AGGTGAGGGCAGATGCAGATGGG + Intronic
910977210 1:92919324-92919346 CGGTGGTGAGAGATGAAGCTAGG - Intronic
912648558 1:111418171-111418193 AGGTGAGGAGACATGAAGCCAGG - Intronic
912747313 1:112255748-112255770 TGGTGAGGACAGGGGAAACTGGG + Intergenic
915902568 1:159856939-159856961 CAGTGAGGACAGGAGAAGCCAGG + Intronic
916837651 1:168564632-168564654 TGGTGAGAACATATGATGCTTGG - Intergenic
917330752 1:173878156-173878178 CAGTTAGGACAGATAAAACTAGG - Intronic
923401973 1:233624449-233624471 AGGTGAGGCCAGGTGAAGATAGG - Intronic
1062828518 10:588970-588992 TGGTGAGGACAGAGGCAGCCGGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064014596 10:11762578-11762600 CGGTGAGGAGGGAGGGAGCTGGG + Intronic
1066280512 10:33913028-33913050 CGTTGAGGTAAGATCAAGCTGGG + Intergenic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1069908235 10:71744667-71744689 CGGTGAGAGCAGGAGAAGCTGGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1075684584 10:124354599-124354621 CACTGAGGACAGGTGAAGCTGGG + Intergenic
1076933014 10:133546341-133546363 CAGTGAGGAGAGATGGACCTGGG - Intronic
1077081871 11:727960-727982 CGGTGGGGACAGAGCCAGCTCGG + Intergenic
1077411077 11:2404200-2404222 GGGTGTGGACAGAGGAGGCTGGG + Intergenic
1077473485 11:2775705-2775727 CGGTGAGTAGACAGGAAGCTGGG + Intronic
1078592936 11:12661275-12661297 CGGTGAGAACACATGATGTTTGG - Intergenic
1078996997 11:16711950-16711972 CAGTGAGAACAGATGATGTTTGG + Intronic
1081386932 11:42482946-42482968 AGGTTAGGACAGATTAGGCTAGG - Intergenic
1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085119622 11:73958748-73958770 CGGGGAAGAAAGCTGAAGCTGGG + Intronic
1087718521 11:101636359-101636381 CAGTGAGGAGGGATGAATCTGGG - Intronic
1088557760 11:111080128-111080150 CGGTGAGGTCAGAGGAATCAGGG - Intergenic
1088697726 11:112382795-112382817 CAGTGAGGAAAGATGAGTCTGGG - Intergenic
1088741788 11:112773561-112773583 AGGAGAGGAGAGATGAGGCTGGG + Intergenic
1089844158 11:121445456-121445478 CTGTGGGGACAGCAGAAGCTGGG - Intergenic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1090033755 11:123230398-123230420 AGGTGATTAAAGATGAAGCTGGG - Intergenic
1090843994 11:130516141-130516163 AGCTGAGCACAGATGAAGCAGGG + Intergenic
1093036185 12:14334440-14334462 TGGAGAAGACAGATGAATCTTGG + Intergenic
1093886781 12:24470421-24470443 CGGTGAGGACAGATTAAGGCAGG + Intergenic
1095336258 12:41031076-41031098 CGGTGAGGAATGATGAACCAAGG - Intronic
1095981805 12:47978437-47978459 CTGAGAGGACAGAAGAGGCTGGG - Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097722433 12:63037551-63037573 TGGTGAGGGCAGAAGAACCTTGG + Intergenic
1099776934 12:87145833-87145855 CAGTGAGAACATATGATGCTTGG + Intergenic
1101319637 12:103662252-103662274 GGGTGAAGACAGAGGAAGCCAGG + Intronic
1102164588 12:110796242-110796264 CCCTGAGGTCAGATGAAGCCTGG + Intergenic
1104282706 12:127392407-127392429 GGGGGAGGAGAGAAGAAGCTTGG - Intergenic
1105532138 13:21229833-21229855 CTGTGAGGGCAGGTGCAGCTGGG + Intergenic
1105543813 13:21337546-21337568 GGGTGAGGGCAGATGAGGCTAGG - Intergenic
1105543834 13:21337645-21337667 GGGTGAGGGCAGATGAGTCTAGG - Intergenic
1105543847 13:21337704-21337726 AGGTGAAGACAGATGAGGCTAGG - Intergenic
1105544031 13:21338988-21339010 AGGTGAGGGCAGGTGAAGCCAGG - Intergenic
1105544045 13:21339058-21339080 AGGTGAGGACAAATGAGACTGGG - Intergenic
1105544050 13:21339098-21339120 GGGTGAGGGCAGATGAGGCTAGG - Intergenic
1105544060 13:21339158-21339180 AGGTGAGGGCAGATGAGGCTAGG - Intergenic
1105544078 13:21339237-21339259 AGCTGAGGGCATATGAAGCTAGG - Intergenic
1105544083 13:21339267-21339289 GGGTGAGGGCAGATGAGTCTAGG - Intergenic
1105544094 13:21339326-21339348 TGGTGAAGACAGATGAGGCTAGG - Intergenic
1106777215 13:33020069-33020091 CGGTGAGGGGAGTTGAAGGTGGG - Intronic
1110419274 13:75287205-75287227 CAGTGAGAAGAGATGAAGCATGG - Intronic
1113616105 13:111681638-111681660 GGGTGAGGAAACATGAACCTGGG - Intergenic
1113621573 13:111766531-111766553 GGGTGAGGAAACATGAACCTGGG - Intergenic
1116686507 14:48046613-48046635 CAGTGAGGAAAGATAAAGCTTGG + Intergenic
1117780382 14:59225589-59225611 TGGTGAGGACACCTGAGGCTAGG + Intronic
1119791002 14:77349709-77349731 CAGTGAAGAAAAATGAAGCTGGG - Intronic
1121992695 14:98574943-98574965 GGGTGTGGACAGATGAATTTGGG - Intergenic
1122438140 14:101712786-101712808 CGGTGGGGAGAGATGACGGTGGG - Intergenic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1125700930 15:41682943-41682965 GGGTGAAGAGAGATGAGGCTGGG - Intronic
1126566391 15:50105008-50105030 GGGTGAGGACATATGATGTTTGG - Intronic
1127138775 15:55952727-55952749 CAGTGAGAACAGATGACGCAAGG - Intronic
1127257092 15:57301630-57301652 GGGTGAGGACACAGGATGCTGGG + Intergenic
1127968685 15:63942632-63942654 GGCTGAGGACAGATGAGACTCGG - Intronic
1128383745 15:67132460-67132482 TGGTGAGGACAGATGAGGGCAGG + Intronic
1131467774 15:92669256-92669278 AGGTAAGGGTAGATGAAGCTAGG - Intronic
1131467783 15:92669311-92669333 AGGTAAGGGTAGATGAAGCTAGG - Intronic
1133121774 16:3612737-3612759 CAGTGAGAACAGATGAGGCAAGG + Intronic
1134110532 16:11512851-11512873 CGGGGAGGGCAGACCAAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135919912 16:26640578-26640600 CGGCGGAGGCAGATGAAGCTGGG + Intergenic
1136403354 16:30030248-30030270 CAGTGAGGAGAGAGGAAGCCTGG + Intronic
1137982898 16:53084874-53084896 GGGTGTGGACAGACGAAGCCAGG - Intronic
1138941388 16:61794681-61794703 AAGTGATGAAAGATGAAGCTGGG + Intronic
1139659956 16:68413976-68413998 AGGTGTGGACAGATGAAGGTTGG + Intronic
1140392829 16:74602797-74602819 GGGTGGGAACAGTTGAAGCTGGG + Intronic
1141108152 16:81250380-81250402 AGGAGAGGAGAGATGAAGCCAGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141658602 16:85429604-85429626 AGGTGAGGACAGGAGATGCTGGG - Intergenic
1142808911 17:2386194-2386216 GGGTGAGGGCACAGGAAGCTTGG + Exonic
1143045072 17:4071657-4071679 AGGTGAGGACAGGGGATGCTAGG + Intronic
1145045974 17:19616368-19616390 CAGTGAGGTCAGATGACACTAGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149282363 17:55121807-55121829 GGATAAGGACAGATGGAGCTGGG + Intronic
1149623074 17:58060587-58060609 TGCTGAGGACAGATGGGGCTGGG - Intergenic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157180642 18:45495039-45495061 AAGTGAGGAAATATGAAGCTGGG - Intronic
1157955185 18:52089121-52089143 AGGTAAGGACAGAGGGAGCTAGG - Intergenic
1158031003 18:52964945-52964967 CAGAGAGGAAAGATGATGCTAGG - Intronic
1159863346 18:73675086-73675108 CGGTGAGGGCAGATAAATGTAGG - Intergenic
1165093085 19:33396714-33396736 GGGTGAGGAGAGAGGGAGCTGGG + Intronic
1165532809 19:36418291-36418313 CGGTGTGGGCAGAGGATGCTGGG + Intronic
1165537999 19:36466311-36466333 GGGTGAGGACAGTTGAGGTTTGG + Intronic
925030257 2:645039-645061 CGGTCTGGACAGATGGAGCCTGG + Intergenic
928099290 2:28426167-28426189 GGGTAAGGACAGAAGAAGTTGGG - Intergenic
929050017 2:37828487-37828509 CAGTGGGGACAGCTGAAGCCGGG + Intergenic
929688853 2:44058076-44058098 GGGTGATGAGAGATAAAGCTGGG + Intergenic
930830034 2:55733160-55733182 GGGAGAGGAGAGATAAAGCTAGG - Intergenic
930852250 2:55973583-55973605 AGGTGAGGTCAGATGCACCTTGG + Intergenic
930990419 2:57647470-57647492 CAGTGAGAACATATGATGCTTGG + Intergenic
932064781 2:68543170-68543192 CGGGGAGGACAGGAGGAGCTGGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
940680798 2:156782706-156782728 CAGTGAGAACAGATGATGTTTGG - Intergenic
943389113 2:187240305-187240327 AAGTGAGAACAGATGAAGTTAGG + Intergenic
946548456 2:220773894-220773916 CAGTGGGTACAGATGAAGCCAGG - Intergenic
948059634 2:235033275-235033297 ACGTGAGGACACATGAAGCCAGG - Intronic
948329638 2:237155010-237155032 ACCTGAGGCCAGATGAAGCTGGG - Intergenic
948677926 2:239610098-239610120 CGCGGAGCACAGAGGAAGCTGGG - Intergenic
1168804158 20:662917-662939 AGGTGAGGGCAGCTGGAGCTGGG + Exonic
1169064763 20:2688778-2688800 TGGTGATGACAGAGGAAGCGTGG - Intergenic
1169686470 20:8279322-8279344 CCTAGAAGACAGATGAAGCTTGG + Intronic
1170196566 20:13694911-13694933 CGGTAAGGACAAAGGAAGTTGGG + Intergenic
1173714792 20:45193857-45193879 TGTTGAGGACAGATGAAGAAGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175769665 20:61615806-61615828 TGGTGAGGACAAAGGGAGCTGGG + Intronic
1177991175 21:28038064-28038086 TGGGGAAGACAGATGAATCTAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178805101 21:35832903-35832925 CAGTGAGGACATATGATGTTTGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1181950721 22:26551658-26551680 GGGTGGGGACTGATGAGGCTGGG + Intronic
961455487 3:127021894-127021916 TGCTAAGGACAGGTGAAGCTTGG + Intronic
961463374 3:127067167-127067189 CAGTGAGCACAGGTAAAGCTAGG - Intergenic
961719567 3:128883907-128883929 CCATGAGGACAGGTGATGCTTGG + Intronic
963882532 3:150545486-150545508 CTGTGAGTACAAATTAAGCTGGG + Intronic
964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG + Intergenic
966592744 3:181699767-181699789 CGGTGAGAAGTGATCAAGCTTGG + Intergenic
969258524 4:6019398-6019420 GAGTGAGGACAGAGGAGGCTGGG + Intergenic
969661980 4:8535687-8535709 GGGTGAGGACAGATGCAGACAGG - Intergenic
971431511 4:26572842-26572864 GAGTGAGGACATATGATGCTTGG + Intergenic
971574253 4:28253909-28253931 CAGTGAGGAGGGATGAATCTGGG - Intergenic
971712642 4:30136152-30136174 CTGTGAGGCCAGATGAATCTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975591845 4:76008889-76008911 CAGTGAGAACAGATGATGATTGG - Intergenic
982322278 4:154090007-154090029 AGGTGAGTTCAGATGAAGATAGG + Intergenic
984428174 4:179614544-179614566 CTGTGAGGACACAGCAAGCTAGG + Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
988506770 5:31830588-31830610 CTGTGATGACAGAGGAATCTGGG - Intronic
991018949 5:61960116-61960138 GGATGAGGACTGGTGAAGCTGGG - Intergenic
994261602 5:97665774-97665796 CTGTGAGCAGAAATGAAGCTTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
997472855 5:134126316-134126338 GTGTGGGGACAGATGAACCTGGG + Intronic
997955568 5:138275949-138275971 AGGTGAGGGAACATGAAGCTGGG + Intergenic
1000234053 5:159341252-159341274 AGGTGTGGACAGATGAAGGCTGG + Intergenic
1001310679 5:170608055-170608077 GAGTGAGGACAGAAGAAGGTAGG + Intronic
1002089187 5:176794465-176794487 TGGTGGGGACAGAGGAAGCAGGG - Intergenic
1002134072 5:177097441-177097463 CGGTCAGGCCAGATGAGGCCTGG - Intronic
1002551320 5:179994976-179994998 TGGTGGGGAGAGGTGAAGCTGGG + Intronic
1003246518 6:4386665-4386687 CGGTGAGGAAAGAGGAAGAAGGG + Intergenic
1003390557 6:5709328-5709350 CTGTGAGGGCAGGTGCAGCTGGG - Intronic
1003407997 6:5839077-5839099 AGGTGAGGACAGATGAGGCTAGG + Intergenic
1003408006 6:5839126-5839148 AGGTGAGGGCAGATGAGGTTAGG + Intergenic
1003408020 6:5839195-5839217 AGGTGAGAGCAGATGAGGCTAGG + Intergenic
1003639621 6:7865635-7865657 CTGTGAGGCCAGATGTTGCTGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006408911 6:33860789-33860811 AGGGGAGGACAGATGAAGGTTGG - Intergenic
1006523839 6:34587741-34587763 CCGTGAGGACAGTTGAATTTGGG - Exonic
1006912404 6:37571934-37571956 CGGTGAGCACAGATGGTGCAAGG - Intergenic
1007230648 6:40345493-40345515 TGGGGAGGACAGAGGAGGCTGGG + Intergenic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1011660943 6:89593313-89593335 ATGTGGTGACAGATGAAGCTGGG + Intronic
1013822658 6:114174075-114174097 GAGTGGGAACAGATGAAGCTGGG - Intronic
1016311380 6:142737462-142737484 AGGTGAGAAATGATGAAGCTGGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018380071 6:163251018-163251040 CAGTGAGAACATATGATGCTTGG - Intronic
1030469018 7:109939400-109939422 CTGTGATGACAGGTGCAGCTTGG + Intergenic
1034945521 7:155259415-155259437 GGGTGAGGACAGATGGGGATGGG + Intergenic
1035055228 7:156030847-156030869 CGGTGAGCACAGGTGAAGACAGG + Intergenic
1036047712 8:5162345-5162367 CTGTGAGGATATATGAAGCCAGG + Intergenic
1041163930 8:55072640-55072662 CTCTGAGGACAGATAAAGCTGGG - Intergenic
1042729569 8:71917129-71917151 TGGTCAGCACAGTTGAAGCTGGG + Intronic
1043548466 8:81341352-81341374 AGGTGTGGACAGAAGGAGCTAGG - Intergenic
1043849507 8:85199876-85199898 CGATGAGGCCAGCTGAAGATAGG + Intronic
1044036199 8:87306669-87306691 CGGTGAGAACATATGATGTTTGG - Intronic
1044262553 8:90144068-90144090 AGGTGAGGAAAGTTGAAGCAGGG + Intergenic
1044558695 8:93591521-93591543 CTGTCAGGTCAGATGAAGCCTGG - Intergenic
1047209689 8:122831362-122831384 AGGTGAGGACAAGTGAGGCTAGG + Intronic
1047411765 8:124629964-124629986 CGCTGAGGACAGATGTGGCAAGG + Intronic
1049158046 8:141078866-141078888 CTGTGAGGACGGCTGGAGCTGGG - Intergenic
1053001027 9:34577509-34577531 AGGTGTGGACAAATGAAGCCAGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1056950907 9:91039986-91040008 CGGTCAGAACAGATGGAGGTGGG + Intergenic
1058495548 9:105554968-105554990 TGGGAAGTACAGATGAAGCTTGG + Intergenic
1060374506 9:123106411-123106433 GGGTGATGAGAGATGAAACTGGG + Intergenic
1060424265 9:123491816-123491838 GGGTGAGGACAGAAGGAGTTTGG - Intronic
1060879771 9:127109961-127109983 CGGTGAGGACTGCTGGAGCAAGG - Intronic
1061623303 9:131825324-131825346 GGGTGGGGAGAGATGAGGCTGGG - Intergenic
1061935240 9:133853790-133853812 TGGTGAGGACAGGTGAAGGGAGG - Intronic
1062291289 9:135796328-135796350 GGCTGAGGACTGCTGAAGCTGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188306754 X:28568599-28568621 CAGTGAAGACAGATGAATCAGGG - Intergenic
1189414203 X:40800646-40800668 CGGTGAGAACATATGATGTTTGG - Intergenic
1191712161 X:64161566-64161588 GGATAAGGACAGATGAAACTGGG + Intergenic
1194434830 X:93856615-93856637 CAGTGAAGAGAGAGGAAGCTGGG - Intergenic
1194697545 X:97073237-97073259 CTGTCAGGCCAGATGAAACTTGG + Intronic
1195823447 X:108971399-108971421 CAGTGAGGACATATGATGTTTGG - Intergenic
1197701838 X:129605619-129605641 CTGTGAGGTCACAAGAAGCTTGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201798508 Y:17927456-17927478 GGGTGATGACAGCAGAAGCTCGG - Intergenic
1201803045 Y:17978501-17978523 GGGTGATGACAGCAGAAGCTCGG + Intergenic