ID: 1083414674

View in Genome Browser
Species Human (GRCh38)
Location 11:62517819-62517841
Sequence GGTCTGAAAGGTTCAGAAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083414674_1083414679 13 Left 1083414674 11:62517819-62517841 CCTACTTCTGAACCTTTCAGACC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1083414679 11:62517855-62517877 GGCCCAGAAATCTGCCCAGTTGG 0: 1
1: 0
2: 0
3: 20
4: 319
1083414674_1083414676 -8 Left 1083414674 11:62517819-62517841 CCTACTTCTGAACCTTTCAGACC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1083414676 11:62517834-62517856 TTCAGACCACCTTTGATTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 173
1083414674_1083414680 14 Left 1083414674 11:62517819-62517841 CCTACTTCTGAACCTTTCAGACC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1083414680 11:62517856-62517878 GCCCAGAAATCTGCCCAGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083414674 Original CRISPR GGTCTGAAAGGTTCAGAAGT AGG (reversed) Exonic
900304143 1:1995006-1995028 GCTGTGAAAGGTTCAGGACTGGG + Intronic
901856621 1:12048492-12048514 GATCTGAAAGGTTCCTAAGCAGG - Intergenic
907048719 1:51315568-51315590 GGTCTGAAAGGACCAGAAAGTGG - Intronic
907818807 1:57946711-57946733 GGTCTGAAAGGGTAAGAAGAGGG - Intronic
917902891 1:179560694-179560716 AGTCTGAAAGGTTTAGTAGTGGG - Intronic
918130659 1:181625559-181625581 GGTGAGAAAGCTGCAGAAGTTGG - Intronic
918513997 1:185342277-185342299 GATCAGAAAGATTCAGAGGTGGG + Intergenic
918686832 1:187427872-187427894 TGTCTGAAAGGTTGAGGAGCTGG - Intergenic
921756185 1:218858355-218858377 CGTCTGAAAGTTTAAGAATTTGG - Intergenic
1063738229 10:8786888-8786910 AGTCTGAAGGCTTCAGAAGCAGG + Intergenic
1064043434 10:11988893-11988915 GGTCTGGAAGAATCAGAAATGGG + Intronic
1065359589 10:24877055-24877077 TTCCTGAAAGGTTCAGGAGTAGG - Intronic
1065555283 10:26909066-26909088 GGTCTAAAACGTTCAGCAGATGG + Intergenic
1067692152 10:48508792-48508814 GCTCTGACAGGTCCAGAAGCTGG + Intronic
1068414925 10:56708235-56708257 ACTCTGAGAGGCTCAGAAGTAGG - Intergenic
1068711261 10:60136730-60136752 GGTCTGGAATGATCAGAAGTAGG - Intronic
1070615609 10:77967267-77967289 GTTCAGAAAGGTTCAGAAAGTGG - Intergenic
1074261896 10:111862486-111862508 GGTCTCAAGGGGTCAGATGTGGG + Intergenic
1074506492 10:114075465-114075487 TGTCAGAAAGATTCAGACGTGGG + Intergenic
1075608587 10:123834044-123834066 GGCCCGAAAGGCTCAGAAATAGG + Intronic
1075912716 10:126139688-126139710 GGGCTGGAAGGTTCAGATGCAGG + Intronic
1080382030 11:31781795-31781817 GGTATGAAAGGCTCAGGAATCGG - Intronic
1082789657 11:57338564-57338586 GGTCTCATAGGTGAAGAAGTCGG - Exonic
1083414674 11:62517819-62517841 GGTCTGAAAGGTTCAGAAGTAGG - Exonic
1085038721 11:73314520-73314542 GGTCTGTGAGGCTCAGAAGGAGG + Intronic
1086143631 11:83526407-83526429 GGAATGGAATGTTCAGAAGTGGG - Intronic
1094764301 12:33574380-33574402 TGCCTGAGAGGTTCAGGAGTTGG + Intergenic
1095324994 12:40878772-40878794 GATCTGAAAGATAAAGAAGTTGG - Intronic
1095374853 12:41514683-41514705 GGACTGAGTGGCTCAGAAGTTGG - Intronic
1095611459 12:44133442-44133464 GGTCTGAAATGTTCACAAGATGG + Intronic
1096646151 12:53037480-53037502 GGTTTGGGAGGTTTAGAAGTTGG - Exonic
1098571349 12:71991059-71991081 GGTATTAAAGGTTCTTAAGTTGG + Intronic
1104378212 12:128283921-128283943 GGGCTGAACTGTTCAGAAGCAGG + Intronic
1104702473 12:130917784-130917806 GGGCTGTGAGCTTCAGAAGTCGG + Intergenic
1104751476 12:131242803-131242825 GGTCAGGAAGGTTCAGCTGTGGG + Intergenic
1106628185 13:31442279-31442301 AGTCTAAAAGGGTCAGAAGCAGG + Intergenic
1106631234 13:31476453-31476475 AGTCTGAAAGCATGAGAAGTAGG - Intergenic
1113401992 13:110002683-110002705 GCTCTGAAGGGGTCACAAGTAGG + Intergenic
1113940120 13:114014631-114014653 GGTCGGCAAGGTTGAGAAGTGGG + Intronic
1117823599 14:59677123-59677145 GGTCAGAAAGCATCAGAAGGAGG - Intronic
1121576711 14:94994931-94994953 GATCTGAAAAGTTGTGAAGTAGG - Intergenic
1125287149 15:38105857-38105879 GATCTGGAAGGGTCAGAAGAAGG - Intergenic
1125475834 15:40047557-40047579 GGTCTGAAAGGGGCTGGAGTGGG - Intergenic
1126145042 15:45466096-45466118 AGTCCAAAAGGCTCAGAAGTAGG - Intergenic
1128691881 15:69730859-69730881 GTTCTGACAGGATCAGAAATAGG + Intergenic
1129557721 15:76530432-76530454 GGCTTGAAAGGTTCAGAACATGG - Intronic
1131900025 15:97077665-97077687 GCTATGAAAAGTTCTGAAGTAGG - Intergenic
1133072837 16:3257802-3257824 GGTATGCAACGGTCAGAAGTAGG - Intergenic
1140086706 16:71803524-71803546 AGTTTGAAGGGTCCAGAAGTGGG - Intronic
1143265672 17:5635283-5635305 GCTCTGACAAGTTCAGAACTGGG + Intergenic
1144396799 17:14852210-14852232 GTTCTTAAAGGTTAAGAAGAGGG + Intergenic
1147572001 17:41577090-41577112 GGTCTGATAGGGTCTGAATTGGG - Intergenic
1147977773 17:44257902-44257924 GGTCAGACAGAGTCAGAAGTTGG + Intronic
1149127482 17:53253955-53253977 AGTCTGAAGGGTGAAGAAGTAGG + Intergenic
1151080720 17:71325428-71325450 GGTCTGATAGGTTCAGGATGGGG - Intergenic
1151979818 17:77502188-77502210 GGTCTGAATGGATGAGAATTTGG + Intergenic
1152115733 17:78385941-78385963 GGTCAGAGCGGTTCAGATGTGGG + Intronic
1155873933 18:31061862-31061884 GGACTGAAATCTTGAGAAGTAGG - Exonic
1156474071 18:37394712-37394734 GGACTGAAGGGTCCAGAAGGAGG + Intronic
1160041559 18:75350140-75350162 GATCAGATCGGTTCAGAAGTGGG + Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1163623301 19:18373550-18373572 GGTGTGAGAGGCTCAGCAGTTGG - Intergenic
925227590 2:2199116-2199138 CTTTGGAAAGGTTCAGAAGTGGG + Intronic
925876764 2:8317887-8317909 ATTCTGTAAGGTTCAGAATTGGG + Intergenic
928241295 2:29589051-29589073 GGTCTGAGAGCTTTAGAGGTGGG + Intronic
929129185 2:38549581-38549603 ACTCTGAAAGGTTCAGGAATCGG - Intergenic
929776223 2:44932716-44932738 GTCCTGAAAGGTTAAGAAATTGG - Intergenic
930111864 2:47685569-47685591 TGTCTGAGAGGGTCAGATGTGGG - Intergenic
931528962 2:63190913-63190935 GGTCTGAAAGATCCTGAATTGGG + Intronic
932160804 2:69457586-69457608 GGTCTTAAATTTTCAGAAGTAGG + Intergenic
933203820 2:79482249-79482271 GGTCTCAAAGGATTAGGAGTTGG + Intronic
936621459 2:114102148-114102170 GGTCGGAAAAGTGCAGTAGTAGG + Intergenic
937957455 2:127429382-127429404 GGTCTGAAAGGTTTACATGGTGG + Intergenic
939155995 2:138524936-138524958 GGTCTGGAGGGCTCAGAAGGAGG - Intronic
939701325 2:145395804-145395826 GTTCTGAAAGGATTAGAATTAGG - Intergenic
943581005 2:189683502-189683524 GGTCTGAAAGGATGTGAGGTAGG + Intronic
946178772 2:217937696-217937718 GGGCTGAAAGGTGCAGGGGTGGG - Intronic
947153760 2:227139823-227139845 GCTCTGAGAGGTACTGAAGTTGG - Intronic
1169572913 20:6926041-6926063 AGACTGAAACCTTCAGAAGTGGG - Intergenic
1173405122 20:42757696-42757718 TGTCTGAAAGCTTCCCAAGTTGG + Intronic
1173743205 20:45416861-45416883 GGTCTGAAAGTTTTAGGATTGGG - Intronic
1176155357 20:63617386-63617408 GGTCTGCCAGGTTCAGCTGTTGG - Intronic
1179597211 21:42450962-42450984 ATTCTGCAAGGATCAGAAGTCGG + Intergenic
1181329881 22:22081677-22081699 TGTCTGCATGGTTCAGAAGTGGG + Intergenic
1183183589 22:36278272-36278294 CTTCAGGAAGGTTCAGAAGTAGG + Intergenic
1183716854 22:39538188-39538210 GGTCTGGAAGGATCAGAAGATGG - Intergenic
1184808411 22:46811749-46811771 GGACTGATAGTTTCAGAAGAAGG + Intronic
953558324 3:43964589-43964611 GGTCTGAAAGGTTCAGCAGCTGG + Intergenic
954393244 3:50278587-50278609 GCTCTGATAGCTTCACAAGTGGG - Intergenic
954518130 3:51198247-51198269 GGTGTGCAAGGTGCAGAAGCAGG - Intronic
954758160 3:52853973-52853995 GGTGGTAAAGCTTCAGAAGTAGG - Intronic
954839275 3:53496085-53496107 GGTCTGAAAGCCTGAGAAGAGGG - Intronic
955333077 3:58063427-58063449 GGGCTGAAAGGTCCAGATTTGGG + Intronic
957145324 3:76415344-76415366 TGTCTGAAAGGCTCTGAAGAAGG + Intronic
960912336 3:122661979-122662001 GGTTTGAGACGTTTAGAAGTTGG - Intergenic
967428040 3:189350179-189350201 GGTTTAAAAGGATCAGAAGCTGG + Intergenic
967759272 3:193205385-193205407 TATTTGAAAGGTTCAGGAGTTGG + Intergenic
968261230 3:197325812-197325834 AGTGTGAAAGGTTAAGAAGATGG - Intergenic
972823594 4:42730942-42730964 GGTCAGAAAAGTGGAGAAGTGGG + Intergenic
973225642 4:47780736-47780758 TGTTTGAAAGTTTCAGAGGTGGG + Intronic
977846709 4:101775635-101775657 AGTCTGAAAGTTTCAGAACCAGG + Intronic
981567411 4:146115469-146115491 GGGCTGGAAGGTTCAGGATTAGG - Intergenic
981633498 4:146848831-146848853 GGTCTGAAAGGGTGGAAAGTTGG + Intronic
983437136 4:167730408-167730430 AGTTTGAAAGGCTCAGAAGAAGG + Intergenic
983785130 4:171720668-171720690 GGTCTGAAAGCTGAAGAACTTGG - Intergenic
984541831 4:181048211-181048233 AGTCTGAAAGGTTCAGGGGAGGG - Intergenic
984670467 4:182479193-182479215 AGTCTGTAATTTTCAGAAGTGGG + Intronic
986993561 5:13580279-13580301 AGTCTGAAAGCTTCACAACTGGG - Intergenic
988630810 5:32929394-32929416 GGACTGAAATGTTAAGAATTTGG - Intergenic
992103145 5:73426622-73426644 AATCTGAAAGCTTCAGAACTAGG - Intergenic
992662479 5:78975129-78975151 GGACTTTGAGGTTCAGAAGTGGG - Intronic
992715560 5:79507998-79508020 GCCCTGGAAGGTTCCGAAGTGGG - Intronic
994131721 5:96236508-96236530 GGTCTGAAATGTGCATAAATAGG + Intergenic
995505757 5:112859378-112859400 GGTGAGGAAGCTTCAGAAGTGGG - Intronic
995766615 5:115626010-115626032 GGCCTGAGAGGGTCGGAAGTGGG + Exonic
996308029 5:122073135-122073157 GGTATGAAGGGATCAGCAGTTGG - Intronic
996464952 5:123789446-123789468 GGTCTGAAAGCTTCAAAGGATGG + Intergenic
996602107 5:125276610-125276632 TTTCTGAAAAGTTCAGAAGTTGG + Intergenic
997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG + Intronic
997237381 5:132280726-132280748 CATCTTTAAGGTTCAGAAGTAGG - Intronic
997813671 5:136996157-136996179 GGACTGAAGCTTTCAGAAGTGGG + Intronic
999990950 5:157049300-157049322 GAGCCGAAAGGTTCAGAAGTGGG - Intronic
1001804946 5:174575982-174576004 GCTCTGTAAGTTTTAGAAGTGGG + Intergenic
1002302052 5:178262845-178262867 AGTCTGTAAGGTTCAGAGTTAGG + Intronic
1002844522 6:935117-935139 GGCCTGAAAGGATGAGAACTTGG + Intergenic
1003150662 6:3546159-3546181 GGTCTGAAAGCCTGAGAACTAGG + Intergenic
1003170380 6:3717105-3717127 TGACTGAAATGTTCAGATGTGGG - Intergenic
1003409603 6:5850937-5850959 GGAATGAAAGGTTCAGAGGTTGG + Intergenic
1003858506 6:10300022-10300044 GGGCTGATTGGTTCAGGAGTGGG + Intergenic
1004720334 6:18263803-18263825 GGTCTGAAAAATTCATCAGTTGG + Intronic
1005501530 6:26432958-26432980 AGTCTGAAAGCCTCAGAACTAGG - Intergenic
1007028746 6:38606174-38606196 AGTCTGAAAACTTCAAAAGTAGG - Intronic
1007274400 6:40662788-40662810 GGGCTGGAAGGTTCAGAGGCTGG + Intergenic
1007468301 6:42070872-42070894 GGTATGAAATGTCCAGAAGAAGG - Intronic
1007582523 6:42967902-42967924 GGACTGAAAGGCTGAAAAGTAGG + Intronic
1007595664 6:43049815-43049837 GGTCTGGAATTTTCAGAGGTGGG - Intronic
1013416107 6:109926099-109926121 GGCCAGAAAGCATCAGAAGTAGG + Intergenic
1017649587 6:156568672-156568694 GTTCTGAAAGGTGCAGCGGTTGG - Intergenic
1019175360 6:170156779-170156801 GGCCTGAATGGTGCAGAACTTGG + Intergenic
1019268841 7:134605-134627 GGCCTGCAAGATTCAGAAGCCGG - Intergenic
1021900394 7:25279459-25279481 GGTCTGAAAGCCTCAGAACCAGG - Intergenic
1024137195 7:46422193-46422215 GCTGTGAAAGGTTCTGAAGATGG + Intergenic
1024645484 7:51367304-51367326 GGTCTGCAAGGTTCAGTCCTGGG - Intergenic
1026244002 7:68602174-68602196 TCTCTGACAGATTCAGAAGTGGG - Intergenic
1029001106 7:97155425-97155447 AGTCTAAAAGGATAAGAAGTTGG - Intronic
1029958922 7:104669118-104669140 GGTTTGGGAGGTTTAGAAGTTGG - Intronic
1029970273 7:104781673-104781695 AGTCTGATAAGTTCAGAAGATGG - Intronic
1031284084 7:119842418-119842440 AGTTTGAAGGGTTCAGAAGAAGG + Intergenic
1031918065 7:127581740-127581762 GGACTGAGAAGTGCAGAAGTTGG - Exonic
1033555270 7:142483421-142483443 GGCTTGTAAGGATCAGAAGTGGG + Intergenic
1033557434 7:142500925-142500947 GGCTTGTAAGGATCAGAAGTAGG + Intergenic
1033559870 7:142520958-142520980 GGCTTGTAAGGATCAGAAGTAGG + Intergenic
1034979235 7:155465752-155465774 TTTCTGAACTGTTCAGAAGTCGG - Intergenic
1035570780 8:671062-671084 GGGCTGGCAGGTTCAGAGGTCGG - Intronic
1038143881 8:24875931-24875953 GGTCAGCAAGTTTCAGAAGCTGG + Intergenic
1038728841 8:30108370-30108392 GTTCTGAAAATTTAAGAAGTAGG - Intronic
1039028334 8:33282550-33282572 TGGCTGAAAGGTTCAGGATTGGG + Intergenic
1039607099 8:38890152-38890174 GGTGTCAAAGGTTATGAAGTGGG - Intergenic
1040859479 8:51984268-51984290 GGTCTGCAAGGTGCAGAGGCAGG - Intergenic
1042050096 8:64694465-64694487 AGTCTGAAAGGTGCAGAGGTAGG + Intronic
1044936243 8:97295883-97295905 GGTCTGAAAAGGTCAGTATTCGG - Intergenic
1045815379 8:106271142-106271164 GGCCTGAAAGGTTCAGGAGAGGG + Intronic
1048836542 8:138524306-138524328 GCTCTGAAAGGCTCTGAAATTGG + Intergenic
1051331096 9:16025718-16025740 TATCTGAAATGTCCAGAAGTGGG + Intronic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1057563494 9:96147398-96147420 GGTTTGGGAGGTTTAGAAGTTGG - Intergenic
1058843836 9:108935962-108935984 GCTCTGAACAGTTCAGTAGTTGG - Intronic
1059633164 9:116146788-116146810 GGTATGAGAGTTTCAGAAGAGGG + Intergenic
1061690763 9:132326817-132326839 GGTCTCAAAGGTTTAGATGCAGG + Exonic
1186365721 X:8891183-8891205 GGTCTGAAAGCCTAAGAAGAAGG - Intergenic
1188499354 X:30808878-30808900 GGACAGAGAGGTTCAGCAGTGGG - Intergenic
1190544569 X:51512231-51512253 GATCTGGAAGGTTGAGAAGTTGG - Intergenic
1190768858 X:53498589-53498611 GGTCTGAAAGACTCATAAGAAGG + Intergenic
1191904554 X:66074968-66074990 GGTTTGGGAGGTTTAGAAGTTGG + Intergenic
1192330776 X:70173552-70173574 GCTCTAACAGGTTGAGAAGTGGG - Intergenic
1194542253 X:95189506-95189528 GATCTGAAAGTTTCATAAGGGGG - Intergenic
1194563189 X:95448016-95448038 GGTTTGAAAGGCTCAAAAGAAGG - Intergenic
1196079919 X:111620111-111620133 GGTTTGGGAGGTTTAGAAGTTGG + Intergenic
1198428065 X:136539624-136539646 GCCCTGAAATGTTTAGAAGTTGG - Intronic
1199291363 X:146108276-146108298 GGTCTCAAAGGTTTTTAAGTGGG - Intergenic
1201277751 Y:12314451-12314473 AATATGAAAGCTTCAGAAGTTGG + Intergenic
1201357640 Y:13113758-13113780 AATATGAAAGCTTCAGAAGTTGG + Intergenic