ID: 1083415288

View in Genome Browser
Species Human (GRCh38)
Location 11:62521591-62521613
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 2, 1: 2, 2: 3, 3: 25, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083415288_1083415296 18 Left 1083415288 11:62521591-62521613 CCACATCACCCTTCACCTTGGGA 0: 2
1: 2
2: 3
3: 25
4: 226
Right 1083415296 11:62521632-62521654 AAGTCAGGCATGGAGATCTTGGG 0: 4
1: 4
2: 16
3: 21
4: 232
1083415288_1083415293 3 Left 1083415288 11:62521591-62521613 CCACATCACCCTTCACCTTGGGA 0: 2
1: 2
2: 3
3: 25
4: 226
Right 1083415293 11:62521617-62521639 TTCAGATGCAAATCAAAGTCAGG 0: 4
1: 2
2: 1
3: 23
4: 219
1083415288_1083415295 17 Left 1083415288 11:62521591-62521613 CCACATCACCCTTCACCTTGGGA 0: 2
1: 2
2: 3
3: 25
4: 226
Right 1083415295 11:62521631-62521653 AAAGTCAGGCATGGAGATCTTGG 0: 4
1: 4
2: 6
3: 36
4: 225
1083415288_1083415294 8 Left 1083415288 11:62521591-62521613 CCACATCACCCTTCACCTTGGGA 0: 2
1: 2
2: 3
3: 25
4: 226
Right 1083415294 11:62521622-62521644 ATGCAAATCAAAGTCAGGCATGG 0: 4
1: 0
2: 6
3: 46
4: 567
1083415288_1083415298 20 Left 1083415288 11:62521591-62521613 CCACATCACCCTTCACCTTGGGA 0: 2
1: 2
2: 3
3: 25
4: 226
Right 1083415298 11:62521634-62521656 GTCAGGCATGGAGATCTTGGGGG 0: 6
1: 13
2: 1
3: 14
4: 237
1083415288_1083415297 19 Left 1083415288 11:62521591-62521613 CCACATCACCCTTCACCTTGGGA 0: 2
1: 2
2: 3
3: 25
4: 226
Right 1083415297 11:62521633-62521655 AGTCAGGCATGGAGATCTTGGGG 0: 4
1: 3
2: 13
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083415288 Original CRISPR TCCCAAGGTGAAGGGTGATG TGG (reversed) Exonic
900698916 1:4031989-4032011 ACCCAAGGCTATGGGTGATGTGG - Intergenic
900820940 1:4888112-4888134 TCTCAAGGTCCAAGGTGATGAGG - Intergenic
901742554 1:11351834-11351856 TCCCAGGAGGAAGGGCGATGTGG + Intergenic
903868251 1:26413418-26413440 TCCTAAGGTGAAGCCTGCTGAGG - Intronic
904445219 1:30567808-30567830 TCCCATGTTGTAGGTTGATGAGG - Intergenic
905016087 1:34779859-34779881 TCTGAAGGTCAAGGGTCATGGGG + Intronic
905096141 1:35472684-35472706 TCCAAAGGTTGGGGGTGATGAGG - Intronic
906375437 1:45292999-45293021 TGCCAAGGTGAAAGGTATTGGGG + Intronic
907002034 1:50870748-50870770 TCCCAAGGAGGAGAGAGATGGGG - Intronic
909844402 1:80373536-80373558 TACCAAGTTGAAGGCTGAAGAGG - Intergenic
910451262 1:87348265-87348287 TTCCCTGGTGAAGGGTGAAGGGG - Exonic
911528909 1:99020184-99020206 TCACAAGGTGAAGGGATAGGAGG + Intergenic
917269169 1:173254674-173254696 TCACCAGATCAAGGGTGATGGGG + Intergenic
918215478 1:182389860-182389882 CCCCAAGGGGAAGGGTGGTGAGG - Intronic
919834008 1:201561316-201561338 TCCCAGCCTAAAGGGTGATGTGG + Intergenic
919920833 1:202165622-202165644 TCCCCAGGTGAGGTGGGATGAGG + Intergenic
920866600 1:209758645-209758667 TCCCAGGGTGGTGGGTAATGAGG + Exonic
921254269 1:213325342-213325364 TCCCTGGGTGGAGGGTGATAAGG + Intergenic
1065315462 10:24459502-24459524 GCCCAGGGTTAAGGCTGATGAGG - Intronic
1068994818 10:63190691-63190713 TTCCAAGGTGAAAGGTGGAGGGG - Intronic
1071802797 10:89083297-89083319 TCCCAAACTGAAGCCTGATGGGG - Intergenic
1072759119 10:98041342-98041364 TACCATGGTGTAGGTTGATGGGG + Intergenic
1073150583 10:101308764-101308786 TCCCAGGGAGATGGGGGATGGGG - Intergenic
1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG + Intronic
1074437588 10:113447109-113447131 TCCCAAGGAGAAGAATGGTGGGG - Intergenic
1076457466 10:130610540-130610562 TGCCAAGGGGAAGGGAGAGGAGG - Intergenic
1076572831 10:131443842-131443864 TCAAAAGGTGTAGGGAGATGTGG - Intergenic
1076686029 10:132198844-132198866 TCCCCAGGTGGAGGCTGAGGCGG + Exonic
1076767329 10:132643792-132643814 ACCCAAGGTGATGGATGCTGTGG - Intronic
1077232020 11:1462005-1462027 TCCAAAGGTGAAGGGGTAGGAGG + Intronic
1078725346 11:13925257-13925279 TCCCAATGAGAAGGATGAGGTGG - Intergenic
1080888623 11:36389304-36389326 TTGCAAGGTGATGGGTGGTGGGG - Intronic
1081186696 11:40051624-40051646 CCCCAAGTTGAAAGTTGATGGGG + Intergenic
1081715456 11:45246832-45246854 GCAGAAGGTGAAGGGTAATGGGG - Intronic
1081811332 11:45915740-45915762 TGCCAAGGTGTGGGGTGAAGTGG - Exonic
1083415061 11:62520199-62520221 ACCCAAAGTGAAGGGCGATGTGG - Exonic
1083415126 11:62520583-62520605 TCCAAAGGTGAAGGGCGACATGG - Exonic
1083415185 11:62520985-62521007 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415220 11:62521207-62521229 TCCCAAAGTGAAAGGTGATGTGG - Exonic
1083415288 11:62521591-62521613 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415352 11:62521975-62521997 TCCAAAGATGAAGGGCGACGTGG - Exonic
1083415415 11:62522359-62522381 CCCTAAGGTGAAAGGAGATGTGG - Exonic
1083415474 11:62522743-62522765 ACCCAAAGTGAAGGGTGATATGG - Exonic
1083415540 11:62523127-62523149 CCCCAAAGTCAAGGGCGATGTGG - Exonic
1083415578 11:62523349-62523371 ACCCAAAATGAAGGGTGATGTGG - Exonic
1083415638 11:62523733-62523755 CCCCAAGGTGAAAGGTGATGTGG - Exonic
1083415815 11:62525089-62525111 TCCCAAAGTGAAGGGTGACATGG - Exonic
1083415886 11:62525473-62525495 TCCCAAGGTGAAGGGCGATGTGG - Exonic
1083416008 11:62526241-62526263 ACCCAAAGTGAAGGGTGATGTGG - Exonic
1083416079 11:62526625-62526647 TCCCAAGGTGAAGGGCGATGTGG - Exonic
1086284770 11:85234404-85234426 TCTCTAGGTGTAGGCTGATGAGG + Intronic
1087641417 11:100759169-100759191 TAGCAAGCTGCAGGGTGATGGGG - Intronic
1088456771 11:110041148-110041170 GCCCAAGGTCAAGAGTGATGGGG + Intergenic
1089184192 11:116603761-116603783 TCCCCAGGTGAAGGAAGAAGGGG + Intergenic
1092081992 12:5723962-5723984 TCCCAAGCTGAAGGGCGGTTGGG - Intronic
1092682054 12:10994185-10994207 TCCCAAATGGAAGGGTGATGTGG - Intronic
1096823838 12:54259254-54259276 TTCCAAGGTGAGTGGTGGTGGGG - Intronic
1098981458 12:76961287-76961309 ACCCAGGCTGAAGGGTAATGGGG + Intergenic
1100376247 12:94018554-94018576 TCCCATGGTGGAGGATGAGGGGG - Intergenic
1100982212 12:100170726-100170748 TGCCAAGTTGAAGGATGATGGGG + Intergenic
1101027176 12:100621843-100621865 TTCGAAGATGAAGGGTGGTGGGG + Intronic
1101959395 12:109237296-109237318 TGCCAAGGTGAAGGAAGGTGTGG + Exonic
1103818182 12:123675740-123675762 TACCAAGTTGGAGGATGATGTGG + Intronic
1104419802 12:128625838-128625860 CCCCAAGGTGATGGGTTAGGAGG - Intronic
1105209236 13:18248025-18248047 TCCCAGGGTCAAGGGTGAAGGGG - Intergenic
1106769103 13:32944628-32944650 CCCCAGGATGAAAGGTGATGGGG - Intergenic
1107823991 13:44311235-44311257 TCTCAAGGTGGAGAGTGGTGGGG - Intergenic
1108532870 13:51343864-51343886 GTCCAGGGTGCAGGGTGATGGGG - Intronic
1108636373 13:52339019-52339041 TCCCAAGGTCAAGGGAGCTAGGG - Intergenic
1109020735 13:57088576-57088598 TCCCAGGGTGGAATGTGATGGGG - Intergenic
1113754347 13:112799504-112799526 TCACAAGGTGCAGGGTGGGGAGG + Intronic
1114995286 14:28342941-28342963 TCCCAAGGTGGATGGTCAGGAGG + Intergenic
1115390187 14:32845462-32845484 TCCAAAGGTGATGTGTGATGTGG + Intergenic
1115513588 14:34162653-34162675 TCCCAGGGGGTAGGGTGGTGTGG + Intronic
1116366574 14:44074308-44074330 TGACAAGGTAAAGGGTGAGGAGG - Intergenic
1116405862 14:44565577-44565599 TTCTAAAGTGAACGGTGATGTGG + Intergenic
1117024157 14:51602997-51603019 TCCCAAGGTATTAGGTGATGGGG + Intronic
1117753344 14:58946546-58946568 CCCCATGGTGAAGGGTTTTGTGG - Intergenic
1118907454 14:70033009-70033031 TCCCAAGGGGATGGCTGAGGCGG - Intergenic
1122117693 14:99535928-99535950 TCCCAAGGGGAAGGGTGCCCTGG + Intronic
1122290463 14:100678026-100678048 TCCCAGGGTGGAGGGTTAGGAGG + Intergenic
1122931944 14:104937235-104937257 TCCCATGCTGAAGGCTGCTGAGG - Exonic
1123061404 14:105596344-105596366 CACCAAGGTGGAGGCTGATGGGG - Intergenic
1123469308 15:20538417-20538439 TGCCAGGTTGAAGGATGATGGGG + Intronic
1123648755 15:22462281-22462303 TGCCAGGTTGAAGGATGATGGGG - Intronic
1123682556 15:22773156-22773178 TGCCAGGTTGAAGGGTGACGGGG + Intronic
1123729582 15:23133404-23133426 TGCCAGGTTGAAGGATGATGGGG + Intronic
1123747749 15:23330886-23330908 TGCCAGGTTGAAGGATGATGGGG + Intergenic
1123762535 15:23443942-23443964 TGCCAGGTTGAAGGATGATGGGG + Exonic
1123989290 15:25671501-25671523 TCTGAAAGTGAAGGGTGATGAGG + Intergenic
1124280117 15:28354737-28354759 TGCCAGGTTGAAGGATGATGGGG + Intergenic
1124302583 15:28556874-28556896 TGCCAGGTTGAAGGATGATGGGG - Intergenic
1124431962 15:29615641-29615663 TCCCAAGATGAGAGGGGATGGGG + Intergenic
1125746599 15:42001277-42001299 TTCCAGGCTGAAGGGAGATGAGG + Intronic
1125751102 15:42029560-42029582 TACCAAAGTGATGGGTGATAAGG - Intronic
1127718268 15:61673403-61673425 TAGCTGGGTGAAGGGTGATGTGG - Intergenic
1128435019 15:67638216-67638238 TCAGAAGGTGGAGGGTGAAGTGG - Intronic
1128767059 15:70257709-70257731 CCCCAAGGTCCAGGGTGAGGAGG + Intergenic
1129029638 15:72609008-72609030 TGCCAGGTTGAAGGATGATGGGG - Intergenic
1129520319 15:76181978-76182000 TCTCAGGGTGAATGGTGCTGAGG - Intronic
1129729439 15:77921501-77921523 TGCCAGGTTGAAGGATGATGGGG + Intergenic
1129739053 15:77981145-77981167 TCCCCAAGAGAGGGGTGATGGGG + Intergenic
1131765566 15:95672009-95672031 TTCCTAGGTGAAGGGTCCTGTGG - Intergenic
1132323483 15:100945175-100945197 TCCCAAAGTGATGGGTCACGGGG + Intronic
1132360305 15:101207300-101207322 TCCCATTCTGAAGGGTTATGTGG - Intronic
1132906896 16:2287089-2287111 TCCTTAGGAGAAGGGTGATGGGG - Intronic
1132932683 16:2467046-2467068 TCCCAAGTTGAGGGCTGCTGGGG + Intergenic
1137379946 16:47987948-47987970 TCCCAAGGTGAAGAGAAAGGAGG - Intergenic
1138009216 16:53362182-53362204 TGCCAGGCTGAAGGATGATGGGG + Intergenic
1139298210 16:65921387-65921409 TAAACAGGTGAAGGGTGATGGGG - Intergenic
1140870491 16:79102015-79102037 ACCAAAGGTGGAGGGTGGTGGGG + Intronic
1141679865 16:85537710-85537732 TCCCATGGTGAAGGCCGAAGAGG + Intergenic
1145934440 17:28706626-28706648 TTCCCAGGTGAGGGGTGATGAGG + Intronic
1145961838 17:28891255-28891277 TCCCAAGGTCAAGGGTCTGGGGG + Intronic
1146304742 17:31722340-31722362 TCCCAAGGTCAATGCTGAAGAGG + Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1150302903 17:64060895-64060917 TCCACAGGTGAAGTATGATGAGG + Intronic
1150790325 17:68197207-68197229 TCCCCAGGTGAGGGGAGAAGGGG + Intergenic
1151988347 17:77558169-77558191 TCCCCAGGTGGAAGGTGAGGGGG + Intergenic
1152022289 17:77786519-77786541 TCCCTGTGTGAAGGGAGATGTGG - Intergenic
1152841140 17:82569053-82569075 TCCCTAGGGGAATGGTGATTAGG + Intronic
1153448975 18:5205494-5205516 TGCCAGGGTGAGGGGTGGTGTGG + Intergenic
1155020957 18:21896821-21896843 TCCCCAGGGGAGGGGAGATGGGG - Intergenic
1156476403 18:37408568-37408590 TCATAAAGTGAAGTGTGATGAGG - Intronic
1156708639 18:39914425-39914447 TCACAAAGTGAAGGTGGATGGGG - Intergenic
1158127714 18:54120366-54120388 TGCCAAGGTCACTGGTGATGTGG - Intergenic
1158899541 18:61949937-61949959 TCCGAAGGGGAATGGTGAGGGGG - Intergenic
1159556940 18:69955614-69955636 TCCCAAAGTGAAGGCCGAGGCGG + Intronic
1159971941 18:74666075-74666097 TCCGAAGGTGCATGGTGACGTGG + Intronic
1160730862 19:641074-641096 TCCCCAGCTGGACGGTGATGGGG + Intronic
1160792531 19:929334-929356 GCTCAAGCTGAAGGCTGATGGGG - Exonic
1161729211 19:5948682-5948704 TCCAAAGTTGAGGGGTGCTGAGG + Intronic
1161836299 19:6649360-6649382 TCCAGAGGTGAAGAGTGAGGAGG - Intergenic
1162583594 19:11545605-11545627 ACCCAAGCTGCAGGGAGATGAGG + Intronic
1163093144 19:15035391-15035413 GGCCAATGGGAAGGGTGATGGGG - Intergenic
1165898955 19:39159720-39159742 TAACAAGGTGAAGGTTGAGGGGG + Intronic
1167461107 19:49625212-49625234 TCCCAGGGCGATGGGTGCTGTGG - Intronic
925804574 2:7635600-7635622 GCCCACTGTGAAGGGTGATAAGG - Intergenic
927381992 2:22489853-22489875 TCCCCAGGTGAGGGTTGGTGTGG + Intergenic
929947102 2:46379984-46380006 TCTCAATGTGCAGGGTGAAGAGG + Intronic
934719229 2:96561691-96561713 TGCCAAGGTGGTGGGGGATGTGG - Intergenic
935105335 2:100038303-100038325 TCCCAAAGTGAATGGGGTTGGGG - Intronic
935189148 2:100761953-100761975 TGTCAAGGTGATGGGTGATGGGG - Intergenic
935333302 2:101993343-101993365 TAGTAAGGTCAAGGGTGATGAGG + Intronic
937309243 2:120891982-120892004 TCACAAGGTGCAGGGTGGGGTGG - Intronic
938140579 2:128791563-128791585 CCACCAGGTGAAGGGTGAAGAGG - Intergenic
938350293 2:130594225-130594247 TCCCAAGGTGGGGGGTGCTATGG - Intronic
943143249 2:184010031-184010053 TCCAAAGGTGAAGGGGGTCGTGG - Intergenic
945476497 2:210287880-210287902 TGCAAAAGGGAAGGGTGATGAGG - Intergenic
1168754785 20:308871-308893 CCCCAAGGGGAGGGGTGGTGGGG - Intergenic
1168974901 20:1957385-1957407 TCTCAAAGTGCAGGGTGGTGGGG + Intergenic
1169592120 20:7156219-7156241 TCTCTAGGTGCAGGGTGAGGAGG + Intergenic
1170974660 20:21150804-21150826 TCACCAGGTGCAGGGTGCTGTGG - Intronic
1171117753 20:22541019-22541041 TCCCAAGCTGAGGTGAGATGTGG + Intergenic
1171290406 20:23979738-23979760 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1172181026 20:33003534-33003556 TCCCAAGGTGCAGGGGGCTCCGG - Intronic
1172865681 20:38095361-38095383 ACCCCAGGTGATGGGAGATGAGG + Intronic
1174331696 20:49824904-49824926 CACCAAGGGGAAGCGTGATGAGG + Intronic
1175535819 20:59710687-59710709 TGCCAAGGTAAAGGTTAATGAGG - Intronic
1179904083 21:44413177-44413199 TCCCAAAGAGAAGGGAGACGTGG - Intronic
1180767021 22:18351272-18351294 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
1180779292 22:18511107-18511129 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1180812009 22:18768427-18768449 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1181198164 22:21202671-21202693 TCCCAGGGTCATGGGTGAAGGGG - Intergenic
1181401580 22:22653133-22653155 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
1181647972 22:24243984-24244006 TCCCAGGGTCATGGGTGAAGGGG - Intronic
1181703541 22:24634230-24634252 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
1181827461 22:25529634-25529656 TCCTATGGGGATGGGTGATGAGG - Intergenic
1182921603 22:34085231-34085253 TCCCAAGGGGAAGTGAGAGGAGG + Intergenic
1183218689 22:36497869-36497891 TCCTAAGATGAAGGCTGCTGTGG - Intronic
1183355808 22:37358780-37358802 CCCCCAAGTGAAGGGTGGTGTGG + Intergenic
1184493904 22:44826229-44826251 TAGCAAGGTGCATGGTGATGCGG - Intronic
1203228643 22_KI270731v1_random:92166-92188 TCCCAGGGTCATGGGTGAAGGGG + Intergenic
950041087 3:9919932-9919954 TACCATGGTGCAGGGTGTTGGGG + Intronic
950649240 3:14396812-14396834 TCCAGAGGTGAAGTGGGATGGGG - Intergenic
950730846 3:14955772-14955794 GCCCAAGTGTAAGGGTGATGTGG - Intronic
952843966 3:37671238-37671260 TCCTAAAGTCAAGGCTGATGAGG + Intronic
952887064 3:38018432-38018454 AGCCAAGGTGCAGGGTGAGGAGG - Intronic
953667993 3:44939915-44939937 GCCCAAGGAGAAGGGTAGTGTGG - Intronic
955423925 3:58768075-58768097 TTCCAAGGAGAAGGGGGAGGAGG - Intronic
956087599 3:65629112-65629134 TTTCAAGGTGATGGATGATGAGG + Intronic
959734354 3:109641049-109641071 TCCCAAGGTGCTGGGTAATATGG + Intergenic
965866149 3:173206232-173206254 TCCCAAGGTAAGTGGTGATAAGG + Intergenic
969244432 4:5923403-5923425 TAACAAGGGGAAGGGGGATGCGG + Intronic
974090771 4:57308586-57308608 TCCCAAGGAGCAGGGTAATGTGG - Intergenic
974821497 4:67071800-67071822 TCCCATGGCTAAGGGTGGTGCGG + Intergenic
975826031 4:78320362-78320384 TGCCAAAGTGGAGGGTGATGTGG + Intronic
978392495 4:108241911-108241933 TACCATGGGGAAGGGTTATGAGG + Intergenic
982092395 4:151891952-151891974 TCCAGAGGAGAAGGGTCATGAGG + Intergenic
983933535 4:173478596-173478618 TCCCAGGGTGAAGGGGTGTGGGG - Intergenic
984489298 4:180412273-180412295 ACTCAAGGTGAAGGGTTAGGAGG - Intergenic
985823259 5:2175308-2175330 ACCCAGGGTGAGGGGTGCTGTGG + Intergenic
987085387 5:14462919-14462941 TGACAAGGTAAAGGGGGATGAGG + Exonic
988306476 5:29499882-29499904 TCCCCAGGTAAGGGTTGATGTGG - Intergenic
988520874 5:31944708-31944730 TGCCAAGGTGGAGGGTGGGGTGG + Intronic
989639037 5:43565398-43565420 TCCCAAGGTTTAGGGGGTTGAGG + Intergenic
990261165 5:54023984-54024006 TCTCAGGGGAAAGGGTGATGGGG - Intronic
992368141 5:76114241-76114263 TCCCATGGTGATGGGGGATGGGG - Intronic
995525062 5:113044153-113044175 TCCCAAGGAGACGTGGGATGGGG - Intronic
995526510 5:113054744-113054766 GCCCAAGGTGAATGGTGACCAGG + Intronic
997065491 5:130554545-130554567 GCCAAAGGTGAAGGGGGATTAGG + Intergenic
999429159 5:151511116-151511138 TGCCAGGGTGAGAGGTGATGGGG + Intronic
999693646 5:154169812-154169834 TCTACAGGTGAAGGGTGCTGTGG + Intronic
1001655875 5:173349211-173349233 GCCCAAGGAGAAGGGAGATGGGG - Intergenic
1001755006 5:174161509-174161531 TCCCAAGATGAAGGGGGAAGAGG + Intronic
1003520419 6:6853943-6853965 GCCCAAGGTGAAAGCTAATGAGG + Intergenic
1003527954 6:6913614-6913636 TCCCAAGGTGCAGGGTGGCTGGG - Intergenic
1003528421 6:6917508-6917530 TTCCAAGTTGAGGGGTGAAGTGG - Intergenic
1004019524 6:11764115-11764137 TCACAAGCTGAGGGGTGCTGTGG - Intronic
1009414656 6:63402083-63402105 TGACAAGGTGAAGGTGGATGTGG + Intergenic
1012726828 6:102824299-102824321 TCCCAAGCTGGAGGGCAATGTGG - Intergenic
1013254288 6:108369208-108369230 TGCCAAGGTCCAGGGTGAGGAGG + Intronic
1018474885 6:164130436-164130458 TCCTCAGGTGAAGAGAGATGAGG - Intergenic
1021595548 7:22312568-22312590 TCCCAATGAGAAGGGGGATCTGG - Intronic
1021840165 7:24715957-24715979 CCACAAGCTGAAGGGTGTTGAGG - Intronic
1022652155 7:32287385-32287407 TTCCCTGGTGAAGGGTGTTGGGG - Intronic
1023998021 7:45173969-45173991 TGCCAAGGAGAGGGGTGAGGTGG + Intronic
1027152644 7:75743478-75743500 AGCCAAGGGCAAGGGTGATGTGG + Intergenic
1029599173 7:101553762-101553784 TTACAAGGTCAAGGGTGCTGGGG + Intronic
1030578432 7:111320038-111320060 TCCCACGATGGAGGCTGATGTGG - Intronic
1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG + Intronic
1032128318 7:129210581-129210603 TCCCAAGGCTGAGGGTGAGGCGG - Intronic
1033222916 7:139540495-139540517 TGCCAAGGTGAAGGGGGTTGGGG + Intronic
1035393897 7:158523275-158523297 TCCCACGGTGAGGGCTGGTGCGG + Intronic
1035937062 8:3852659-3852681 GGCCAAGATGAATGGTGATGGGG + Intronic
1036662470 8:10716858-10716880 TCCAAAGGTGTAGGGTGAAGCGG - Intergenic
1037760080 8:21736035-21736057 TCCCAAGGTGAAGGGAGGAGAGG - Intronic
1038761961 8:30392547-30392569 TCCCAATGGGCAGGGGGATGTGG + Intronic
1039499282 8:38003899-38003921 TCACAAGGTGCAGGGTGGGGAGG + Intergenic
1041334111 8:56760476-56760498 TCCCAAGGTGACTGGTTTTGGGG + Intergenic
1045816259 8:106280560-106280582 TTGCAAGGGGATGGGTGATGGGG + Intronic
1046726289 8:117678238-117678260 TACCAAAGTGGAGGGAGATGGGG + Intergenic
1050656442 9:7833622-7833644 TTCCTAGGTGGAGGGTGGTGGGG + Intronic
1050721550 9:8597141-8597163 TCCCAAAGTGAAGGGTTAAAGGG + Intronic
1050778285 9:9296527-9296549 TCCCAAGGTGGAGGAGGAGGAGG - Intronic
1052936045 9:34093944-34093966 ACCCAGGGTTAAGGCTGATGTGG - Intronic
1054869080 9:70032589-70032611 TCCCATGGTGGTGGGGGATGGGG - Intergenic
1058654127 9:107204160-107204182 TGCCAAGGAGAAGGGTAAAGGGG - Intergenic
1059073725 9:111166811-111166833 CCCCAAGGGGAAGGTTGTTGTGG - Intergenic
1059328161 9:113517300-113517322 TCTCACGGTGAGGGTTGATGGGG + Intronic
1059572187 9:115451085-115451107 TCCCAGTGTGAAGGGAAATGGGG + Intergenic
1061063914 9:128265750-128265772 TGCCAGGTTGAAGGATGATGGGG + Intronic
1061718660 9:132537724-132537746 TCCCAAGTTGACAGCTGATGGGG + Intronic
1185631264 X:1517387-1517409 GCCCAAGCTGAAGGCTGAGGTGG - Intronic
1187260781 X:17683409-17683431 TCCCTAAGCTAAGGGTGATGGGG - Intronic
1187317664 X:18212011-18212033 CCCCAAAGTTAAGGGAGATGGGG + Intronic
1187427066 X:19187647-19187669 TCCCAAGTTGCAGGATGCTGAGG + Intergenic
1190650316 X:52563044-52563066 TCTCAGGGTGAAGGGTCATGAGG - Intergenic
1192274661 X:69616608-69616630 GCCCAAGGTGACTGGTGATGGGG - Exonic
1193978013 X:88147554-88147576 TCCACAGGTGAAGGGGAATGGGG - Intergenic
1194431533 X:93813075-93813097 TCCTAAAGTGAAGGGAGATCTGG - Intergenic
1197936785 X:131747720-131747742 TCCCAGGGGGAAGGGTGCGGTGG + Intergenic
1199381210 X:147174508-147174530 TCACAAGGTGCAGAGTGATGAGG - Intergenic
1201409822 Y:13688285-13688307 TCACAAGGTGAAGTCTGATAGGG + Intergenic
1201863502 Y:18625096-18625118 ACCCATGGTAATGGGTGATGAGG - Intergenic
1201869820 Y:18695282-18695304 ACCCATGGTAATGGGTGATGAGG + Intergenic
1202338352 Y:23833287-23833309 TCACAAGGTGACAGGTGAGGGGG - Intergenic
1202532414 Y:25836784-25836806 TCACAAGGTGACAGGTGAGGGGG + Intergenic