ID: 1083419665

View in Genome Browser
Species Human (GRCh38)
Location 11:62545882-62545904
Sequence CGCCTCCGGAGGGGAAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 320}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083419651_1083419665 13 Left 1083419651 11:62545846-62545868 CCGGACGGGTTTGGGAGTTGGGC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG 0: 1
1: 0
2: 1
3: 38
4: 320
1083419649_1083419665 14 Left 1083419649 11:62545845-62545867 CCCGGACGGGTTTGGGAGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG 0: 1
1: 0
2: 1
3: 38
4: 320
1083419646_1083419665 18 Left 1083419646 11:62545841-62545863 CCCGCCCGGACGGGTTTGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG 0: 1
1: 0
2: 1
3: 38
4: 320
1083419643_1083419665 22 Left 1083419643 11:62545837-62545859 CCATCCCGCCCGGACGGGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG 0: 1
1: 0
2: 1
3: 38
4: 320
1083419647_1083419665 17 Left 1083419647 11:62545842-62545864 CCGCCCGGACGGGTTTGGGAGTT 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG 0: 1
1: 0
2: 1
3: 38
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083419665 Original CRISPR CGCCTCCGGAGGGGAAGGGG CGG Intronic