ID: 1083421561

View in Genome Browser
Species Human (GRCh38)
Location 11:62556196-62556218
Sequence CTGTGCCATGTGCTGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 257}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083421550_1083421561 9 Left 1083421550 11:62556164-62556186 CCCCCTTCCCTTTCTGCTCCTCA 0: 1
1: 0
2: 16
3: 221
4: 1932
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421549_1083421561 20 Left 1083421549 11:62556153-62556175 CCATTCAAACACCCCCTTCCCTT 0: 1
1: 0
2: 7
3: 57
4: 451
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421553_1083421561 6 Left 1083421553 11:62556167-62556189 CCTTCCCTTTCTGCTCCTCACCC 0: 1
1: 1
2: 15
3: 145
4: 1466
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421555_1083421561 1 Left 1083421555 11:62556172-62556194 CCTTTCTGCTCCTCACCCCAGTC 0: 1
1: 0
2: 4
3: 43
4: 540
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421554_1083421561 2 Left 1083421554 11:62556171-62556193 CCCTTTCTGCTCCTCACCCCAGT 0: 1
1: 1
2: 5
3: 44
4: 508
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421547_1083421561 27 Left 1083421547 11:62556146-62556168 CCCTGATCCATTCAAACACCCCC 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421551_1083421561 8 Left 1083421551 11:62556165-62556187 CCCCTTCCCTTTCTGCTCCTCAC 0: 1
1: 1
2: 14
3: 114
4: 1265
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421552_1083421561 7 Left 1083421552 11:62556166-62556188 CCCTTCCCTTTCTGCTCCTCACC 0: 1
1: 0
2: 10
3: 93
4: 1168
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421548_1083421561 26 Left 1083421548 11:62556147-62556169 CCTGATCCATTCAAACACCCCCT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421556_1083421561 -9 Left 1083421556 11:62556182-62556204 CCTCACCCCAGTCTCTGTGCCAT 0: 1
1: 1
2: 4
3: 77
4: 460
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257
1083421546_1083421561 28 Left 1083421546 11:62556145-62556167 CCCCTGATCCATTCAAACACCCC 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083421561 Original CRISPR CTGTGCCATGTGCTGGACCA TGG Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
904321714 1:29702055-29702077 CTGCGGCATGTGCCAGACCATGG + Intergenic
904512209 1:31021045-31021067 CTGGGCCATCTGTTGGAGCATGG - Intronic
904917772 1:33982778-33982800 CTGTGCCCTGTGCTCCACCAAGG - Intronic
905454071 1:38075582-38075604 CTGTGTCCTGTGCAAGACCAAGG - Intergenic
906118419 1:43370670-43370692 CTGTTCCTTGTGCTGAGCCAGGG - Intergenic
906409479 1:45567376-45567398 CCGTGCCCTGTGCTGGAAGAAGG + Intronic
906461917 1:46041104-46041126 CTGTCCCATGATCTGGACCCTGG - Exonic
907246812 1:53114082-53114104 CTGTGCCAGGCCCTGGACCAGGG - Intronic
907303328 1:53501467-53501489 GTGTGCCGTGTGCTGTTCCAGGG + Intergenic
907306922 1:53518405-53518427 GTGTGCCAGGTGCTGCTCCAGGG - Intronic
907456838 1:54581612-54581634 CTGTGCCAAGTGCTGGCCCCAGG - Intronic
907458592 1:54592052-54592074 CTGTGCCATGTGCTAGGCCTTGG + Intronic
907745504 1:57209061-57209083 CTGTGCCAAGTGATGGACATAGG - Intronic
907788988 1:57642939-57642961 ATGTGCCAGATGCTGGACTACGG + Intronic
913445356 1:118944832-118944854 CTGTGAGATGTGCTGGAACATGG - Intronic
914876240 1:151514274-151514296 CTGTGCCCTCTGCTGGGCCTAGG + Intronic
915610980 1:156992430-156992452 CTGTGCCTTGTGCTGCACTCAGG - Intronic
916969518 1:169996762-169996784 CTGTACGATCTGCTGGACCTGGG + Intronic
917320839 1:173779887-173779909 CTGGGACATGTTCTAGACCATGG + Intronic
917671827 1:177280620-177280642 CCGGGCTATGTGCTGGCCCAGGG + Exonic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
920824556 1:209413295-209413317 CTTTACCATGTGCTGGGCAAAGG - Intergenic
923012109 1:230096060-230096082 GTGAGCCATTTGCTGGGCCAGGG + Intronic
923221225 1:231895931-231895953 CTGTGACGTGTTCTAGACCAGGG - Intronic
924424777 1:243941103-243941125 CTGTGCCGTGTGCTTCACCTGGG - Intergenic
924424802 1:243941237-243941259 CTGTGCCGTGTGCTTCACCTGGG - Intergenic
1064124082 10:12644104-12644126 CTGAGCCCTGTCCTGGTCCATGG + Intronic
1065143589 10:22743964-22743986 CTGTGCCAGGTGCTGGAAAAGGG + Intergenic
1069024670 10:63525972-63525994 ATGTGCCAGATGCTGGACTATGG - Intronic
1070829625 10:79410546-79410568 CTGTGCAAAGGGCTAGACCACGG + Intronic
1071437349 10:85659782-85659804 CTGTGCCATGTGCTGTTACATGG + Intronic
1071513565 10:86282472-86282494 CTGTTCCCTGAGATGGACCACGG - Intronic
1072285708 10:93912431-93912453 CTTTGACATGTGCTGGCACATGG - Intronic
1072934453 10:99698920-99698942 CTGTGCCAGGTGCTGTGCAAAGG + Intronic
1074536930 10:114334770-114334792 CTCTGCCATGTGCTGGAGAAGGG - Intronic
1075319860 10:121482350-121482372 CTGTGGCCTGTGCTGGATAAAGG - Intronic
1075933928 10:126323596-126323618 CTGTGCCAAGCACTGCACCAAGG + Intronic
1076106201 10:127825630-127825652 CTGAGCCATGTGAATGACCATGG - Intergenic
1076421531 10:130335545-130335567 CTGTGCCCAGTGCTGGACGTCGG + Intergenic
1076445938 10:130513821-130513843 CTGTGCCATGTGTGGGACGGAGG + Intergenic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1078527633 11:12112191-12112213 GTGTGCTGTGTGCAGGACCATGG + Intronic
1078778250 11:14413196-14413218 ATGTGCCATTTACTGGACTAGGG + Intergenic
1083198370 11:61104548-61104570 CTGTGGCCTGTGTTGGGCCAGGG - Intronic
1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG + Intronic
1083610523 11:64002207-64002229 CGGTGCCAGGTGCTCGACCCGGG - Intronic
1085439163 11:76542261-76542283 CTGAGCCACATGCTGGAGCAGGG - Exonic
1089213382 11:116821086-116821108 CTGTTCCATCTGCTGCACCAGGG + Exonic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1090434774 11:126677624-126677646 CTGTGCTAGGTGCTGAAGCAGGG + Intronic
1091400863 12:179781-179803 CTGTGCCAGATGCGGGCCCATGG + Intergenic
1091598257 12:1895775-1895797 ATGTGCCATGTGGTGGCACATGG - Intronic
1091999808 12:5022824-5022846 CTCAGCCAGGTACTGGACCAAGG - Intergenic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1092162238 12:6322070-6322092 CTGTGCCCAGTGCTGGCCCCAGG - Intronic
1093482613 12:19620369-19620391 CTGTGGCATGTGCTGTCTCAGGG + Intronic
1094097471 12:26723392-26723414 CTGAGCCATGTTCTTGAACATGG - Intronic
1094141486 12:27186481-27186503 CTGTGCTGTGTGCTGAGCCAAGG + Intergenic
1096367841 12:51043805-51043827 CTGTGTCATGTCCTTGACCTTGG - Intergenic
1096375772 12:51109092-51109114 CTGGGCAATGTGCTGGCCCTTGG - Intronic
1096875957 12:54630727-54630749 CTATGCCTTGTGTTGGTCCAGGG + Intergenic
1099256886 12:80325414-80325436 CTGTGCCAAGTGCTGTAAAATGG + Intronic
1099692740 12:85980252-85980274 CTGTGTAATATCCTGGACCATGG + Exonic
1101028001 12:100632768-100632790 CTCTGTCATCTGCTGGAGCAGGG - Intergenic
1101737571 12:107474546-107474568 CTGTACCTGGGGCTGGACCATGG + Intronic
1102079420 12:110086042-110086064 CTGGACCATGTCCTGGACCTTGG - Intergenic
1102822895 12:115923467-115923489 CTCTGGCATCTGCTGAACCATGG + Intergenic
1103724311 12:122990159-122990181 CTGCGCCCCGTGCTGGGCCAGGG - Intronic
1104299454 12:127550972-127550994 CTGTGCTATGTGGTTGCCCAGGG - Intergenic
1104412145 12:128567905-128567927 CTGTGCCATGTGCTGCACCGTGG + Intronic
1104885085 12:132102500-132102522 GTGTGCCTGGAGCTGGACCATGG + Intronic
1106293741 13:28390964-28390986 CTGTGGTCTTTGCTGGACCAGGG - Intronic
1106487813 13:30188125-30188147 CTGTGGCAAGTGCTGGACTCAGG + Intergenic
1106786630 13:33113951-33113973 AAGTGCCATGTTCTGGAGCAGGG + Intronic
1108579329 13:51815285-51815307 GTGTGCCATCTGCTGGACAAAGG - Intergenic
1109397708 13:61782332-61782354 CTGTGCCATGTGCTTGAATCTGG + Intergenic
1110073825 13:71213616-71213638 CAGTGTCATGTGCTGGAAAAGGG - Intergenic
1112452244 13:99523200-99523222 CTGTGGCCTGGGCTGGGCCACGG + Intronic
1119300649 14:73569020-73569042 CTGCGGAATGGGCTGGACCAGGG - Intronic
1119607807 14:76035764-76035786 GTGTGCCATGTGCTGCACTGTGG + Intronic
1119621073 14:76132287-76132309 CTGTGCTAAGTGCTGTGCCAAGG + Intergenic
1120463719 14:84829113-84829135 CTTTGTCATGTGTTAGACCAAGG - Intergenic
1121264306 14:92589410-92589432 CTCTGCCCTCTGCTGGACAATGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121465898 14:94115471-94115493 CTTGGCCAAATGCTGGACCAGGG - Intronic
1121627033 14:95393273-95393295 CTGTGGCATGTGCTTAATCAGGG - Intergenic
1121988914 14:98535751-98535773 CTGTGCCATGTACTGAGCCAGGG - Intergenic
1123709877 15:22979931-22979953 CTGTGCCATGTGCCGGGGCGCGG + Intronic
1124237357 15:28002301-28002323 GTGTGGCAGATGCTGGACCATGG + Intronic
1126097104 15:45097580-45097602 CTGCTCCATGGGCTGGCCCAGGG + Intronic
1126119297 15:45237039-45237061 CTGAGCCATCTGATGAACCAGGG + Intergenic
1128228713 15:66020113-66020135 CTGGGCCCTGTGCTGTACAAGGG - Intronic
1128601500 15:68998934-68998956 CTCTGCCAGGCGTTGGACCAGGG - Intronic
1128678169 15:69627033-69627055 CTGCGCTCTGTGCTGGACCTGGG - Intergenic
1129321634 15:74778182-74778204 CTGTTGCATGGCCTGGACCAGGG - Intergenic
1131154313 15:90065390-90065412 ATGTGCCAGGTGTTGAACCAGGG + Intronic
1131255332 15:90858321-90858343 ATGTGCCAGGTGGTGGACCGTGG + Intergenic
1132284019 15:100646440-100646462 CCGTTCCATGTGTTTGACCAAGG + Intronic
1132933677 16:2470966-2470988 CTGTGCCACGTGCTGGACGGGGG - Intergenic
1134313581 16:13098107-13098129 CTGTCCCAGGTTTTGGACCAGGG + Intronic
1136059031 16:27712142-27712164 CTTTGCCATGTGATGGTCCACGG + Intronic
1136268117 16:29132540-29132562 CTGTGCCTTCTGCTGGGGCAGGG + Intergenic
1137585109 16:49659692-49659714 GTGTGCCATGTGCAGGATCTGGG - Intronic
1138171556 16:54854817-54854839 CTCTGCCAGGTACTGCACCAGGG + Intergenic
1139421046 16:66849774-66849796 CTGTCCCTTGAGCTGGGCCAGGG - Intronic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1140728228 16:77833273-77833295 CTTTGCCAAGTGCTACACCAGGG + Intronic
1141346686 16:83253034-83253056 CTGTGCCAGGTGCTGTGCTAAGG - Intronic
1142071427 16:88092878-88092900 CTGTGCCTTCTGCTGGGGCAGGG + Intronic
1142372369 16:89690312-89690334 CTTTGCTCTGTGCTGGACCCTGG - Intronic
1147020300 17:37526261-37526283 CTGTGCCATGTCCTTACCCAGGG - Intronic
1147951073 17:44108379-44108401 CTGTGCTAGGTGCTGGGCAATGG + Intronic
1148073094 17:44920043-44920065 CTGTGCCAGGCACTGGGCCAGGG - Intergenic
1148752124 17:49951464-49951486 CTGTGCCAAGTGCTGGAAACAGG - Intergenic
1148874269 17:50677422-50677444 CTGTGCTCTGTGCTGGGCTAGGG + Intronic
1149554664 17:57564651-57564673 CTGTGCACTGTGCTGGACACAGG - Intronic
1151063315 17:71121848-71121870 ATGTGCCATGTGCTAGGCAATGG + Intergenic
1151321573 17:73355742-73355764 CTGTGCTGGGTGCTGGACTAAGG - Intronic
1152456425 17:80419379-80419401 CTGTGCCAGATGCTGAGCCATGG + Intronic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1160947546 19:1650745-1650767 CTGTGCCATCTGCTGGGGGAGGG - Intronic
1161522256 19:4731131-4731153 CTGTGCCCTCTGGTGGACCCAGG + Intergenic
1165495627 19:36150803-36150825 CGGTGCCTCATGCTGGACCAGGG - Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1165794786 19:38512436-38512458 CTGGGCGATGTGCTGGAAGAGGG - Exonic
1166074785 19:40407703-40407725 CTGTGCCAGATGCTGCACTAAGG + Intronic
1166371138 19:42301956-42301978 CTGGTGCATGAGCTGGACCAAGG + Exonic
1166714986 19:44961279-44961301 CTGTCCCACCTGCTGGACCAGGG + Intronic
1167044336 19:47040968-47040990 CTGGGCCCAGTGCTGGACAAGGG + Exonic
1168015057 19:53566236-53566258 CTGTTCCATGTTATCGACCAGGG + Intronic
1168228986 19:55016719-55016741 CTCAGCCATGTGCTGGGCCATGG + Intronic
1168290979 19:55357429-55357451 GTTTGTAATGTGCTGGACCACGG - Intronic
1168563527 19:57403669-57403691 ATGAGCCATGGGCTGGAGCAGGG + Intronic
925047328 2:782674-782696 CTCTGCCATGCTCTGGCCCAGGG + Intergenic
925085572 2:1105151-1105173 CTCTGCCCTCTGCTGAACCATGG + Intronic
925966665 2:9073037-9073059 CTGTGCCATCCGCTTGACCTGGG - Intergenic
925991536 2:9259072-9259094 CCGTCCCACGGGCTGGACCACGG - Intronic
926145714 2:10396218-10396240 GTGTGCCCTGTGCTGGGCCCAGG + Intronic
926421527 2:12704467-12704489 CTGTGCTAGGTGCTGGACACAGG - Intergenic
927538896 2:23889582-23889604 CTGTGACCTTTGCTGGGCCAGGG - Intronic
928364789 2:30692272-30692294 CAGGGCCACGTGCTGTACCAGGG - Intergenic
928660335 2:33495502-33495524 CTGGGCCATGGCCTGGTCCATGG - Intronic
929012332 2:37457249-37457271 CCATGCCAAGTGCTGCACCAGGG + Intergenic
933771844 2:85749608-85749630 AAGTGCACTGTGCTGGACCAAGG + Intergenic
935328819 2:101961689-101961711 CTGTGCCATTTGCTGGTGCTGGG + Intergenic
935571967 2:104671247-104671269 CTGTACCCTGTGCTGTGCCAAGG - Intergenic
936245159 2:110820157-110820179 CTGTGCCTGGTGCTGTAACAAGG + Intronic
937246315 2:120496379-120496401 GTGTGTCAGATGCTGGACCAAGG - Intergenic
937362257 2:121237445-121237467 CTGGGCCAAGTGCTGGACATAGG - Intronic
939059331 2:137400837-137400859 CTGTGCTGTGTCCTGGAGCAGGG + Intronic
941928385 2:170917598-170917620 CAGAGCCATGGGCTGGAGCAGGG - Intergenic
946052082 2:216871510-216871532 CTGTGCCATGTGTTCTCCCAGGG + Exonic
946241359 2:218357836-218357858 CCGTGCCTTGTCCTGGTCCAAGG - Intronic
947564668 2:231186151-231186173 CTGTGACATGATCTGGACCTGGG - Intergenic
948370678 2:237487389-237487411 CTCTCCCAGGTGCTGGACCAGGG + Exonic
948504036 2:238415835-238415857 CAGAGCCATGGGCTGGAGCAGGG - Intergenic
1171244755 20:23602382-23602404 CTGTGCCATGTTCTGGAGGGAGG - Intergenic
1171415732 20:24979359-24979381 GCGTGCCCTGTGCTGGACCATGG - Intronic
1172071912 20:32263870-32263892 CTGTGCCAGGTGATGAATCACGG + Intergenic
1172287178 20:33749032-33749054 CTGGGGCATGGGCTGGTCCAGGG - Exonic
1173426197 20:42945635-42945657 CTGCCCCTTGTGCTGGACCCAGG + Intronic
1175263137 20:57687270-57687292 CTGTGCCTGGGGCTGGTCCAAGG + Intronic
1175293514 20:57893837-57893859 TTGTGCCATGTGCTCACCCATGG - Intergenic
1179063085 21:37997789-37997811 CTGTACCATGTGCTGTTACATGG - Intronic
1179143850 21:38750833-38750855 CTGGGCCCTGTTCTGGACCCTGG + Intergenic
1179224630 21:39442875-39442897 CTGTGCCTTGTGCTAGATGAAGG + Intronic
1179508846 21:41859034-41859056 CTGTGCCACCTGGTGGCCCAGGG - Exonic
1180161602 21:46000824-46000846 CTGTGACATGTGTGGGACCCAGG - Intronic
1181048626 22:20228297-20228319 CAGGGCCCAGTGCTGGACCAGGG + Intergenic
1181528883 22:23504815-23504837 CTGTGCTGTGTGCAGGGCCAGGG + Intergenic
1182432692 22:30309644-30309666 CTGTGCCACGTCATGGTCCAAGG + Intronic
1183202601 22:36396150-36396172 CTGTACCAGGTGCTGGAACTTGG + Intergenic
1184337600 22:43862844-43862866 CTGTGCCAGGCACTGGGCCAGGG + Intergenic
1184749145 22:46474237-46474259 CTGTGCCACTGGCTGGACAATGG + Intronic
1184810829 22:46830605-46830627 TTGTGCCATCAGCTGGCCCACGG - Intronic
1184872474 22:47249646-47249668 CCGTGCTATGTGCTGGGCCAAGG - Intergenic
950017721 3:9765970-9765992 CTGTGACCACTGCTGGACCAAGG + Exonic
950201116 3:11044812-11044834 CTGTGCCATGTTTGTGACCATGG - Intergenic
952492932 3:33889064-33889086 CTGAGCCATGTGGAGGCCCAGGG - Intergenic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
954241445 3:49296915-49296937 CTGTGCCAAGGGCTAGAACATGG - Intronic
954960690 3:54562192-54562214 TTCTGCCATGTGCTGGTCAAAGG + Intronic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
960290826 3:115882281-115882303 TTGTACCAGGTGCTGGACTAGGG + Intronic
960543378 3:118884855-118884877 CTGTGCCCTGTGCTGCCCCCAGG - Intergenic
961819789 3:129570147-129570169 CTGTGCCAGGCCCAGGACCAAGG - Intronic
967109505 3:186281267-186281289 CTGGGCTAAGGGCTGGACCATGG - Intronic
968425301 4:519298-519320 CTGTGCCAGGCGCTGTGCCAGGG - Intronic
969220065 4:5753480-5753502 CTGCCCCACATGCTGGACCATGG - Intronic
971916958 4:32883492-32883514 CTGTGCCATTTTCAGGAGCAAGG + Intergenic
976745236 4:88396360-88396382 CTGTACCAGGTGCTGGAGAATGG + Intronic
977931250 4:102751594-102751616 CAGTTCCATGTGTTTGACCAAGG - Intronic
978401998 4:108341068-108341090 CTGTGCCAGGTGTTGGGCCTGGG + Intergenic
984087872 4:175334447-175334469 CTGTTCCATGTATTGGAGCATGG - Intergenic
984367029 4:178812820-178812842 TCCTGCCATGGGCTGGACCATGG - Intergenic
984935233 4:184883904-184883926 CTGGTTCCTGTGCTGGACCATGG + Intergenic
985178118 4:187225169-187225191 CTGTGCCATCTGCCAGACCTTGG + Intergenic
986182761 5:5408954-5408976 CTGTTTCATGTGCTGGGACATGG - Intergenic
986516915 5:8574066-8574088 CAATGCCAGGTGCTGGACCAAGG - Intergenic
990794682 5:59526088-59526110 CTGTGCCCTGTGATGCACAATGG + Intronic
991440890 5:66647689-66647711 CTGTGCTATGTTCTGGAGCTGGG - Intronic
995565440 5:113429304-113429326 CTGTGCCATGTGAGGGCACAGGG + Intronic
995770321 5:115662822-115662844 CTGTGCCTGGCCCTGGACCATGG + Intergenic
996409279 5:123139648-123139670 GTGTGGCCTGTGCTGGACCCTGG + Intronic
997615441 5:135243159-135243181 CTGTGCCGTTTGCTGGACCGGGG - Intronic
998274002 5:140734586-140734608 CTGTCCAAGATGCTGGACCAGGG + Intergenic
1001327148 5:170737375-170737397 TTGTGCCAGGTGCTGCACTAGGG + Intergenic
1002372253 5:178764373-178764395 CTGGGCCATGTGCTGTATGAAGG - Intergenic
1002879538 6:1238720-1238742 GTGTGCCAGGGGCTGGACTAGGG - Intergenic
1006675331 6:35758548-35758570 CTTTCCCATGAGCTGGGCCAAGG + Intergenic
1007111529 6:39315812-39315834 ATGTGCCAGGTGCTGTGCCAGGG - Intronic
1007284392 6:40737157-40737179 CTGTGCCAGGTGCTGGGACTCGG + Intergenic
1007446068 6:41907123-41907145 GAGTTCCATGTACTGGACCATGG + Exonic
1007513405 6:42391918-42391940 ATGTGCCAGGTGCTTGGCCAGGG + Intronic
1007609869 6:43142370-43142392 CTGTGCCATGTTCTGTACACAGG - Intronic
1008007720 6:46429652-46429674 CTGTGCCAGGTGCTAGAGAATGG + Intronic
1011270160 6:85570280-85570302 ATGTGCCAGGTACTGGACCAAGG + Intronic
1013015822 6:106159789-106159811 CAGTGCCAAGTGCTGGCCCATGG + Intergenic
1013259808 6:108430452-108430474 CTGTGCCTTGTTCTGGACATGGG + Intronic
1015916599 6:138223794-138223816 GTGTATCATGTGTTGGACCATGG + Intronic
1017477132 6:154808367-154808389 CTGGGCCATGTGCTTGGCCTAGG - Intronic
1017517846 6:155173779-155173801 CTTTGCCAAATGCTGTACCAGGG + Intronic
1019069210 6:169328123-169328145 CTCTGACATGTGCTAGAGCATGG + Intergenic
1021698178 7:23293602-23293624 CTGTGCCAGGCGCTGGACTAAGG - Intergenic
1022100783 7:27167938-27167960 CCCTGCCATTTTCTGGACCAGGG - Intronic
1023154046 7:37230274-37230296 ATGTGACAAGTGCTGGAACAGGG + Intronic
1023319697 7:38980894-38980916 CTGTGTCCTGAGCTGGATCATGG - Intronic
1023970008 7:44983946-44983968 TTGTGCCATGTGCTGGGTCAGGG + Intergenic
1026681866 7:72473009-72473031 CTGTACCATCTCCTGGGCCAGGG + Intergenic
1026740136 7:72974034-72974056 CTGAGGCAGGTGCAGGACCAGGG + Intergenic
1026797445 7:73375546-73375568 CTGAGGCAGGTGCAGGACCAGGG + Intergenic
1027103597 7:75391036-75391058 CTGAGGCAGGTGCAGGACCAGGG - Intergenic
1027192152 7:76002965-76002987 CTGTACCAGGGGCTGGAGCATGG - Intronic
1027629237 7:80581585-80581607 GTGTCCCATGTTCTGGATCAGGG - Intronic
1027890065 7:83961723-83961745 CTCTGCCATGCGGTGGAACATGG - Exonic
1028197111 7:87920156-87920178 CTGTGCCATATGGTTCACCAGGG - Intergenic
1030011566 7:105173641-105173663 CTGGGCAATGTGGTAGACCATGG - Intronic
1030781115 7:113601314-113601336 CTCTGCCAGGTTTTGGACCAGGG - Intergenic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1033142515 7:138840253-138840275 CTGTGTCAGGTGCTGGATCTGGG + Exonic
1033365696 7:140671556-140671578 CTAGGTCATGTGCTGGACCCTGG - Intronic
1035631507 8:1110335-1110357 CTGTGACATGTGCTGGGTCTGGG + Intergenic
1036139855 8:6197472-6197494 CTGGGCCACGTGCTGGACTCTGG - Intergenic
1036833232 8:12038050-12038072 CTTTGCCATCTTCTGTACCAAGG + Intergenic
1036855079 8:12284615-12284637 CTTTGCCATCTTCTGTACCAAGG + Intergenic
1038421541 8:27437074-27437096 CTGAGCACTGGGCTGGACCAAGG + Intronic
1039785268 8:40829240-40829262 CTTTGCAATGTGCTGGGCCTGGG - Intronic
1039913556 8:41843496-41843518 CTGCTGTATGTGCTGGACCAGGG - Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040415902 8:47195901-47195923 CTGTGGCATTGGCTGGGCCAAGG - Intergenic
1041067269 8:54094164-54094186 CTGTGACATTTCCTAGACCAAGG - Intronic
1041248228 8:55909213-55909235 GTGTGCCACGTGATGGGCCAGGG + Intronic
1041424349 8:57703469-57703491 CTGTGCCAAGTCCTTGGCCAAGG + Intergenic
1042105912 8:65326040-65326062 CAGTGCCACGTGCTGTACCATGG - Intergenic
1043388740 8:79770925-79770947 ATGTGCCATGTGCTGTGCTAGGG + Intergenic
1044875666 8:96663498-96663520 CTGTGCCAAGCTGTGGACCATGG + Intronic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1048887281 8:138918529-138918551 GAGTGGCATGTGCTGGGCCATGG - Intergenic
1049072277 8:140365358-140365380 ACGTGCCATGTGAGGGACCAGGG - Intronic
1049288263 8:141788255-141788277 CCGGGCCATGTGCTTCACCATGG - Intergenic
1049928688 9:434824-434846 CTCTGCCATGTTCTGGAGCCAGG - Exonic
1050003132 9:1099563-1099585 CTGTGACTTCTGCTGGGCCAAGG + Intergenic
1051062469 9:13060178-13060200 TGGTGGCATGTGCAGGACCATGG - Intergenic
1053408070 9:37894926-37894948 TTGTGCCCTTTGCTGGAACATGG - Intronic
1053595110 9:39552705-39552727 GTGTGCCATATGCTGGAAGATGG - Intergenic
1053852892 9:42307734-42307756 GTGTGCCATATGCTGGAAGATGG - Intergenic
1056299223 9:85224570-85224592 CTGTGACATGTTCTGGGCCTCGG + Intergenic
1056693838 9:88829830-88829852 ATGTGCCCTGTGCTGCCCCAAGG - Intergenic
1058423099 9:104851766-104851788 CAGTGCCATGCTCTGGCCCAGGG - Intronic
1058567338 9:106300435-106300457 CTGTACCAAGTGGTGTACCATGG + Intergenic
1060223189 9:121775037-121775059 CTCTGCCATCTGCTGGGGCAAGG + Intronic
1061209643 9:129183365-129183387 CTTTGCCAGATGCTGGAGCAGGG - Intergenic
1062459537 9:136657143-136657165 CTGTGCCATGTACTGGCGCCAGG + Intergenic
1062496829 9:136835904-136835926 CAGGGCCATGGGCTGCACCAAGG + Intronic
1062729245 9:138099942-138099964 ATCTGCCATGTGCTGGGGCAGGG + Intronic
1186473190 X:9837060-9837082 CGGTGCCAAGTGCTGGTCCTTGG + Intronic
1187318323 X:18219141-18219163 CTGTGGCAAGTGCTGGGCGATGG - Intronic
1187601730 X:20839093-20839115 CTGTGCCCTGAGCTTGATCAAGG - Intergenic
1189849715 X:45166274-45166296 CCGTGCCAAGTACTGGGCCAGGG + Intronic
1194971885 X:100352808-100352830 CTGTGCAGTCTGCAGGACCACGG + Intronic
1197127876 X:122969421-122969443 CTATGCAATGTGCTAGACCCTGG + Intergenic
1199035909 X:143050757-143050779 CTTTGCCATGTGCAGCACCTGGG + Intergenic
1200037948 X:153345541-153345563 TTGTGCCAGGTGAGGGACCAAGG - Exonic
1200053936 X:153448884-153448906 GTGTGCCATGTGCTGCCCCTGGG - Intronic
1201942556 Y:19475499-19475521 AACTGCCATGTCCTGGACCATGG - Intergenic