ID: 1083424316

View in Genome Browser
Species Human (GRCh38)
Location 11:62575291-62575313
Sequence GTGGCTGGCGACTGAGGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083424316_1083424323 17 Left 1083424316 11:62575291-62575313 CCTGAGCCTCAGTCGCCAGCCAC 0: 1
1: 0
2: 4
3: 24
4: 254
Right 1083424323 11:62575331-62575353 GCCACCTCCAGCTCCCTCCTTGG 0: 1
1: 0
2: 4
3: 93
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083424316 Original CRISPR GTGGCTGGCGACTGAGGCTC AGG (reversed) Exonic
900127770 1:1075981-1076003 GTGGCGGGAGGCTGAGGCTATGG + Intergenic
900331100 1:2135038-2135060 GCGGCTGGAGACAGAGGCCCAGG - Intronic
900495376 1:2973738-2973760 CAGGCTGGCTTCTGAGGCTCTGG + Intergenic
901030161 1:6302507-6302529 GTGGGTGGAGGCTGAGGCACTGG - Intronic
902047882 1:13539518-13539540 GTGGCTGGGCACAGTGGCTCAGG - Intergenic
902404220 1:16174247-16174269 GGGTCTGGCTAGTGAGGCTCTGG - Intergenic
904566749 1:31432873-31432895 GTCGCTGGCCTCTGAGGCTCTGG + Intronic
904599500 1:31665744-31665766 ATGGCTGGCAGGTGAGGCTCTGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905164242 1:36067571-36067593 GTGGCAGGCGCCTGAGGCTGAGG + Exonic
907004823 1:50901572-50901594 TTGGCTGGCCACAGTGGCTCAGG + Intronic
907201003 1:52726702-52726724 GTGGCGGGCGGCTGCGGCTAGGG - Intronic
908052418 1:60247515-60247537 GTGGCTGGGGAAAGAGGCTGAGG - Intergenic
911327213 1:96482403-96482425 GTGGGTGGAGACTGAGGCCGGGG - Intergenic
915599520 1:156913595-156913617 GTGTCTGGAGACGGGGGCTCTGG + Intronic
921047479 1:211487774-211487796 GGGCCTGGAGACTGAGGCGCAGG + Intronic
922763953 1:228148185-228148207 GTGCCTGAGGACTGAGGCCCAGG + Intronic
922767458 1:228163366-228163388 CTGGCGGGGGACTGAGGCCCAGG + Intergenic
924948027 1:248858878-248858900 GTGGGTCGCGACGGGGGCTCTGG - Intronic
1064605866 10:17038083-17038105 GTGGCTGGGCACGGTGGCTCAGG - Intronic
1064624818 10:17251521-17251543 GGGGCTGGCTACAGTGGCTCAGG - Intergenic
1066043018 10:31570199-31570221 GTGGCTGGGCACAGTGGCTCAGG + Intergenic
1074523491 10:114245425-114245447 CTGGCAGGAGACTGAGGCTCAGG - Intronic
1075328973 10:121558721-121558743 GTGGCGGGCGCCTGAGGCTGAGG - Intronic
1076353413 10:129834167-129834189 GTGGCTGGAGGCTGGGGCTGGGG - Intergenic
1076722562 10:132399067-132399089 CCGGCTGGAGACTCAGGCTCAGG - Intronic
1076800524 10:132825987-132826009 GTGGCTGGTCTCTGTGGCTCTGG - Intronic
1076800548 10:132826088-132826110 GTGGCTGGTCTCTGTGGCTCCGG - Intronic
1076800557 10:132826126-132826148 GTGGCTGGTCTCTGTGGCTCCGG - Intronic
1076800626 10:132826417-132826439 GTGGCTGGTCTCTGTGGCTCTGG - Intronic
1076800660 10:132826556-132826578 GTGGCTGGTCTCTGTGGCTCCGG - Intronic
1076800680 10:132826632-132826654 GTGGCTGGTCTCTGTGGCTCCGG - Intronic
1076800700 10:132826708-132826730 GTGGCTGGTCTCTGTGGCTCCGG - Intronic
1077358318 11:2128690-2128712 GTGGCTGGAGATGGGGGCTCAGG - Intergenic
1079372874 11:19866895-19866917 ATGGCTGGTGAGTGAGGCTTTGG - Intronic
1083424316 11:62575291-62575313 GTGGCTGGCGACTGAGGCTCAGG - Exonic
1084476006 11:69390234-69390256 GGGGCTGGCCTCTCAGGCTCAGG + Intergenic
1084605078 11:70167691-70167713 GTGCCTGGGGACTGTGGCTGGGG - Intronic
1087385925 11:97468339-97468361 GAGGCCTGGGACTGAGGCTCTGG - Intergenic
1089050139 11:115538786-115538808 GTGGCTGGAGGGAGAGGCTCAGG + Intergenic
1089458597 11:118639893-118639915 GGGGCTGGGGACTAAGGCTCTGG + Intronic
1091688153 12:2578364-2578386 CTGGCTGGTCCCTGAGGCTCTGG + Intronic
1093584522 12:20820496-20820518 ATGCCTGGCCACTGAGGTTCAGG + Intronic
1096155485 12:49339285-49339307 GTGGATGGGGCCTGAGGATCAGG - Intergenic
1096324102 12:50642894-50642916 GTGGCTGGAAAATGAGGCTCAGG - Intronic
1096775611 12:53961675-53961697 GCGGCTGGAGTCTGAGGCGCTGG + Intergenic
1096845291 12:54403238-54403260 GTGGCTGTCCACTGGGGCTTGGG + Exonic
1100600399 12:96107762-96107784 GTGGCTGGGGAAGGAGGCTTTGG - Intergenic
1101729719 12:107416912-107416934 GTGGCTGGGCACGGTGGCTCAGG - Intronic
1101983819 12:109430226-109430248 GTGGCTGGGGACAGAGGCAAGGG + Intronic
1102867125 12:116383244-116383266 GTTGCTGTCGATTCAGGCTCTGG + Intergenic
1103561029 12:121793412-121793434 GACGCTGGGGACTGAGGGTCGGG + Intronic
1103704867 12:122865993-122866015 GTGGCTGGTGGCTGGGCCTCAGG - Exonic
1104677943 12:130727786-130727808 GAGGCTGGGGACTGAGAGTCTGG + Intergenic
1107658974 13:42619695-42619717 GTGGCTGGTGCCAGAGGCACTGG - Intergenic
1108474703 13:50802205-50802227 GTGGCTGGCCTCTGAGGAACTGG + Intronic
1108476200 13:50820444-50820466 CTGGTTGGCCACTAAGGCTCTGG - Intronic
1108795390 13:54024014-54024036 GTGGCTGGAGATGGAGACTCAGG - Intergenic
1109166731 13:59044661-59044683 GGGGCTGGAGACTGTGGCTTGGG - Intergenic
1113016366 13:105832756-105832778 GTGGCTGTCGAGTGATGCCCAGG + Intergenic
1114248209 14:20934374-20934396 CTGGCAGACCACTGAGGCTCTGG + Intergenic
1114257827 14:21017812-21017834 GGGGCTGGCGACTCAGGGTGTGG + Intronic
1116854983 14:49944280-49944302 GTGGCACCCGACTGAGGCACAGG + Intergenic
1118348200 14:64955038-64955060 GTGGCGGGGGACTAAGGCTGAGG + Intronic
1119020566 14:71108658-71108680 CTGGCTGGCTACTGAGGCCCGGG - Exonic
1119325650 14:73758565-73758587 GAGGCTGGCCACGGAGGCCCCGG - Intronic
1121048465 14:90804654-90804676 GTGACTCGCCACTGAGTCTCAGG - Intronic
1121429202 14:93874833-93874855 GTGGCTGGTCTCTGAGGCTCAGG - Intergenic
1121567643 14:94922814-94922836 GTGGCTGGTGGCTGGGGCCCTGG - Intergenic
1122418118 14:101560102-101560124 GGGGTTGGCGACTTGGGCTCAGG - Intergenic
1122982087 14:105196545-105196567 GGGGCTGGGGAGTGAGGCTGGGG - Intergenic
1123709810 15:22979465-22979487 GCCGCTGGGGACTGAGGCTCGGG - Intronic
1125375233 15:39021641-39021663 GTGGATGGATACTGAGGCTTGGG - Intergenic
1125749872 15:42020894-42020916 GTGGCTGGGGCCAGAGGCTGAGG - Intronic
1128232701 15:66046729-66046751 TTGGCTGGGTATTGAGGCTCAGG - Intronic
1131408999 15:92190151-92190173 GTGACTGGGGAATGAGGGTCAGG - Intergenic
1132402729 15:101523306-101523328 AGGGCTGGCCACTGAGGATCTGG + Intronic
1132588823 16:717563-717585 CTGGCGGGAGACTGAGGCTCAGG + Exonic
1132639415 16:970886-970908 GCGGGCGGCGACTCAGGCTCCGG + Exonic
1132838163 16:1965038-1965060 GCGGCTGGGGACGGAGGCGCCGG - Intergenic
1132885887 16:2181725-2181747 GTGGCTGGTGGCTGGGGCTTGGG + Intronic
1132974278 16:2703686-2703708 GTGGCCAGCGAGGGAGGCTCTGG - Intronic
1133138180 16:3726473-3726495 GTGGCTGGGAACTGTGGCCCAGG - Exonic
1133231258 16:4367776-4367798 GTGGGTGAGGGCTGAGGCTCAGG + Intronic
1133988303 16:10685001-10685023 CTGCCTGGCTAATGAGGCTCTGG + Intronic
1134607699 16:15583965-15583987 TTGGGTAGCTACTGAGGCTCAGG + Intronic
1135591999 16:23711691-23711713 GAGGAGGGAGACTGAGGCTCAGG + Intronic
1136367032 16:29813646-29813668 GAGGGTGGTGAGTGAGGCTCAGG - Exonic
1136551105 16:30983066-30983088 ATAGCTGGCGGCTGAGGCTCTGG + Intronic
1136585361 16:31180795-31180817 GCGGCTGGGGGCGGAGGCTCGGG + Intronic
1137668090 16:50263326-50263348 GTGGCTGGTGGCTGCGGCTGCGG + Intronic
1138328130 16:56191972-56191994 GTGGCCGGGGTCTGGGGCTCCGG - Exonic
1138475945 16:57270647-57270669 GGGGCAGGGGACAGAGGCTCCGG + Intronic
1138778559 16:59755027-59755049 GTCGCTGGCAACTGCAGCTCCGG + Intergenic
1141760113 16:86022704-86022726 CTGGCTGGCTGCTGGGGCTCTGG + Intergenic
1142129153 16:88424897-88424919 GAGGCTGGCCACAGATGCTCTGG + Intergenic
1142345426 16:89550788-89550810 GTGGGTGGCGACTGATGGGCGGG + Intronic
1142984622 17:3688449-3688471 GTGGCCAGCGACTGAAGCTGGGG - Intronic
1143080131 17:4375597-4375619 GTGGCTGGAAACTGAGAATCAGG + Intergenic
1143854539 17:9839001-9839023 GTAACTGACGACTGAGGCTGGGG + Intronic
1144131515 17:12251200-12251222 GTGGCTGGGGATGGAGGCTCTGG + Intergenic
1144549876 17:16230769-16230791 GAGGCTGGCCACGGTGGCTCAGG - Intronic
1144570070 17:16391948-16391970 GTGGCTGGAGGGGGAGGCTCAGG - Intergenic
1144824935 17:18100489-18100511 TTGGCTGGCGGCTGAGGCTGTGG + Intronic
1145104783 17:20105866-20105888 GTGGCTGGGGATGGAGGCTGTGG + Intronic
1145307710 17:21684547-21684569 GTGTCGGGCCTCTGAGGCTCCGG - Intergenic
1145362222 17:22221710-22221732 GTGGCTGGAGGGGGAGGCTCAGG - Intergenic
1147218772 17:38915950-38915972 CTGGCTGGAGTCTGATGCTCTGG + Intronic
1148089982 17:45017750-45017772 TTGGCAGGGAACTGAGGCTCTGG + Intergenic
1149660418 17:58331744-58331766 AAGGGTGGGGACTGAGGCTCTGG - Intergenic
1149660439 17:58331799-58331821 GAGGCTGGGGACTTAGGCCCTGG - Intergenic
1149660505 17:58331992-58332014 GTGGCTGGGGACTGAGGCCCTGG - Intergenic
1150458820 17:65330283-65330305 GTGGCTGACTCCTCAGGCTCTGG + Intergenic
1150771220 17:68042746-68042768 GCGGCGGGCGCCTGAGGCTGAGG + Intronic
1150912076 17:69398926-69398948 GGGGCTGGACACTGTGGCTCAGG + Intergenic
1151603409 17:75120531-75120553 GTGGCTGGGCACGGTGGCTCAGG + Intronic
1151813332 17:76458326-76458348 GTGGCTGGGGGCTCAGGGTCTGG - Intronic
1152347645 17:79763225-79763247 CTGGCTGGCCACAGTGGCTCAGG + Intergenic
1152378242 17:79929577-79929599 GGGGCTGGCGGCTGAGGGTGAGG + Intergenic
1152565955 17:81100573-81100595 GTGGCTGGGGACCCAGGCTTGGG - Intronic
1152660559 17:81540049-81540071 GAGGCTGGGGGCTGGGGCTCAGG + Exonic
1153632877 18:7088858-7088880 GAGGCTGGACACGGAGGCTCAGG + Intronic
1154156141 18:11945770-11945792 GTGGCAGGCGCCTGCTGCTCGGG + Intergenic
1155172904 18:23280342-23280364 GTGGCTGGGTACTGAGGCTGAGG + Intronic
1156098124 18:33561231-33561253 GGGGCTATCGTCTGAGGCTCCGG + Intergenic
1156408697 18:36807344-36807366 GTAGCTGGTGACTTAGGCTGAGG + Intronic
1160225549 18:77008565-77008587 GTGACTGGCGGCTGCGGCTGGGG - Intronic
1160513707 18:79466891-79466913 GTGGCTGGCGGCGGAGCCTTGGG + Intronic
1161009494 19:1953451-1953473 GTTGATGGCGTCTGAGGCTCTGG + Intronic
1161405497 19:4089193-4089215 GTGGCTGGCAACTGTGTTTCTGG - Intergenic
1161784143 19:6312566-6312588 CTGGCTGGTGACTGAGTGTCTGG - Intronic
1162996466 19:14338969-14338991 CTTGCTGGCCTCTGAGGCTCTGG - Intergenic
1163637345 19:18443471-18443493 GTGGATGGCGGCTGTGACTCAGG - Exonic
1164501581 19:28824592-28824614 GAGGCTGGAGAATGGGGCTCTGG - Intergenic
1164811813 19:31163448-31163470 GTGGCTGGGCACAGTGGCTCAGG + Intergenic
1166525111 19:43505610-43505632 TTGGCTGGGCACAGAGGCTCAGG + Intergenic
1166997831 19:46728206-46728228 GTGGCTGGGGCCTGAGGCCTAGG - Intronic
1167182984 19:47919482-47919504 GTGGCTGTGCACTGAGGCTTCGG + Intergenic
1167183652 19:47924832-47924854 GTGGCTGTGCACTGAGGCTTCGG + Intergenic
1167184952 19:47935234-47935256 GTGGCTGTGCACTGAGGCTTCGG + Intergenic
1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG + Intergenic
1167541598 19:50091534-50091556 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167542270 19:50096871-50096893 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167542706 19:50099936-50099958 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167543142 19:50103001-50103023 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167543578 19:50106064-50106086 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167544251 19:50111411-50111433 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167544926 19:50116764-50116786 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167545601 19:50122115-50122137 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1167546278 19:50127443-50127465 GTGGCTGTGCACTGAGGCTTCGG - Intergenic
1168496958 19:56861193-56861215 GTGGTTGAGGGCTGAGGCTCAGG - Intergenic
925989698 2:9244614-9244636 GTGCCAGGCCACTGAGGCACAGG - Intronic
927856374 2:26530241-26530263 GTGGCGGGAGGCTGAGGCTAAGG + Intronic
928324633 2:30309791-30309813 GAAGCTGGGGACAGAGGCTCAGG - Intronic
930578553 2:53182283-53182305 GAGGCTGGCTAATGAGTCTCTGG - Intergenic
932852256 2:75198996-75199018 GTGGCTGGCGCCTGGGGCTCAGG + Exonic
933490518 2:82980700-82980722 GTGGCTGGGCACGGTGGCTCAGG + Intergenic
935297891 2:101666309-101666331 GTGGCAGGCTACTGAGGAACAGG - Intergenic
937019882 2:118640548-118640570 GTGGGTAGAGACTGAGGCCCGGG + Intergenic
937096056 2:119235901-119235923 GTGGCTGGGCACTGGGGCACTGG - Intronic
938696800 2:133842092-133842114 TTGGGTGGCCTCTGAGGCTCAGG + Intergenic
941951504 2:171160859-171160881 GTGGGTGGCGGCTGAGGCGGTGG + Intronic
942849079 2:180461486-180461508 CTGGCCAGCGACAGAGGCTCGGG + Intergenic
944391706 2:199225593-199225615 GTGGTTGGCCACTGTAGCTCCGG - Intergenic
945642278 2:212444614-212444636 GTGGCTGGGGAAAGAGGCTGAGG - Intronic
947653913 2:231810231-231810253 GTGGCTGGGAGCTCAGGCTCTGG - Intergenic
948088567 2:235271084-235271106 GCGGCTGGCCACTGAGGTTGCGG - Intergenic
948257137 2:236576702-236576724 GTGGCCTGCGACAAAGGCTCTGG - Intronic
948458118 2:238116707-238116729 GTGGCTGTGGGATGAGGCTCGGG + Intronic
948822552 2:240557475-240557497 GTGGGTGGCGGCCCAGGCTCCGG - Intronic
1169186273 20:3619920-3619942 GTGGCAGGCTAGGGAGGCTCTGG - Intronic
1171201795 20:23247770-23247792 GAGGCAGGAAACTGAGGCTCAGG - Intergenic
1173163637 20:40671007-40671029 GTGGCTGGGGAGTGAGGTGCTGG - Intergenic
1173847527 20:46197602-46197624 CTGGGTAGCAACTGAGGCTCTGG - Intronic
1173857242 20:46258320-46258342 ATGGCTCAAGACTGAGGCTCAGG + Intronic
1174229330 20:49031626-49031648 GTGGCTGGGCTCAGAGGCTCAGG + Intronic
1174290610 20:49505852-49505874 GTGCCTGGAGGCTGAGGCCCAGG + Exonic
1174304360 20:49604609-49604631 CTGGCTGACTACTGAGCCTCTGG + Intergenic
1175791040 20:61739865-61739887 GTGGCTGGAGGCTGAGCCTGAGG - Intronic
1178244155 21:30935771-30935793 TGGGCTGGCGACTGAGGCAGGGG - Intergenic
1178453760 21:32728154-32728176 GTAGCTGGAGACTGAGGCTGGGG - Intergenic
1179034509 21:37747946-37747968 GTGCCTGGAGACTGAGTCACAGG + Intronic
1180000440 21:44993122-44993144 ATGGCTGGTGGCTGTGGCTCAGG - Intergenic
1180079321 21:45479710-45479732 GTGGCTGGCGAAATGGGCTCAGG + Intronic
1180749284 22:18113279-18113301 GTGGCTCAGGACAGAGGCTCTGG - Intronic
1180835079 22:18925764-18925786 GTGCCTGTCACCTGAGGCTCAGG - Intronic
1181001212 22:19988617-19988639 GTAGCTGGGGGCTGAGGCTGGGG - Intronic
1181116899 22:20636949-20636971 GTGGCTGGAGCTGGAGGCTCGGG + Intergenic
1181780735 22:25191024-25191046 GAGGCAGGTGACTGGGGCTCTGG + Intronic
1182554584 22:31122444-31122466 GTGGCTGGAGCCTGAGTGTCTGG + Intergenic
1183063179 22:35347684-35347706 TTGGCTGGCCACTGAGGGTAGGG + Exonic
1183261153 22:36796851-36796873 GTGGCTGGAGACTGAGGAACTGG + Intergenic
1183936091 22:41263206-41263228 GTGCCTGGAAACTGAGGCTCAGG - Intronic
1184642575 22:45880268-45880290 GGGGCTGGTGACAGAGGCTTTGG + Intergenic
1184661579 22:45967876-45967898 CTGGCTGGAGCCTGAGGCCCTGG + Intronic
1184679661 22:46063450-46063472 GTGCCTGGCCAGGGAGGCTCTGG + Intronic
1203285168 22_KI270734v1_random:151063-151085 GTGCCTGTCACCTGAGGCTCAGG - Intergenic
952902386 3:38118825-38118847 ATGGCTGTTCACTGAGGCTCTGG - Intronic
953982988 3:47421990-47422012 GCGTCTGGCGACTGCGGCACAGG + Intronic
954457293 3:50606824-50606846 TCTGCTGGGGACTGAGGCTCCGG + Exonic
954674953 3:52310641-52310663 GTTGCTGCAGACAGAGGCTCTGG - Intergenic
954972761 3:54664832-54664854 GTGGCTGGAGGTGGAGGCTCTGG + Intronic
958428047 3:94002346-94002368 GTGGCTGGGTACAGTGGCTCAGG - Intronic
961216617 3:125165026-125165048 GTGGCTGGAGACTGAGGCCTGGG + Intronic
963478484 3:145836826-145836848 TTGGCTGGGGACGGTGGCTCAGG - Intergenic
964119911 3:153172970-153172992 GTGACTCAAGACTGAGGCTCAGG + Intergenic
964811033 3:160665039-160665061 GTGGTGGGCGCCTGAGGCTGAGG - Intergenic
965291648 3:166888814-166888836 ATGGCTGGGGACAGAGGCTGAGG + Intergenic
966189533 3:177259607-177259629 GTGGCTGGGCACAGTGGCTCAGG - Intergenic
966758142 3:183390644-183390666 GTGGCTGGGTACTGAGGCCGAGG + Intronic
969593115 4:8133095-8133117 GCGGCTGCAGGCTGAGGCTCGGG - Intronic
971105996 4:23524719-23524741 GTGGCAGGTGGCTGAGGCCCAGG - Intergenic
972194584 4:36638242-36638264 TTGGCTGGCTCCTGAGGCCCAGG - Intergenic
972715270 4:41639898-41639920 GTGACTTGAAACTGAGGCTCAGG - Intronic
974644515 4:64673990-64674012 GTGGCTGGGGAGAGAGGCTGAGG + Intergenic
982452244 4:155566828-155566850 GTGGGTGGCGAATGGGGCTGGGG - Intergenic
985206084 4:187538606-187538628 GTGGCTGGGCACAGTGGCTCAGG + Intergenic
985830186 5:2222348-2222370 CTGGTTGGCGTCTGAAGCTCTGG - Intergenic
986220598 5:5765546-5765568 CTGGCTGGTGTTTGAGGCTCAGG + Intergenic
992774665 5:80078976-80078998 GTGAGTGGCAACTGAGGCCCTGG - Intronic
995283783 5:110364102-110364124 GTGGTTTGCCACTGGGGCTCAGG + Intronic
995967608 5:117927842-117927864 GTGTCTGGCCTGTGAGGCTCTGG - Intergenic
1000386633 5:160680741-160680763 GTGGGTGGGGACTGTGGCTCAGG + Intronic
1001049177 5:168400665-168400687 GTGGCTGGGCACAGTGGCTCAGG + Intronic
1001709725 5:173768520-173768542 GTGGTTGGCAAGTCAGGCTCTGG + Intergenic
1002344027 5:178535776-178535798 GGGGCTGGGGACTCTGGCTCAGG - Intronic
1002427077 5:179182780-179182802 GTGGCTGGTCACCGTGGCTCCGG + Intronic
1002508811 5:179699186-179699208 GTGGCCGGCGACTGAGGGGTCGG + Intronic
1002922862 6:1585536-1585558 CAGGCTAGGGACTGAGGCTCGGG + Intergenic
1005312052 6:24568115-24568137 GTGGCTGCAGCCTGAGGCACAGG - Intronic
1006090527 6:31626033-31626055 GTGGCGGGCCCCCGAGGCTCAGG + Exonic
1006629392 6:35420301-35420323 GTGGCTGGCCACTGAGGCTGTGG + Intronic
1008426014 6:51357501-51357523 GAGGCTGGGGGCTGGGGCTCAGG + Intergenic
1010741692 6:79513655-79513677 GTGGCTCTCTATTGAGGCTCTGG + Exonic
1010794820 6:80106716-80106738 CCGGCTGGCTACTCAGGCTCAGG + Exonic
1011101063 6:83723161-83723183 GGGGCTAGAGACTGAGGCTGAGG - Intergenic
1012125060 6:95418615-95418637 GTGGTTGGCAACTGAGGCTGGGG + Intergenic
1017732211 6:157326665-157326687 GTGGCAGGCTTCTGAGGCTCTGG - Intergenic
1018083284 6:160277235-160277257 GTGGTTAGCGACTAAGGCACTGG + Intronic
1018724075 6:166597184-166597206 GTGGCTGGGGACATAGGCTACGG + Intronic
1019005740 6:168795030-168795052 TTGGCTGGGGATTCAGGCTCAGG + Intergenic
1019492172 7:1320547-1320569 GTGGTGGGAGCCTGAGGCTCTGG + Intergenic
1024700609 7:51900984-51901006 GTGGGTGGGGGCGGAGGCTCAGG + Intergenic
1025086151 7:56025102-56025124 ATGGCTGGGTACTGTGGCTCTGG - Intronic
1028439952 7:90848380-90848402 CTGGCTGGGCACTGTGGCTCAGG - Intronic
1029706906 7:102280899-102280921 GTGCCTGGAGACAGAGGCTCAGG - Intronic
1030047597 7:105511460-105511482 GTGGTTGGGTACTGTGGCTCAGG + Intronic
1030190243 7:106803510-106803532 GTGCCAGGAGACAGAGGCTCTGG - Intergenic
1030277644 7:107737416-107737438 GTGGCTGGGGAAAGAGGCTGAGG - Intergenic
1031221526 7:118972519-118972541 CTGGCTGGGCACTGTGGCTCAGG - Intergenic
1031682134 7:124688124-124688146 GTGGCTGGGGAAAGAGGCTGAGG - Intergenic
1032425315 7:131818152-131818174 GTGAGTGGAGACTGAGGCTTTGG + Intergenic
1034911751 7:155003214-155003236 GTGGCTGGCGGCAGAGGCGCGGG - Intergenic
1034968201 7:155404218-155404240 GGTGCTGGTGACCGAGGCTCAGG - Intergenic
1037662817 8:20941868-20941890 GTGGCTGCACACTGAGGCTTTGG + Intergenic
1037825291 8:22156794-22156816 GTGGCTGCGGACTGCGGCGCGGG + Exonic
1037911420 8:22745847-22745869 GAGGCAGGAAACTGAGGCTCAGG + Intronic
1038307700 8:26419808-26419830 GTGGCTGCAGAGTGAGGTTCTGG - Intronic
1040284193 8:46091686-46091708 GTGGCTGGAGCCCCAGGCTCTGG + Intergenic
1040538260 8:48328722-48328744 GGGGGTGGCTGCTGAGGCTCAGG + Intergenic
1041737874 8:61131085-61131107 GTGACCAGCCACTGAGGCTCAGG - Intronic
1041748544 8:61234695-61234717 GTGGCTGGGGACTGAACCTGGGG - Intronic
1043729722 8:83661141-83661163 GTGGGTGGCAAGTCAGGCTCTGG - Intergenic
1048989758 8:139754405-139754427 GTGCCTGTGGACTGTGGCTCTGG - Intronic
1049340723 8:142111179-142111201 GGTGCTGGCGACTGCGGCACCGG + Intergenic
1049381814 8:142319933-142319955 GCAGCTGGCGTCTGAGGCTTTGG + Intronic
1049771554 8:144384564-144384586 GTGGGTGACGACAGAGCCTCGGG + Intronic
1051637091 9:19190568-19190590 TTGGCTGGGTACTGTGGCTCAGG + Intergenic
1055018314 9:71643056-71643078 GTGGCTGGGCACGGTGGCTCAGG + Intergenic
1056687430 9:88778142-88778164 GTGGCTCGCTAGTGAGGCCCTGG + Intergenic
1056897602 9:90565514-90565536 GTGGCTCAGGACTGAGGCTGAGG - Intergenic
1057041718 9:91853102-91853124 CTGGCTGGGGACTGGGGCTGAGG + Intronic
1057928350 9:99171907-99171929 GTTGATGGAGTCTGAGGCTCAGG - Intergenic
1058432744 9:104933238-104933260 TTGGCTGGGCACTGTGGCTCTGG + Intergenic
1060828958 9:126702013-126702035 GTGGCTGGCCACTGAGGCACGGG + Intergenic
1061831814 9:133300971-133300993 GTGGCTGGGCACGGTGGCTCAGG + Intergenic
1062565863 9:137163722-137163744 CTGGCCAGCAACTGAGGCTCTGG + Intronic
1062678030 9:137759809-137759831 CTGGATGGCGTCTGGGGCTCTGG + Intronic
1187888078 X:23907703-23907725 GTCGCTGGCAGCGGAGGCTCCGG + Exonic
1189799286 X:44676811-44676833 GTGGCGGGCGCCTGATACTCGGG + Intergenic
1195018773 X:100804930-100804952 ATGGCTGGATACTCAGGCTCAGG + Intergenic
1198504816 X:137290918-137290940 CTGGCTGGCCACTGGGGCCCAGG + Intergenic
1200340382 X:155389865-155389887 GTGGCTGGGGAAAGAGGCTGAGG + Intergenic