ID: 1083425249

View in Genome Browser
Species Human (GRCh38)
Location 11:62581015-62581037
Sequence ACTAAGACATGGAGAGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083425246_1083425249 3 Left 1083425246 11:62580989-62581011 CCTATTATCTGCATTGTAGATGA 0: 1
1: 0
2: 2
3: 22
4: 185
Right 1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG 0: 1
1: 0
2: 1
3: 10
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083425249 Original CRISPR ACTAAGACATGGAGAGCTAA AGG Intronic
900670702 1:3852466-3852488 ACTAACACATGGACATTTAAAGG + Intronic
902614994 1:17618850-17618872 AATAAAACATGCAGAGCTAAAGG - Intronic
902656713 1:17874117-17874139 ACTAAGACATGGAGGGATGAAGG + Intergenic
902692975 1:18121794-18121816 ACTTGGACATTGAGAGCCAATGG - Intronic
903629796 1:24759320-24759342 ACTAAGTGCTGGAGAGGTAAAGG + Intronic
903795614 1:25927048-25927070 CCTAAGAGAGGGAGAGCCAAGGG + Intergenic
906944964 1:50287684-50287706 ACTAAGGCATAGAGAGTCAAGGG + Intergenic
907718571 1:56950706-56950728 ACTGAGGCATGGAGAGGTCAAGG - Intronic
909542079 1:76802596-76802618 ACTAAGAGATGGTGAGCCACAGG + Intergenic
912272353 1:108224144-108224166 ACTAGGACATGGAGTTGTAAGGG - Intronic
912295868 1:108470177-108470199 ACTAGGACATGGAGTTGTAAGGG + Intronic
912585403 1:110760011-110760033 GCTAAGAAATGGAGATCCAATGG - Intergenic
915917691 1:159950852-159950874 CCTAAGACATGGAAATCTATAGG + Intergenic
917241484 1:172953653-172953675 ACTAACACATGTAGTGCTTATGG - Intergenic
918037435 1:180888671-180888693 GCTAAGACAAGGAGTGTTAAAGG + Exonic
918131537 1:181633870-181633892 ACTAAAGCATGGAGAGGTTAAGG + Intronic
920500707 1:206483243-206483265 CCTGAGGCCTGGAGAGCTAAAGG + Intronic
921558284 1:216625886-216625908 AGTAAGACAGGGAGAGATATAGG - Intronic
922164539 1:223104152-223104174 ACTAATTCATGTAGAGCTTATGG - Intergenic
1062805960 10:419616-419638 ACTGAGGCACGGAGAGCTTAAGG - Intronic
1065480898 10:26192990-26193012 TCTAGGACTTTGAGAGCTAAGGG - Intronic
1067429788 10:46235535-46235557 ATTAAGAAATGGAAAGCTGAGGG - Intergenic
1069536146 10:69254861-69254883 ACTAATAAATGGAGAGGAAAAGG + Intronic
1069950088 10:72012603-72012625 CCTGAGGCAAGGAGAGCTAAGGG + Exonic
1072167471 10:92827945-92827967 ACTAGGATTTGGGGAGCTAATGG - Intergenic
1072396219 10:95044944-95044966 TCTAAAACATGGAGAGACAATGG - Intronic
1072836078 10:98713855-98713877 AATAATAAATGGAGAGGTAAAGG - Intronic
1079717865 11:23771138-23771160 CCTAAGACAGAGAGAGTTAAAGG - Intergenic
1080414457 11:32056269-32056291 ACTAAGACCCAGAGAGGTAAAGG + Intronic
1081071771 11:38618806-38618828 ACTAAGATATTCAGAGGTAAGGG + Intergenic
1081273322 11:41115189-41115211 ACTAAAACTTTCAGAGCTAAAGG + Intronic
1082078253 11:47991640-47991662 ACCAGGACATGGAGAACTATGGG + Intronic
1082085110 11:48043759-48043781 GCTAAGCCATGGTGGGCTAATGG + Intronic
1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG + Intronic
1085718272 11:78891701-78891723 ACTGAGATGTGGAGAGGTAATGG + Intronic
1087350822 11:97030032-97030054 ACTGGGAGAGGGAGAGCTAATGG - Intergenic
1087378580 11:97375845-97375867 ACTAAGACTATGTGAGCTAAGGG + Intergenic
1087816556 11:102664822-102664844 ACTAAGGCACGGAGAGGTTAAGG + Intergenic
1089069920 11:115691632-115691654 AATAAGTTCTGGAGAGCTAATGG + Intergenic
1090066360 11:123507137-123507159 ACAAACACATGGAGAGCAGAAGG - Intergenic
1091072245 11:132578648-132578670 ACAAAGACAGGCAGAGCTACTGG - Intronic
1092215842 12:6681591-6681613 ACTAAGATACTGAGAGCTAAAGG + Intronic
1092471068 12:8781575-8781597 ACAAAGACAGGGAGAGATAGAGG - Intronic
1095105080 12:38223783-38223805 ACTGTGGCATGGAGAGCAAAAGG - Intergenic
1097638354 12:62148725-62148747 ACTAAGAAATGTAGAGACAAAGG + Intronic
1098085857 12:66842447-66842469 ACTGAGGCAGGGAGTGCTAAAGG - Intergenic
1103894326 12:124263284-124263306 ATTAGGACATGGAGAGAGAAGGG - Intronic
1104974186 12:132545033-132545055 ACTGAGACACAGAGAGCTCAGGG + Intronic
1105251821 13:18706076-18706098 AATCTGACAAGGAGAGCTAAAGG + Intergenic
1106473536 13:30078419-30078441 ACTGAGGCACGGAGAGCTTAAGG + Intergenic
1107911245 13:45107506-45107528 AAAAAGACTTGGAAAGCTAAAGG + Intergenic
1115026567 14:28754235-28754257 AATAAGACATAGAGAGACAACGG - Intergenic
1116704466 14:48279362-48279384 ACAAATAGATGGAGAGCAAAGGG + Intergenic
1119120536 14:72072164-72072186 ACTAAAGCATGGAGAGGTTAAGG + Intronic
1120764067 14:88312336-88312358 AATATGACAAGGAGTGCTAACGG + Intronic
1121848950 14:97201620-97201642 AATAAGATATGGAGAGGTGAAGG - Intergenic
1202845673 14_GL000009v2_random:171712-171734 ACCAAGACACAGAGAGTTAAGGG + Intergenic
1202915069 14_GL000194v1_random:161980-162002 ACCAAGACACAGAGAGTTAAGGG + Intergenic
1202877610 14_KI270722v1_random:20738-20760 ACCAAGACACAGAGAGTTAAGGG - Intergenic
1124609487 15:31198496-31198518 TCTTAGACATGGTGAGCTGAAGG - Intergenic
1125155154 15:36577710-36577732 ACTAAGACATGAAAAGGTTAAGG - Intergenic
1126763327 15:51989428-51989450 ATTAAGACATGGATAGCTTTTGG + Intronic
1127871587 15:63078335-63078357 ACCAAAACAAGGAGAGCAAAAGG - Intergenic
1127944099 15:63732525-63732547 ACTAATACAGGGAAAGCTATAGG + Intronic
1129228269 15:74182312-74182334 AACAAGACATGGAGGGCTCAGGG - Intronic
1129993868 15:79988031-79988053 ACTGAGACATGGAGAGTGATAGG + Intergenic
1130193978 15:81761822-81761844 ACTGAGACACAGAGAGATAAAGG - Intergenic
1132645335 16:996928-996950 ACAAAGGCATGGAGGGCTCATGG + Intergenic
1135488837 16:22889681-22889703 ACTGAGACTTGGGGAGCTTAAGG + Intronic
1137003011 16:35247619-35247641 AGTAAGACATGGCCAGCTGACGG - Intergenic
1138119508 16:54387907-54387929 ACTAACGCTTGGAGAGCTCAGGG + Intergenic
1138939934 16:61777901-61777923 ACTAAAATATGGAAAGTTAAAGG - Intronic
1139171764 16:64638912-64638934 CTTAAGAAAAGGAGAGCTAAGGG + Intergenic
1139366528 16:66437189-66437211 ACTGAGACCTGGAGAGGTGAGGG - Intronic
1139845390 16:69917511-69917533 AATTAGAAATTGAGAGCTAATGG + Intronic
1140451499 16:75074642-75074664 ACCAAGACATGGACACCTCAGGG + Intronic
1141968633 16:87464498-87464520 ACGCAGACAGGAAGAGCTAAAGG + Intronic
1144123662 17:12180938-12180960 ATTAAGAGAGGGAGAGTTAAGGG + Intergenic
1146029312 17:29351153-29351175 ACTAAGAATGGGAAAGCTAACGG - Intergenic
1147293143 17:39459928-39459950 ACTAAGGCATGGAGAAATGAAGG - Intergenic
1147472196 17:40673461-40673483 TCAAAGACAGGAAGAGCTAAGGG - Intergenic
1148386159 17:47236693-47236715 AGTCAGACATGGAGTGGTAAGGG + Intergenic
1149615251 17:57991900-57991922 ACAAAGTCATAGAGAGCAAAGGG + Intronic
1152480661 17:80550042-80550064 ACTAATACATGGACTGCCAAAGG + Intronic
1156164908 18:34406723-34406745 ATTAAGACATAGAGACATAACGG + Intergenic
1156493947 18:37513500-37513522 AGAAAGGCATGGAGAGCTACTGG + Intronic
1158558660 18:58495725-58495747 GCTAAGACATGAGGAGCGAAGGG + Intronic
1159317731 18:66800725-66800747 ATTAAAACATGGAGAGGTATAGG + Intergenic
1164487088 19:28667839-28667861 ACTAAGACAGGGAGGCATAAGGG + Intergenic
1202673071 1_KI270710v1_random:12206-12228 ACCAAGACACAGAGAGTTAAGGG + Intergenic
925296134 2:2778828-2778850 ACTAAGACATGGAGGCCAGAGGG - Intergenic
925833360 2:7918154-7918176 AAGAGGACATGGAGAGCTGATGG - Intergenic
926137439 2:10346786-10346808 ACAAAGACATGGAGAAGGAAGGG - Intronic
926193831 2:10748760-10748782 ATTAAGACTCAGAGAGCTAAAGG - Intronic
927368541 2:22327662-22327684 TCAAAGACATGGAATGCTAATGG + Intergenic
930307143 2:49688966-49688988 AATAAGAGATGGTGAGCTAATGG - Intergenic
931228816 2:60356737-60356759 AGTAAGCAATGGAGAGCAAAAGG - Intergenic
933198185 2:79416732-79416754 AATAAGACATGGAGAGAAAGAGG + Intronic
936871842 2:117142449-117142471 ACTTATACATGGAGAGTAAATGG + Intergenic
940786886 2:157990822-157990844 ACTAAGACATATAGAGTTCATGG - Intronic
940789258 2:158014479-158014501 AATAAGAGATGGAGTGCTATTGG - Intronic
942731809 2:179068517-179068539 ACTGAAACATGGAGAGATTAAGG - Intergenic
943396044 2:187336051-187336073 ACTCACACAAGGAGAGGTAAAGG - Intergenic
944823975 2:203461740-203461762 TCTAAGATATGGAGAGATACAGG - Intronic
945317910 2:208390964-208390986 TCAAAGCCTTGGAGAGCTAAGGG - Intronic
946644167 2:221815695-221815717 GCTAAGCCCTGCAGAGCTAAAGG + Intergenic
946669856 2:222091168-222091190 ACCAGGACATGGAAAGCTATGGG - Intergenic
947704296 2:232261869-232261891 ACTAAGACATAGAGAAATTAAGG - Intronic
1171960041 20:31486672-31486694 ACTAAGGCATGGAGAGATGGAGG - Intergenic
1173639963 20:44594722-44594744 ACTAGGACCTGGAGAAATAAAGG - Intronic
1176221766 20:63972677-63972699 ACTTACACAGGGAGAGCTGACGG - Intronic
1176634422 21:9176626-9176648 ACCAAGACACAGAGAGTTAAGGG + Intergenic
1176837347 21:13805962-13805984 AATCTGACAAGGAGAGCTAAAGG + Intergenic
1180390276 22:12224632-12224654 ACCAAGACACAGAGAGTTAAGGG + Intergenic
1180415659 22:12709835-12709857 ACCAAGACACAGAGAGTTAAGGG - Intergenic
1181282884 22:21732240-21732262 GCCAAGACATAGAGGGCTAAGGG - Intronic
1182534113 22:30987310-30987332 TTTAAGACATGGAGACCTACTGG + Intergenic
949691322 3:6643219-6643241 ACCAAGACATGCTGATCTAATGG + Intergenic
951541825 3:23789288-23789310 ACTGGGACATAGAGAGGTAAGGG - Intergenic
955472302 3:59298286-59298308 ACTAGGCCTTGGAGAGGTAATGG + Intergenic
956783655 3:72624424-72624446 ACTAAGCCCTGAAGAGCTTAGGG - Intergenic
957101963 3:75838908-75838930 ACCAAGACACAGAGAGTTAAGGG + Intergenic
958462003 3:94410102-94410124 ACTAAGTCATGAAGAGTTGAAGG + Intergenic
959263164 3:104105508-104105530 ACTAATACAGTGAGAGATAAGGG - Intergenic
960185051 3:114628005-114628027 ACTGAGACATGGGGAGTTAAGGG - Intronic
960375634 3:116898035-116898057 ACTGAGGCATAGAGTGCTAAAGG + Intronic
964022594 3:152031958-152031980 ACTAAGACCTGGAGAAATCATGG + Intergenic
964530985 3:157667581-157667603 TCTGAGACCTGGAGAGCTGACGG - Intronic
965053072 3:163676500-163676522 ACTAAGACCTCAAAAGCTAAAGG + Intergenic
965305007 3:167052978-167053000 ACCATGAAATGGAGACCTAAAGG + Intergenic
965372766 3:167884927-167884949 AATTGGACATGGAGAACTAAGGG - Intergenic
966315343 3:178638419-178638441 ATTCAGACATGCAGAGATAATGG - Intronic
970360781 4:15306980-15307002 ACTAAGACTTGGAGAGAATAAGG + Intergenic
971577343 4:28292247-28292269 ACTAAAATATGGAGATCTATAGG + Intergenic
973256195 4:48116058-48116080 ACTAAGACTTAGAGAAGTAAAGG - Intronic
974072906 4:57141328-57141350 CCTAAGACAGAGAGGGCTAAAGG - Intergenic
974100271 4:57408675-57408697 AGTAACACATTGAGAGCAAAGGG - Intergenic
974817012 4:67018340-67018362 ACTATGAAATGCAGAGATAAAGG + Intergenic
975421322 4:74167436-74167458 ATAAAGAAATGGAGAGCTACAGG + Intronic
975567430 4:75773373-75773395 ACTAAGACCTTGAAAGCTAGTGG + Intronic
976125667 4:81831564-81831586 ACTAAAGCATGAAGACCTAATGG - Intronic
976710433 4:88065145-88065167 AGTAAGTCATGAAGAACTAAAGG - Intronic
976958205 4:90931960-90931982 AAAAAGCCATAGAGAGCTAAAGG + Intronic
977499743 4:97823839-97823861 CCTAAGACAGAGAGAGTTAAAGG + Intronic
978579053 4:110214361-110214383 AAAAAGAAATAGAGAGCTAACGG + Intergenic
979369949 4:119873026-119873048 ACTAAGACAGGTCAAGCTAAGGG - Intergenic
979482117 4:121231416-121231438 ACTCTGACATGGATAGCAAAGGG + Intergenic
980607987 4:135118308-135118330 ACTAAGACATTGAGAACTTCAGG + Intergenic
982681962 4:158441952-158441974 ACTAAGGGAGGGAGAGCAAAGGG + Intronic
984153632 4:176166117-176166139 TCCAACACATGGAAAGCTAAAGG - Exonic
986786386 5:11118133-11118155 ACTAGCACATGCTGAGCTAATGG + Intronic
988418011 5:30970567-30970589 ACTGAGACACAGAGTGCTAAGGG + Intergenic
989133665 5:38131770-38131792 AATAAGAAATGGAGAGGCAAAGG - Intergenic
989524909 5:42442140-42442162 ACTGAGACAGGGAGAGAGAAAGG + Intronic
991262862 5:64685685-64685707 ACTGAGGCATGGAGAGGTTAAGG - Intergenic
992898249 5:81266549-81266571 ACTAACATCTGGATAGCTAATGG - Intergenic
993308196 5:86295848-86295870 ACTAGGACATGGAGTTGTAAGGG + Intergenic
993466512 5:88253514-88253536 ACAAAGACAAGGAGAACAAATGG + Intronic
995844825 5:116482147-116482169 ACTGAGGCCTGGAGAGGTAAAGG - Intronic
997137498 5:131342340-131342362 ACTAAGAGATGGAGAGGCACAGG + Intronic
998753015 5:145345237-145345259 ACTAAGCCCTGGAGACATAAAGG + Intergenic
1000540663 5:162535588-162535610 ACAAAGACTTGGAGAGGTTAAGG - Intergenic
1000710001 5:164561766-164561788 ACTGAGACATAGAGAGATTAAGG + Intergenic
1001471409 5:172015768-172015790 ACTATAACATGGAGGGCTCATGG - Intergenic
1003776255 6:9368849-9368871 ACTAAGACACACAGAGGTAAAGG + Intergenic
1004015026 6:11724268-11724290 CCGCAGACTTGGAGAGCTAAGGG - Intronic
1004162900 6:13230231-13230253 GCTAGAACCTGGAGAGCTAAAGG - Intronic
1006332830 6:33404672-33404694 ACTAAGACAGGGAGTGCTATGGG - Intronic
1008932197 6:56953327-56953349 AATAAAACATGGAGAGCTTTAGG + Intronic
1010476231 6:76291694-76291716 AGTGAGAAATGGAGAGATAATGG + Intergenic
1010508998 6:76694265-76694287 ACTAAGACATGGTGGGGGAAAGG - Intergenic
1013047638 6:106503151-106503173 ACTAAGAGATGGAGAGATTAGGG + Intergenic
1013792875 6:113856232-113856254 AGTTAGACTTGGAGAGCTCAGGG + Intergenic
1014324669 6:119977994-119978016 CTTAAGACAGGGAGAGGTAATGG - Intergenic
1018433053 6:163737959-163737981 ACTAAGAAATGGGGATCGAAAGG - Intergenic
1018778460 6:167041439-167041461 ACTAAGACATGAAGAGCTGAAGG - Exonic
1019108324 6:169688754-169688776 TCAAAGACATGGAGAGACAAGGG + Intronic
1020765301 7:12312283-12312305 GCTAAGACAGGGAGAGAGAAGGG + Intergenic
1021223655 7:18002951-18002973 AGTAAGACTTGGACAACTAATGG - Intergenic
1028538669 7:91918225-91918247 ACTAAGACAAGGACAGATTATGG + Intergenic
1029306734 7:99625141-99625163 ACTGAGACCTGGAAAGCTCAAGG - Intronic
1030039017 7:105433403-105433425 AGTAAGCCATGAAGAGCAAATGG - Intergenic
1031727432 7:125258461-125258483 TCTGAGACAAGGAAAGCTAATGG - Intergenic
1034007863 7:147494042-147494064 ACTAAAGCATTGGGAGCTAAGGG + Intronic
1034234532 7:149556431-149556453 AATCAGACATGTAGACCTAAAGG + Intergenic
1035017711 7:155781182-155781204 ATTGAGACATGGAGAGATGACGG + Exonic
1035969672 8:4233940-4233962 ACTAATGCATGGAGAGCTTAAGG + Intronic
1038159888 8:25026439-25026461 AAAAAGACAAGGAGAGCTAATGG + Intergenic
1038195226 8:25360966-25360988 ACTAAGACCTGGAGAAATGAGGG + Intronic
1039328727 8:36513457-36513479 CCTAAGAAATGGAGATCCAAAGG + Intergenic
1041923176 8:63205728-63205750 ACTAAGAAATGATGAGCTACCGG - Intronic
1043678675 8:82994618-82994640 TCTAAGCCAGGGAGAGATAAAGG - Intergenic
1047810683 8:128405543-128405565 ATGAAAACATAGAGAGCTAAAGG - Intergenic
1048035176 8:130671185-130671207 ACTAAGACATGGACATCTTTTGG - Intergenic
1049819159 8:144624003-144624025 GCTAAGACCTGGAGAGCTGACGG + Intergenic
1050494740 9:6229202-6229224 ACTGAGACCTGGAGAGCTGTAGG + Intronic
1051025448 9:12605203-12605225 AGTAAGACATAGAGAGGTTAAGG + Intergenic
1051114411 9:13677723-13677745 ACTAAGAGATGGATACCAAAAGG - Intergenic
1051289088 9:15527563-15527585 AGTAAGACGTGGACAGGTAAAGG + Intergenic
1051570207 9:18547895-18547917 ACAAAGACAGGGAGAACAAAAGG + Intronic
1051689952 9:19700883-19700905 TCTAAGAAATGCAGACCTAACGG + Intronic
1054747954 9:68874237-68874259 ATTAAGACATGGAGAAGTATGGG - Intronic
1056000113 9:82206409-82206431 ACTGAGGCATGGAGAGGTTAAGG + Intergenic
1058419170 9:104818495-104818517 CTTAAGGCATGGAAAGCTAAGGG - Intronic
1058561511 9:106233606-106233628 ATTAAGCCATGGAGGGCTGAAGG + Intergenic
1061082522 9:128380425-128380447 AGGAAGACATGGGGTGCTAAAGG + Intronic
1061732234 9:132624608-132624630 ACTGAGACTTAGAGAGGTAAAGG - Intronic
1203757259 Un_GL000218v1:144266-144288 ACCAAGACACAGAGAGTTAAGGG + Intergenic
1203650869 Un_KI270751v1:120495-120517 ACCAAGACACAGAGAGTTAAGGG + Intergenic
1186209119 X:7231445-7231467 ATTAAGACGTGGAAAGCCAAAGG - Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1189115399 X:38337040-38337062 ACAAAGATCTGGAGAGATAAAGG - Intronic
1190444574 X:50510610-50510632 ACTAATGCAGGGAGAGCAAAGGG + Intergenic
1190534406 X:51411475-51411497 ACTTAGACATGGAGACACAAAGG - Intergenic
1194498511 X:94650000-94650022 AATAAGAGACGGGGAGCTAATGG + Intergenic
1195010369 X:100727847-100727869 ACTGAGACAGGGAGTGCTGAGGG + Intronic
1195870906 X:109484458-109484480 ACTAAAACTTAGAGATCTAATGG - Intergenic
1196383023 X:115114149-115114171 ACTAAGACATGGATCGCAGAAGG - Intronic
1197974438 X:132151638-132151660 ATTAAGACATGGATAGCTTTGGG - Intergenic
1198167478 X:134071790-134071812 ACTAAGGCATGAAGAGGTTAAGG - Intergenic
1199101655 X:143808675-143808697 ACTAAGCCATGTAGAAATAAAGG - Intergenic
1201170837 Y:11261881-11261903 ACCAAGACACAGAGAGTTAAGGG + Intergenic