ID: 1083429344

View in Genome Browser
Species Human (GRCh38)
Location 11:62605854-62605876
Sequence GGGCTTCTCCCCTGTAATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083429344_1083429354 14 Left 1083429344 11:62605854-62605876 CCTGGATTACAGGGGAGAAGCCC 0: 1
1: 0
2: 1
3: 30
4: 491
Right 1083429354 11:62605891-62605913 CCTCAGCAATGCATTCTTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083429344 Original CRISPR GGGCTTCTCCCCTGTAATCC AGG (reversed) Exonic
900316121 1:2057293-2057315 GGGCTCCTCCCCGGTACTGCTGG + Intronic
901942707 1:12675910-12675932 GGGCATCTCTCCTGTAATCCTGG - Intergenic
902344843 1:15808758-15808780 GTGCCTCACGCCTGTAATCCTGG - Intergenic
902862464 1:19256245-19256267 GTGGTTCACGCCTGTAATCCTGG + Intronic
903095592 1:20970092-20970114 GTGGTTCACACCTGTAATCCTGG - Intronic
903159137 1:21472387-21472409 TGGCTTCTGCCCTGTTATTCAGG - Intronic
903590758 1:24454158-24454180 GGGCCTCATGCCTGTAATCCTGG - Intronic
904561604 1:31401871-31401893 GTGGCTCTCACCTGTAATCCCGG + Intergenic
904697561 1:32338824-32338846 TGGCTTCTCGCCTGTCATCCCGG + Intergenic
905869351 1:41394359-41394381 GGGCTCCTGCCCTGTCACCCTGG - Intergenic
905899214 1:41570048-41570070 GGACTTCTCCTCTGAACTCCGGG - Intronic
906141431 1:43536035-43536057 GTGGCTCACCCCTGTAATCCCGG - Intronic
906517869 1:46450105-46450127 GTGCCTCACGCCTGTAATCCTGG + Intergenic
906548659 1:46641949-46641971 GGACTTCTCCCATGAAGTCCAGG + Intronic
906783207 1:48590823-48590845 GGACTTCTCCTATGTAAGCCAGG - Exonic
907052355 1:51338258-51338280 TGGCTTCTTCACTATAATCCAGG + Intronic
907431035 1:54411622-54411644 GTGGTTCACGCCTGTAATCCCGG + Intronic
908022666 1:59914677-59914699 GGACCTCTCCCCTGGAAGCCGGG + Intronic
911098670 1:94076768-94076790 GGGCTTCCTTCCTGGAATCCAGG - Intronic
911145287 1:94546305-94546327 GTGGTTCACACCTGTAATCCCGG - Intergenic
912348640 1:108990091-108990113 GTGCCTCCCACCTGTAATCCTGG + Intronic
912560154 1:110545502-110545524 AGGCTTCTCTCCTGAACTCCAGG + Intergenic
914146708 1:145001750-145001772 GTGGCTCACCCCTGTAATCCCGG + Intronic
914461385 1:147888942-147888964 GGGCCTCTCTCCTGTTATCCAGG - Intergenic
915379261 1:155425844-155425866 GGGGCTCCCACCTGTAATCCTGG - Intronic
917386580 1:174482743-174482765 GTGGCTCACCCCTGTAATCCTGG - Intronic
917933247 1:179838912-179838934 GTGCTTCTGCTCTGTAATTCTGG + Intergenic
919060272 1:192623169-192623191 GGGCTTCTTCCCTGGGATCCTGG - Intergenic
920091822 1:203459343-203459365 GTGGTTCTCGCCTGTAATCCTGG - Intergenic
920478151 1:206296698-206296720 GTGGCTCACCCCTGTAATCCCGG - Intronic
920770121 1:208876328-208876350 GTGGTTCACACCTGTAATCCTGG + Intergenic
920788433 1:209064996-209065018 GGGCTTCTCAGCTGGAACCCAGG - Intergenic
921759771 1:218899631-218899653 GTGGCTCACCCCTGTAATCCTGG + Intergenic
922370295 1:224903751-224903773 GTGACTCTCACCTGTAATCCTGG - Intronic
924515383 1:244761287-244761309 GTGGCTCACCCCTGTAATCCTGG - Intergenic
1062779454 10:188316-188338 GTGGTTCACACCTGTAATCCCGG + Intronic
1062876694 10:948513-948535 GGGGCTCACGCCTGTAATCCCGG - Intergenic
1063571076 10:7215130-7215152 GTGGTTCACACCTGTAATCCCGG + Intronic
1063681656 10:8193896-8193918 GGGCTTATCCCCTGAATTCAAGG - Intergenic
1063727408 10:8653057-8653079 GTGGTTCTCGTCTGTAATCCTGG - Intergenic
1064148580 10:12844198-12844220 GTGGCTCTCGCCTGTAATCCTGG + Intergenic
1064211535 10:13364204-13364226 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1064924914 10:20559218-20559240 GGGCTTCATCCCTGGAATGCAGG + Intergenic
1065134739 10:22656536-22656558 GTGGTTCACACCTGTAATCCCGG + Intronic
1065144665 10:22756171-22756193 GTGCTGCACACCTGTAATCCTGG - Intergenic
1065333113 10:24624606-24624628 GTGGTTCACACCTGTAATCCTGG - Intronic
1065717529 10:28586991-28587013 GTGCTTCCCACCTGTAGTCCTGG + Intronic
1065879212 10:30025247-30025269 GTGGTTCACGCCTGTAATCCTGG + Intronic
1066367800 10:34793516-34793538 GTGCCTCACACCTGTAATCCCGG + Intronic
1067271924 10:44799222-44799244 GTGGCTCACCCCTGTAATCCCGG + Intergenic
1067860140 10:49838160-49838182 GTGCCTCACGCCTGTAATCCCGG + Intronic
1068298534 10:55107763-55107785 GTGATTCACGCCTGTAATCCCGG - Intronic
1071292845 10:84200142-84200164 GAGCTTCGCCCTTGTTATCCAGG - Intronic
1071933626 10:90501516-90501538 GTGGCTCACCCCTGTAATCCAGG + Intergenic
1072191546 10:93080458-93080480 GGGCTTCTCCCTTCTATGCCAGG + Intergenic
1072568972 10:96642154-96642176 GTGCCTCACGCCTGTAATCCCGG + Intronic
1072715442 10:97749452-97749474 GTGGTTCTTCCCTGTCATCCAGG + Exonic
1072975821 10:100056818-100056840 GTGGTTCTCACCTGTAATCCCGG - Intronic
1073178253 10:101569454-101569476 CGGCATCTCCCCTCTCATCCTGG - Intergenic
1074620968 10:115121376-115121398 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1075277410 10:121106544-121106566 GTGGTTCACGCCTGTAATCCTGG - Intergenic
1076846147 10:133070407-133070429 GGGCCTCACACCTGTGATCCCGG - Intergenic
1077046428 11:548412-548434 GTGCTTCATGCCTGTAATCCTGG - Intronic
1077301404 11:1848815-1848837 CGGCTTCTCCCCTCAAATCCAGG + Intergenic
1078490490 11:11763410-11763432 GTGGTTCACACCTGTAATCCTGG - Intergenic
1079982603 11:27167022-27167044 TGGCTTCTCCCCTTGAATCTGGG - Intergenic
1080372849 11:31672519-31672541 GTGGTTCCCACCTGTAATCCTGG + Intronic
1082766625 11:57173705-57173727 GTGCCTCACACCTGTAATCCTGG - Intergenic
1083121294 11:60515144-60515166 GGACTTCTCCTCAGTGATCCTGG + Intergenic
1083245325 11:61422583-61422605 GGTAGTCACCCCTGTAATCCCGG - Intronic
1083294330 11:61707081-61707103 GGGCTTCATCCCTGTCAACCAGG - Intronic
1083429344 11:62605854-62605876 GGGCTTCTCCCCTGTAATCCAGG - Exonic
1083623041 11:64058409-64058431 GGGGTCCTCCCCTGTATGCCAGG + Intronic
1083818264 11:65150269-65150291 GTGCCTCACGCCTGTAATCCCGG + Intergenic
1084278831 11:68072721-68072743 GTGGTTCACACCTGTAATCCTGG + Intronic
1084325482 11:68397458-68397480 GGCCCTCTCCCCTGGAAGCCGGG + Intronic
1084959452 11:72708766-72708788 GTGGCTCACCCCTGTAATCCCGG + Intronic
1085048888 11:73369316-73369338 GGGATTCTACCATGTAACCCTGG - Intergenic
1085537074 11:77228228-77228250 GTGGCTCACCCCTGTAATCCCGG + Intronic
1086443912 11:86854266-86854288 GGGGCTCACACCTGTAATCCCGG - Intronic
1086683484 11:89703540-89703562 GGGGCTCACGCCTGTAATCCTGG + Intergenic
1086922286 11:92601289-92601311 GTGACTCACCCCTGTAATCCCGG + Intronic
1087457569 11:98406160-98406182 GTGCCTCACGCCTGTAATCCCGG - Intergenic
1087498542 11:98920406-98920428 GTGGCTCACCCCTGTAATCCTGG - Intergenic
1088305064 11:108399083-108399105 GGCCTCCATCCCTGTAATCCTGG + Intronic
1088572930 11:111240985-111241007 GGTTTTCTCCCATGTAAACCAGG + Intergenic
1088639540 11:111858201-111858223 GTGGTTCACGCCTGTAATCCCGG - Intronic
1088824216 11:113480170-113480192 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1090030680 11:123203531-123203553 GGGCCTCTCCCCTGACTTCCTGG + Intergenic
1090665277 11:128911150-128911172 AGGCTTCTCTTCTGTTATCCAGG - Intronic
1091335551 11:134763010-134763032 CGGCTTCTCCCCTGAAGGCCTGG - Intergenic
1092804809 12:12211166-12211188 GTGGTTCACACCTGTAATCCCGG + Intronic
1093025700 12:14243351-14243373 GTGGTTCACACCTGTAATCCCGG - Intergenic
1093870605 12:24286669-24286691 GTGGCTCTCACCTGTAATCCCGG - Intergenic
1096324989 12:50652044-50652066 GTGGTTCACACCTGTAATCCCGG + Intronic
1096388646 12:51212510-51212532 GTGGTTCTTGCCTGTAATCCCGG + Intronic
1096696700 12:53353779-53353801 GTGCCTCACGCCTGTAATCCCGG + Intergenic
1097000345 12:55871187-55871209 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1097209892 12:57359183-57359205 GTGGTTCACGCCTGTAATCCCGG - Intronic
1097389257 12:58989401-58989423 GTGCCTCACACCTGTAATCCCGG + Intergenic
1097625027 12:61989572-61989594 TGGCTTCTCCCCTGTAAAGAGGG - Intronic
1097648469 12:62264250-62264272 GTGGTTCACACCTGTAATCCCGG - Intronic
1098775509 12:74609279-74609301 GTGGCTCACCCCTGTAATCCCGG - Intergenic
1100747200 12:97659486-97659508 GTGTTCCTCCCCTGTATTCCAGG + Intergenic
1101079593 12:101169642-101169664 GGGCTGCTCCTCTGGGATCCTGG - Intronic
1102568794 12:113814874-113814896 GTGCTTCACTCCTGTAATCCCGG - Intergenic
1102779385 12:115551009-115551031 GGGTTTCACTCCTGTCATCCTGG + Intergenic
1103117100 12:118344427-118344449 CTGCTTCTCCCCTGTGAGCCAGG - Intronic
1103271600 12:119678030-119678052 GTGGTTCACGCCTGTAATCCCGG - Intronic
1103454959 12:121058183-121058205 GTGGTTCTCGCCTGTAATCCCGG - Intergenic
1103771031 12:123324588-123324610 GGGGCTCACGCCTGTAATCCAGG - Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104347438 12:128013961-128013983 GTGGCTCTCGCCTGTAATCCTGG + Intergenic
1105057741 12:133118206-133118228 GTGGTTCACGCCTGTAATCCTGG - Exonic
1106811326 13:33361071-33361093 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1109145267 13:58772620-58772642 GTGGCTCTCACCTGTAATCCCGG + Intergenic
1109489881 13:63083366-63083388 GTGGTGCTCCCCTGTAATCCTGG - Intergenic
1109742180 13:66568644-66568666 GGGTTTTTCCCCTGTCATTCAGG - Intronic
1109748738 13:66662202-66662224 GTGGCTCACCCCTGTAATCCTGG + Intronic
1110589443 13:77238294-77238316 GGGACTCTCCCATGTAAGCCAGG + Intronic
1111598680 13:90443886-90443908 GTGCCTCACGCCTGTAATCCTGG - Intergenic
1113693426 13:112328002-112328024 GGGCATCTCCCCTGTCAGCTTGG - Intergenic
1113824943 13:113245077-113245099 GGGCTCCTCCCCTGTAACTGAGG + Intronic
1114625266 14:24124771-24124793 GTGGTTCACACCTGTAATCCCGG + Exonic
1115712565 14:36067151-36067173 GGTCTTCTCCCCATGAATCCAGG + Intergenic
1117602323 14:57389124-57389146 GTGCCTCACGCCTGTAATCCTGG - Intergenic
1118174994 14:63429950-63429972 GGGGCTCACGCCTGTAATCCCGG - Intronic
1118645150 14:67831141-67831163 GTGGTTCACGCCTGTAATCCCGG - Intronic
1120998707 14:90436165-90436187 GTGGTTCACACCTGTAATCCTGG + Intergenic
1121769740 14:96522671-96522693 GTGGCTCACCCCTGTAATCCTGG - Intronic
1122350842 14:101089268-101089290 GTGGCTCACCCCTGTAATCCCGG + Intergenic
1122876895 14:104671637-104671659 GTGGTTCACACCTGTAATCCTGG + Intergenic
1122963251 14:105109361-105109383 GTGGTTCACGCCTGTAATCCTGG + Intergenic
1123106620 14:105844814-105844836 GGGCTTCTCACCTGTGTTACGGG + Intergenic
1202870143 14_GL000225v1_random:155255-155277 AGGTTTCTCCTCTGTAAACCAGG + Intergenic
1125578783 15:40771544-40771566 GGCCTTCTCCCCTTTCTTCCTGG - Exonic
1125703489 15:41709702-41709724 GGGGTTCATGCCTGTAATCCCGG - Intronic
1125861977 15:43008233-43008255 GGGCTTCTGCCCTGCAAACTTGG - Intronic
1126829153 15:52582037-52582059 TGGATTCTCTCCTGTTATCCTGG - Exonic
1127066125 15:55240714-55240736 GGGCTCCTCACCTGTAAAACAGG + Intronic
1128102634 15:65015787-65015809 AGGTTTCTCCACTGTACTCCAGG + Intronic
1128633070 15:69284698-69284720 GTGGCTCTCACCTGTAATCCCGG - Intergenic
1128684549 15:69674161-69674183 AGGCTTTTCTCCTGTACTCCAGG + Intergenic
1128687889 15:69700376-69700398 GGGTTTCTCTCCTGTAGTGCAGG + Intergenic
1128978510 15:72169836-72169858 GGGGTCCTCACCTGTAGTCCGGG + Exonic
1129830794 15:78668652-78668674 GTGGCTCACCCCTGTAATCCCGG + Intronic
1129995039 15:79997231-79997253 GTGGCTCTCGCCTGTAATCCTGG + Intergenic
1130322711 15:82854134-82854156 GTGGTTCACGCCTGTAATCCTGG + Intronic
1131082421 15:89547744-89547766 GGGGCTCACACCTGTAATCCTGG + Intergenic
1131210421 15:90490751-90490773 GGGCTTCTTTCCTGGACTCCAGG - Intronic
1131229470 15:90649349-90649371 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1131251513 15:90833747-90833769 GTGGTTCACACCTGTAATCCCGG - Intergenic
1131563507 15:93464435-93464457 GTGGCTCACCCCTGTAATCCCGG - Intergenic
1131704535 15:94978806-94978828 GTGGCTCACCCCTGTAATCCTGG + Intergenic
1132524311 16:406766-406788 GTGGTTCACACCTGTAATCCTGG - Intronic
1132524324 16:406822-406844 GTGATTCACACCTGTAATCCTGG - Intronic
1132524336 16:406878-406900 GTGGTTCACACCTGTAATCCTGG - Intronic
1132737700 16:1395126-1395148 GTGGTTCACGCCTGTAATCCCGG - Intronic
1133610030 16:7424526-7424548 GTGGTTCACACCTGTAATCCCGG - Intronic
1133666701 16:7975065-7975087 GTGCCTCACGCCTGTAATCCTGG + Intergenic
1133984487 16:10657866-10657888 GTGGTTCACGCCTGTAATCCCGG - Intronic
1134057716 16:11180941-11180963 GGGCTTCTACCCTGCATCCCTGG + Exonic
1134173157 16:11984921-11984943 GTGGTTCACACCTGTAATCCTGG - Intronic
1134399988 16:13900912-13900934 GTGGCTCACCCCTGTAATCCTGG - Intergenic
1134487369 16:14669319-14669341 GTGGTTCGCGCCTGTAATCCCGG + Intergenic
1134589012 16:15436525-15436547 GTGCCTCACACCTGTAATCCCGG - Intronic
1134876639 16:17705735-17705757 GTGGTTCTTGCCTGTAATCCCGG - Intergenic
1135583308 16:23646842-23646864 GTGGTTCACGCCTGTAATCCCGG - Intronic
1136449274 16:30343558-30343580 GGGGCTCACACCTGTAATCCCGG + Intergenic
1137597508 16:49734566-49734588 TGGCTCCTCCCCTGTCCTCCTGG + Intronic
1137657752 16:50175007-50175029 GTGGCTCACCCCTGTAATCCCGG - Intronic
1138402381 16:56757344-56757366 GTGGTTCACGCCTGTAATCCCGG + Intronic
1138606301 16:58091677-58091699 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1138811932 16:60161273-60161295 GTGCCTCACGCCTGTAATCCCGG + Intergenic
1139336065 16:66232157-66232179 GGGCGTCTCCCCAGGTATCCTGG - Intergenic
1139345906 16:66303708-66303730 GGGATGCTCCCCTGTAAGGCTGG + Intergenic
1139524039 16:67502509-67502531 GTGGTTCACGCCTGTAATCCTGG + Intergenic
1139742601 16:69048368-69048390 GTGGTTCACGCCTGTAATCCTGG - Intronic
1139753991 16:69128179-69128201 GTGGTTCACGCCTGTAATCCTGG - Intronic
1140576369 16:76174665-76174687 GTGCTTCATGCCTGTAATCCCGG + Intergenic
1141118323 16:81330936-81330958 GTGGTTCACGCCTGTAATCCTGG + Intronic
1141527345 16:84619807-84619829 GGGCTTTCCCCCTGTTATCCAGG - Intergenic
1142368730 16:89665810-89665832 GTGATTCACGCCTGTAATCCCGG + Intronic
1142425639 16:90000900-90000922 GGGCCTCTCCCGTCTAAGCCTGG - Intergenic
1142494354 17:298426-298448 GTGGCTCACCCCTGTAATCCTGG + Intronic
1143122821 17:4619602-4619624 GGGGCTCACGCCTGTAATCCCGG - Intergenic
1143291102 17:5829686-5829708 GTGGTTCACACCTGTAATCCCGG - Intronic
1143839797 17:9723166-9723188 GGGCTTCTCACCTGCAACCCTGG - Intronic
1143881678 17:10034895-10034917 GGATTTCTGCCCTGGAATCCTGG + Intronic
1145109154 17:20146636-20146658 GTGGTTCACGCCTGTAATCCTGG + Intronic
1146323316 17:31864114-31864136 GTGGTTCACACCTGTAATCCCGG + Intronic
1146335329 17:31964670-31964692 GTGCTTCACGTCTGTAATCCTGG - Intronic
1146368257 17:32246777-32246799 GTGGTTCACACCTGTAATCCTGG - Intronic
1146396657 17:32473250-32473272 GGGGTTCACTCCTGTAATCTCGG - Intronic
1146681837 17:34814120-34814142 GGGCTTCTTCTGTGTGATCCTGG - Intergenic
1148063972 17:44855292-44855314 GTGGCTCACCCCTGTAATCCCGG + Intronic
1149867713 17:60159869-60159891 GTGATTCACGCCTGTAATCCTGG + Intronic
1150168035 17:62963795-62963817 GTGGTTCACGCCTGTAATCCTGG + Intergenic
1150182823 17:63143882-63143904 GGGGCTCTCACCTGTAATCCTGG + Intronic
1150338255 17:64345442-64345464 GTGGTTCACACCTGTAATCCCGG + Intronic
1150416453 17:64992655-64992677 GGGTTTCTCCCATGTTGTCCAGG - Intergenic
1150912136 17:69399430-69399452 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1151061215 17:71096666-71096688 GTGCCTCACACCTGTAATCCCGG + Intergenic
1151207729 17:72520303-72520325 GGGTTTCTCTCTTGTCATCCAGG - Intergenic
1151208507 17:72526293-72526315 GTGGTTCACACCTGTAATCCCGG - Intergenic
1151499553 17:74480248-74480270 GGGCTCCTCCCCTTTAATTCTGG + Intronic
1151554994 17:74842328-74842350 TGGCTTCTGCCATGAAATCCTGG - Exonic
1151603150 17:75118933-75118955 GGACTTCGCCCCTGTCATCCAGG + Intronic
1151753749 17:76058525-76058547 GTGGTTCACACCTGTAATCCTGG - Intronic
1152109130 17:78347684-78347706 GGGCTCCTCCCCTCCACTCCAGG + Intergenic
1152125947 17:78446910-78446932 GTGGCTCTCACCTGTAATCCTGG - Intronic
1152170694 17:78745623-78745645 GTGGCTCACCCCTGTAATCCCGG + Intronic
1152761848 17:82112600-82112622 GGGATTCTGCCCTGAAATGCCGG + Intronic
1152967836 18:132847-132869 GGGGCTCACGCCTGTAATCCCGG + Intergenic
1157585389 18:48797743-48797765 GGGTTTCTCTCCTGTAAAACAGG + Intronic
1157764950 18:50289024-50289046 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1158275067 18:55758183-55758205 GGTCTTCTCACCTGTAAACCAGG + Intergenic
1159941529 18:74412445-74412467 GGGCTTCTCTCCTCTCTTCCCGG - Intergenic
1160117631 18:76096715-76096737 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1160664862 19:321374-321396 GGGGCTCACACCTGTAATCCCGG + Intronic
1160884974 19:1341578-1341600 GGGGTGCACGCCTGTAATCCCGG + Intergenic
1160931987 19:1575159-1575181 GTGGTTCACACCTGTAATCCCGG + Intronic
1160979503 19:1810530-1810552 GTGGCTCTCCCCTGTAATCCCGG - Intronic
1161051584 19:2166677-2166699 GTGGCTCACCCCTGTAATCCCGG - Intronic
1161270301 19:3385973-3385995 GGGGGTCACGCCTGTAATCCTGG - Intronic
1161330003 19:3682238-3682260 GGGGTGCGCGCCTGTAATCCCGG + Intronic
1161357421 19:3826704-3826726 GTGCCTCACGCCTGTAATCCCGG - Intronic
1161830155 19:6596946-6596968 GTGGTTCACGCCTGTAATCCCGG + Intronic
1161945158 19:7431246-7431268 GTGGCTCACCCCTGTAATCCTGG + Intronic
1162354055 19:10170015-10170037 GTGTTTCACCCCTGTAATCCTGG + Intronic
1165048793 19:33127982-33128004 GTGGTTCACACCTGTAATCCTGG - Intronic
1165193409 19:34081950-34081972 GTGGCTCACCCCTGTAATCCCGG - Intergenic
1166686022 19:44796756-44796778 CTGCTTCTCCCCAGCAATCCAGG - Intronic
1166722208 19:45002985-45003007 GGGCTGCTCACCTGTGCTCCTGG - Exonic
1166878949 19:45915125-45915147 GTGCCTCACACCTGTAATCCTGG + Intergenic
1166941140 19:46366601-46366623 GTGCCTCACACCTGTAATCCTGG - Intronic
1167306079 19:48710381-48710403 GTGATTCACGCCTGTAATCCTGG - Intergenic
1167329638 19:48847159-48847181 GTGCCTCACTCCTGTAATCCTGG + Intronic
1167877897 19:52429444-52429466 GTGCCTCACGCCTGTAATCCTGG + Intronic
1168366603 19:55793298-55793320 GTGGTTCACACCTGTAATCCTGG + Intronic
926416224 2:12652183-12652205 TGGCTTCACGTCTGTAATCCCGG + Intergenic
927104205 2:19810058-19810080 AGGTTTCTCCACTGTACTCCTGG - Intergenic
927341489 2:21988816-21988838 GAGCTTCTGCCCTGAAGTCCAGG + Intergenic
927789540 2:25999687-25999709 GGGGCTCACGCCTGTAATCCCGG - Intergenic
927986358 2:27413871-27413893 GTGGTTCACGCCTGTAATCCCGG + Intergenic
928620389 2:33082691-33082713 GTGGTTCACGCCTGTAATCCCGG - Intronic
929198523 2:39211137-39211159 GTGGTTCACACCTGTAATCCTGG + Intronic
929747051 2:44669904-44669926 GGGACTCACACCTGTAATCCTGG - Intronic
930845185 2:55895807-55895829 GTGGTTCACGCCTGTAATCCCGG - Intronic
931435902 2:62246069-62246091 GTGGTTCACGCCTGTAATCCTGG + Intergenic
932589416 2:73055217-73055239 GGCCTTCTGCCGTGTAATCTCGG + Intronic
932963093 2:76438512-76438534 GTGGTTCACACCTGTAATCCCGG - Intergenic
933553702 2:83806983-83807005 GTGGCTCTCACCTGTAATCCCGG + Intergenic
933663116 2:84943688-84943710 GGGCTTTTACCCTGTTAGCCAGG - Intergenic
933822282 2:86124354-86124376 GTGCCTCACACCTGTAATCCTGG + Intronic
934078743 2:88450238-88450260 GGGCTTTTCCCATGTTATCCAGG - Intronic
934125581 2:88886017-88886039 GGGCATCTACCCGGGAATCCGGG + Intergenic
941056661 2:160797065-160797087 GTGATTCACACCTGTAATCCCGG - Intergenic
941997167 2:171611681-171611703 GTGGTTCACGCCTGTAATCCCGG - Intergenic
942229080 2:173842830-173842852 GTGGTTCACCCCTGTAATCTCGG - Intergenic
942243706 2:173987838-173987860 GTGGTTCACACCTGTAATCCCGG - Intergenic
942362139 2:175183361-175183383 GTGGTTCACGCCTGTAATCCCGG + Exonic
943448950 2:188024160-188024182 GTGGTTCACACCTGTAATCCAGG - Intergenic
944556211 2:200890087-200890109 GTGGCTCACCCCTGTAATCCCGG + Intronic
944699693 2:202235768-202235790 GCGCCTCACACCTGTAATCCTGG - Intronic
944741872 2:202620390-202620412 GTGGCTCGCCCCTGTAATCCCGG + Intergenic
945318156 2:208392728-208392750 TCTCTTCTCCTCTGTAATCCAGG - Intronic
945372994 2:209044127-209044149 GGTTTTCTCCCCTATAATTCTGG + Intergenic
945684126 2:212948776-212948798 GGGCCTATCCCCTGAAATCCAGG + Intergenic
945867138 2:215188981-215189003 GTGGTTCACACCTGTAATCCCGG - Intergenic
947096287 2:226570700-226570722 GTGTTTCACACCTGTAATCCCGG - Intergenic
1169052383 20:2591883-2591905 GTGGTTCACGCCTGTAATCCTGG + Intronic
1169234480 20:3919178-3919200 GTGGTTCACACCTGTAATCCTGG - Intronic
1171108572 20:22459348-22459370 GTGGTTCTCGCCTGTAATCCTGG + Intergenic
1171293121 20:23993954-23993976 GGGCAGCTCCCCTGTAAGCTGGG + Intergenic
1171472278 20:25381762-25381784 GGGATTATCTCCTGTAATCCTGG - Intronic
1171961932 20:31501064-31501086 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1172025024 20:31942731-31942753 GGTCTTCTCATCTGTAAACCAGG - Intronic
1172228494 20:33321339-33321361 GTGGCTCACCCCTGTAATCCCGG - Intergenic
1172579215 20:36033619-36033641 GTGGTTCACACCTGTAATCCTGG - Intergenic
1173336965 20:42119971-42119993 GTGCTTTTCTCCTGTTATCCAGG - Exonic
1173494033 20:43506059-43506081 GTGCCTCACGCCTGTAATCCCGG - Intergenic
1173783820 20:45777787-45777809 GGGGCTCACGCCTGTAATCCTGG - Intronic
1174004962 20:47403198-47403220 GTGGCTCACCCCTGTAATCCTGG - Intergenic
1174212720 20:48892570-48892592 GGGGCTCACACCTGTAATCCCGG - Intergenic
1174342950 20:49909289-49909311 GGGGCTCACACCTGTAATCCTGG - Intronic
1174490262 20:50888085-50888107 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1174577587 20:51547562-51547584 GGGCCTCTCCACAGAAATCCAGG + Intronic
1174943970 20:54964238-54964260 TGGCTTTGCCCCTGTAATCTTGG - Intergenic
1175436223 20:58951158-58951180 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1180824182 22:18851670-18851692 GGGCAGCTCCCCTGTAAGCTGGG + Exonic
1180848759 22:18999616-18999638 GTGCCTCACACCTGTAATCCCGG + Intergenic
1181123125 22:20685919-20685941 GTGGCTCTCGCCTGTAATCCTGG + Intergenic
1181124609 22:20694824-20694846 GGGCAGCTCCCCTGTAAGCTGGG + Intergenic
1181188555 22:21122878-21122900 GGGCAGCTCCCCTGTAAGCTGGG - Intergenic
1181210645 22:21287615-21287637 GGGCAGCTCCCCTGTAAGCTGGG + Intergenic
1181501599 22:23318625-23318647 GGGCAGCTCCCCTGTAAGCTGGG - Intergenic
1181650555 22:24256783-24256805 GGGCAGCTCCCCTGTAAGCTGGG + Intergenic
1181706826 22:24653955-24653977 GGGCAGCTCCCCTGTAAGCTGGG - Intergenic
1181950347 22:26549388-26549410 GGGGCTCACGCCTGTAATCCCGG + Intronic
1183200488 22:36382667-36382689 GTGGTGCACCCCTGTAATCCTGG + Intronic
1183542817 22:38439506-38439528 GTGGTTCACGCCTGTAATCCCGG + Intronic
1184324272 22:43771160-43771182 GTGGCTCACCCCTGTAATCCCGG + Intronic
1184350552 22:43940781-43940803 GGGTTTCTCTCCTGTCACCCAGG - Intronic
1184560109 22:45257782-45257804 GTGCTTCATGCCTGTAATCCCGG + Intergenic
1203216302 22_KI270731v1_random:7815-7837 GGGCAGCTCCCCTGTAAGCTGGG - Intergenic
949362397 3:3245302-3245324 GTGCTGCACACCTGTAATCCCGG + Intergenic
949584582 3:5425236-5425258 GTGGCTCACCCCTGTAATCCCGG - Intergenic
950022203 3:9795266-9795288 GGGGCTCACGCCTGTAATCCCGG - Intronic
950774852 3:15340723-15340745 GGGTTTCTCTCCTGTCACCCAGG - Intronic
951228255 3:20145965-20145987 GGGCTGCTTTCCTGTAATTCTGG + Intronic
952265814 3:31785151-31785173 GTGGTTCACGCCTGTAATCCCGG - Intronic
952656000 3:35786253-35786275 GTGGTTCACGCCTGTAATCCCGG + Intronic
952730431 3:36632325-36632347 GTGGCTCACCCCTGTAATCCTGG - Intergenic
953663087 3:44905252-44905274 GTGGTTCACACCTGTAATCCCGG - Intronic
954053403 3:48001767-48001789 GGGGCTCACACCTGTAATCCTGG - Intronic
954646130 3:52132638-52132660 GTGCTTCTCTCCTGCAGTCCTGG - Intronic
955000585 3:54923765-54923787 GGGCTTCTGCTCTGTGATCTTGG + Intronic
955265912 3:57444457-57444479 GTGTTTCACACCTGTAATCCTGG - Intronic
955372116 3:58361026-58361048 GTGGTTCACGCCTGTAATCCTGG + Intronic
956400737 3:68877165-68877187 GGGCTTTCCCCATGTTATCCAGG - Intronic
956636563 3:71371049-71371071 GTGGTTCACGCCTGTAATCCTGG - Intronic
957138426 3:76319937-76319959 TGCCTTCCCCCCTCTAATCCTGG - Intronic
957217128 3:77335150-77335172 GTGGCTCACCCCTGTAATCCCGG + Intronic
958781563 3:98549538-98549560 AGGCTTCTCCACTGAAAGCCAGG + Intronic
958991366 3:100849490-100849512 GTGCCTCACGCCTGTAATCCCGG - Intronic
959361834 3:105403213-105403235 GCGGTTCACACCTGTAATCCCGG - Intronic
959631167 3:108508838-108508860 GGGCTTCTTCACTGTCACCCAGG + Intronic
959659187 3:108846380-108846402 AGGGTTCTCCCCTGTAAAGCAGG + Intronic
960485083 3:118241922-118241944 GGGTTTCTGCTCTGTAGTCCAGG - Intergenic
962715568 3:138123136-138123158 GTGGTTCACACCTGTAATCCTGG - Intergenic
962879432 3:139562310-139562332 GGGCTTCTCCAGTATAATGCAGG - Intronic
963136138 3:141906446-141906468 GTGGTTCACACCTGTAATCCTGG - Intronic
963395789 3:144731642-144731664 GTGGTTCTTGCCTGTAATCCCGG + Intergenic
964109220 3:153071804-153071826 GGGGCTCACGCCTGTAATCCCGG + Intergenic
965203182 3:165687236-165687258 GTGGCTCACCCCTGTAATCCTGG + Intergenic
966979585 3:185119382-185119404 GTGGTTCACGCCTGTAATCCCGG + Intronic
967157338 3:186705527-186705549 GGGCATGACGCCTGTAATCCCGG + Intergenic
969600431 4:8172853-8172875 GTGGTTCACACCTGTAATCCCGG + Intergenic
969623068 4:8288541-8288563 GTGGTTCACGCCTGTAATCCCGG - Intronic
970793493 4:19887727-19887749 CGGCTTTTCCCCTGTTAACCAGG - Intergenic
971362766 4:25952411-25952433 GTGGTTCACGCCTGTAATCCCGG + Intergenic
971456712 4:26852012-26852034 GGGCTTTTCCTCTGAATTCCTGG + Intergenic
971847563 4:31939923-31939945 GGGCCTCATGCCTGTAATCCCGG - Intergenic
972443453 4:39119316-39119338 GTGGCTCACCCCTGTAATCCCGG + Intronic
972634479 4:40870967-40870989 GTGGCTCACCCCTGTAATCCCGG - Intronic
972774909 4:42231506-42231528 GTGGCTCACCCCTGTAATCCCGG - Intergenic
972791517 4:42375642-42375664 TGGGTTCACCCATGTAATCCAGG + Intergenic
973848145 4:54934078-54934100 TGGCTTCTCCCCTGAACTCCAGG + Intergenic
974985745 4:69024287-69024309 GGACTTCTCAACTGAAATCCCGG - Intronic
976334998 4:83875454-83875476 GGGATTCTCTGCTGTAATCTGGG - Intergenic
976895243 4:90101553-90101575 GTGGTTCACACCTGTAATCCAGG - Intergenic
978272552 4:106908297-106908319 GTGGTTCACGCCTGTAATCCTGG - Intergenic
979164400 4:117508786-117508808 GGGCTTCAACTCTGAAATCCTGG + Intergenic
979276715 4:118822889-118822911 GGTCTTCTCCCCTTTACTTCTGG + Intronic
979402020 4:120260550-120260572 GTGGTTCACGCCTGTAATCCCGG - Intergenic
980768752 4:137343510-137343532 GTGGTTCACACCTGTAATCCCGG + Intergenic
981105443 4:140875442-140875464 GTGGCTCACCCCTGTAATCCTGG - Intronic
981696771 4:147566750-147566772 GGGTTTCATTCCTGTAATCCTGG - Intergenic
982280781 4:153681963-153681985 GTGGTTCACACCTGTAATCCCGG - Intergenic
984042757 4:174756912-174756934 GGGGCTCACGCCTGTAATCCCGG - Intronic
985429829 4:189868450-189868472 GTGGCTCTCGCCTGTAATCCTGG + Intergenic
987321206 5:16771034-16771056 GTGGTTCACACCTGTAATCCTGG - Intronic
987381841 5:17292772-17292794 AGGCTTCTCCCCAGTCCTCCAGG + Intergenic
988842843 5:35099906-35099928 GTGGTTCACGCCTGTAATCCCGG + Intronic
989121625 5:38010118-38010140 GGGCCTCCCCGCTGTAAGCCTGG + Intergenic
989633185 5:43508823-43508845 GTGGTTCACTCCTGTAATCCTGG + Intronic
989748401 5:44860402-44860424 GGGCTACTCCTCTGAAAGCCAGG - Intergenic
990594267 5:57297365-57297387 GTGTCTCTCGCCTGTAATCCCGG + Intergenic
992011485 5:72532034-72532056 GGACTTCTGCCCTGGAAGCCTGG + Intergenic
992397684 5:76382581-76382603 GTGGTTCACGCCTGTAATCCTGG + Intergenic
993637130 5:90358244-90358266 GTGACTCACCCCTGTAATCCTGG - Intergenic
997119541 5:131160043-131160065 GGGCTTCTCCAATGTTGTCCAGG + Intronic
999472912 5:151871830-151871852 GTGGTTCACGCCTGTAATCCCGG - Intronic
1000618359 5:163455493-163455515 GTGGTTCACGCCTGTAATCCCGG + Intronic
1001188578 5:169603585-169603607 GTGCCTCACACCTGTAATCCCGG + Intronic
1001400997 5:171446369-171446391 GGGCCTCTCCCCTGGAGCCCAGG + Intronic
1002359443 5:178659090-178659112 GTGGCTCTCACCTGTAATCCTGG - Intergenic
1003083580 6:3042543-3042565 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1003547727 6:7074683-7074705 GTGGCTCTCACCTGTAATCCTGG - Intergenic
1005292126 6:24390072-24390094 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1005473671 6:26186541-26186563 GTGGCTCTCACCTGTAATCCTGG - Intergenic
1005586101 6:27277938-27277960 GTGGCTCTCACCTGTAATCCCGG - Intergenic
1006539360 6:34726932-34726954 GTGGCTCACCCCTGTAATCCCGG - Intergenic
1006547998 6:34795344-34795366 GTGGCTCACCCCTGTAATCCCGG - Intronic
1006860711 6:37170137-37170159 GCGCTCCTCCCCTTTACTCCTGG + Intergenic
1006994872 6:38249908-38249930 GGGCTTATTCCTTGTAATTCTGG - Intronic
1008234344 6:49026063-49026085 AGGCTGCTCCCCTGAGATCCTGG - Intergenic
1008942450 6:57061656-57061678 GGGGCTCACACCTGTAATCCCGG - Intergenic
1009277095 6:61696523-61696545 GTGGCTCACCCCTGTAATCCTGG - Intronic
1010316430 6:74456280-74456302 GTGGTTCACGCCTGTAATCCTGG + Intergenic
1010898647 6:81398458-81398480 GTGCCTCACGCCTGTAATCCCGG - Intergenic
1011080561 6:83486231-83486253 GTGCCTCACACCTGTAATCCTGG + Intergenic
1012244699 6:96913441-96913463 GGGCTTTTCCCCTGAGAGCCAGG - Intergenic
1012446779 6:99314963-99314985 GTGCCTCACACCTGTAATCCCGG + Intronic
1012831303 6:104206589-104206611 GGGGCTCACACCTGTAATCCCGG + Intergenic
1013213041 6:108003649-108003671 GTGGTTCACGCCTGTAATCCTGG - Intergenic
1013244205 6:108271424-108271446 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1013302808 6:108819780-108819802 GTGCCTCACACCTGTAATCCCGG - Intergenic
1013588194 6:111597907-111597929 GGGCTTTTCCACTTCAATCCAGG - Intronic
1014126162 6:117779496-117779518 GGGTTTCACTCCTGTCATCCAGG + Intergenic
1015032817 6:128616223-128616245 GTGATTCACACCTGTAATCCTGG - Intergenic
1015524165 6:134159768-134159790 TGGCTCATCGCCTGTAATCCTGG + Intergenic
1015595367 6:134861232-134861254 GTGATTCACGCCTGTAATCCCGG + Intergenic
1016189928 6:141252422-141252444 GTGGTTCACGCCTGTAATCCTGG - Intergenic
1017532584 6:155311177-155311199 AAGCATCTCACCTGTAATCCAGG + Exonic
1018778529 6:167042083-167042105 GTGGTTCACGCCTGTAATCCCGG - Exonic
1019029491 6:168998008-168998030 GTGCCTCACACCTGTAATCCTGG - Intergenic
1019520365 7:1458168-1458190 GGGCTCCTCCCCTGTGCCCCTGG - Intronic
1019574077 7:1727874-1727896 GTGGCTCACCCCTGTAATCCTGG - Intronic
1020104279 7:5414213-5414235 GGGGTTCATGCCTGTAATCCCGG - Intronic
1021173551 7:17423689-17423711 GTGATTCACGCCTGTAATCCCGG - Intergenic
1022208589 7:28186319-28186341 GTGGTACACCCCTGTAATCCTGG + Intergenic
1022381800 7:29867306-29867328 GGGCTTCTCCCCATTCATCCAGG - Intronic
1023933312 7:44720333-44720355 GTGCCTCACGCCTGTAATCCCGG - Intergenic
1024380896 7:48695024-48695046 GTGGCTCACCCCTGTAATCCTGG + Intergenic
1024707884 7:51981121-51981143 GTGGTTCTCACCTGTAATCCCGG + Intergenic
1025291505 7:57729504-57729526 GTGCCTCACACCTGTAATCCCGG - Intergenic
1025744749 7:64232970-64232992 CTGGTTCACCCCTGTAATCCTGG + Intronic
1027046373 7:74994000-74994022 GGGCCTCTCCCCGGGCATCCTGG - Intronic
1030240365 7:107316543-107316565 GTGGCTCTCGCCTGTAATCCCGG + Intronic
1032160370 7:129504817-129504839 GTGGTTCACACCTGTAATCCCGG - Intronic
1032220314 7:129989436-129989458 GTGGCTCACCCCTGTAATCCCGG - Intergenic
1034148695 7:148895855-148895877 GGGGCTCACGCCTGTAATCCCGG - Intergenic
1034483004 7:151337562-151337584 GGCCTTCTCACCTGTGATTCAGG + Intergenic
1034679365 7:152916758-152916780 GTGTTTCACACCTGTAATCCAGG - Intergenic
1036103566 8:5814825-5814847 GGGGCTCACGCCTGTAATCCCGG - Intergenic
1036943140 8:13070324-13070346 GTGTTTCACACCTGTAATCCCGG + Intergenic
1037443631 8:18942885-18942907 GGGCTTGTTACCTGTCATCCTGG - Intronic
1038833651 8:31093367-31093389 GTGGTTCACGCCTGTAATCCCGG - Intronic
1038942828 8:32324274-32324296 AGGCTTATGCCCTGTAAGCCGGG + Intronic
1039430616 8:37522245-37522267 GGGCTTCCTCCCTTGAATCCTGG + Intergenic
1039482467 8:37884815-37884837 GTGGTTCACACCTGTAATCCTGG - Intronic
1039488951 8:37933206-37933228 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1039602762 8:38855276-38855298 GTGATTCACGCCTGTAATCCCGG + Intergenic
1039703379 8:39983593-39983615 GTGGCTCACCCCTGTAATCCCGG + Intronic
1041163962 8:55072940-55072962 GTGGCTCACCCCTGTAATCCCGG + Intergenic
1041486428 8:58382624-58382646 GGGTCTCACACCTGTAATCCTGG + Intergenic
1042582604 8:70297599-70297621 GTGGTTCACACCTGTAATCCTGG - Intronic
1042660550 8:71149804-71149826 GGTCAGCACCCCTGTAATCCTGG - Intergenic
1042847579 8:73184193-73184215 GGGGCTCACGCCTGTAATCCCGG - Intergenic
1042947433 8:74169256-74169278 GTGGTTCACACCTGTAATCCTGG - Intergenic
1043393100 8:79810099-79810121 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1044591217 8:93916518-93916540 GGGCTGCTCCCCTGTCGTGCAGG - Intronic
1044731519 8:95232165-95232187 GGGGCTCACACCTGTAATCCCGG - Intergenic
1045216608 8:100155699-100155721 GCGGTTCACACCTGTAATCCCGG + Intergenic
1046951918 8:120027434-120027456 GTGGTTCACACCTGTAATCCTGG + Intronic
1047988921 8:130265300-130265322 GTGGCTCACCCCTGTAATCCTGG + Intronic
1048021958 8:130547512-130547534 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1048514233 8:135091333-135091355 GGGCTGTTCCCCTGGAGTCCTGG - Intergenic
1049105478 8:140609813-140609835 GGGGCTCACACCTGTAATCCCGG + Intronic
1049105489 8:140609870-140609892 GGGGCTCACACCTGTAATCCCGG + Intronic
1049193655 8:141303629-141303651 GGGGTTCTGCCTTGAAATCCTGG - Intronic
1049419224 8:142509687-142509709 GGGCTTTTCTCCTGAAGTCCGGG + Intronic
1049565108 8:143334207-143334229 GGGCTTCTCACATGTCCTCCAGG + Intronic
1049609416 8:143546958-143546980 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1049656856 8:143802816-143802838 GGGCTTCTGCTCTGGAGTCCAGG + Intronic
1052140389 9:24974438-24974460 GTGGTTCACACCTGTAATCCCGG - Intergenic
1052442495 9:28515472-28515494 GCGGTTCACGCCTGTAATCCCGG - Intronic
1053073757 9:35116003-35116025 GAGCTCCTCCCCTGTAGCCCGGG + Intronic
1053504682 9:38631467-38631489 GGGGCTCACGCCTGTAATCCCGG - Intergenic
1055322315 9:75094773-75094795 GTGGTTCACACCTGTAATCCTGG + Intronic
1055450013 9:76422335-76422357 GTGGTTCACACCTGTAATCCTGG - Intronic
1055532495 9:77198929-77198951 GTGGTTCACGCCTGTAATCCTGG - Intronic
1055975650 9:81952093-81952115 GTGCTTCACACCTATAATCCCGG - Intergenic
1056153608 9:83813829-83813851 GTGGTTCACACCTGTAATCCTGG + Intronic
1056649811 9:88449066-88449088 GGCCTCCTCCCCTGTGATCGAGG + Intronic
1057548966 9:96038315-96038337 GGGCTTCTCTCCTTTTATTCGGG - Intergenic
1057577859 9:96257930-96257952 GTGGCTCACCCCTGTAATCCTGG - Intronic
1057832292 9:98416685-98416707 GGGCTTCTCCTCTGAGCTCCTGG + Intronic
1058897054 9:109409556-109409578 GTGGTTCACGCCTGTAATCCCGG + Intronic
1059110308 9:111551668-111551690 GCGGTTCACACCTGTAATCCCGG - Intronic
1059233926 9:112746322-112746344 GTGGTTCACACCTGTAATCCCGG + Intergenic
1059298117 9:113290592-113290614 AGGCTTCTCCCATGTAGTCAGGG + Intronic
1059406972 9:114107299-114107321 GTGCTTCTCATCTGTAATCCCGG + Intergenic
1059517629 9:114910468-114910490 GGGCTTCTGACTTCTAATCCAGG + Intronic
1060420256 9:123463639-123463661 GTGGTTCACGCCTGTAATCCTGG + Intronic
1060673514 9:125491506-125491528 GTGGCTCACCCCTGTAATCCCGG + Intronic
1060914024 9:127374031-127374053 GTGCTTCACGCCTGTAATCCAGG + Intronic
1061260522 9:129478379-129478401 GTGGTTCACACCTGTAATCCCGG + Intergenic
1062470332 9:136700528-136700550 GGGCCTCACGCCTGGAATCCCGG + Intergenic
1202799306 9_KI270719v1_random:160361-160383 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1203734310 Un_GL000216v2:121287-121309 AGGTTTCTCCTCTGTAAACCAGG - Intergenic
1186244598 X:7607376-7607398 GGGGCTCACGCCTGTAATCCTGG + Intergenic
1186753262 X:12643389-12643411 GTGCCTCACGCCTGTAATCCTGG - Intronic
1188526746 X:31095575-31095597 GTGGTTCACGCCTGTAATCCCGG + Intergenic
1189382050 X:40508974-40508996 GGGCTTCTCCACTGCTCTCCAGG + Intergenic
1189391754 X:40582157-40582179 GTGGTTCACGCCTGTAATCCCGG + Intronic
1190016561 X:46832512-46832534 GTGGTGCGCCCCTGTAATCCCGG - Intergenic
1190034611 X:47009891-47009913 GTGGTTCACACCTGTAATCCCGG - Intronic
1190081498 X:47360018-47360040 GTGCCTCACCCCTGTAATCCTGG + Intergenic
1190223693 X:48529705-48529727 GTGGTTCACACCTGTAATCCTGG - Intergenic
1190279102 X:48917981-48918003 GGGCGTCTCCCCTGCCCTCCAGG + Intronic
1190284511 X:48953358-48953380 GGGTTTCTCCCCTCTCTTCCTGG - Intronic
1190344733 X:49327141-49327163 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190345826 X:49336698-49336720 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190346928 X:49346248-49346270 GTGGCTCTCGCCTGTAATCCCGG - Intergenic
1190348177 X:49537275-49537297 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190349278 X:49546831-49546853 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190350382 X:49556387-49556409 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190351484 X:49565946-49565968 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190352584 X:49575499-49575521 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190353685 X:49585047-49585069 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190354787 X:49594569-49594591 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190355893 X:49604119-49604141 GTGGCTCTCGCCTGTAATCCCGG - Intronic
1190639227 X:52466736-52466758 TGATTTCTCCACTGTAATCCAGG + Intergenic
1191112839 X:56821193-56821215 GTGGTTCACGCCTGTAATCCCGG - Intergenic
1193265592 X:79464484-79464506 GGGCTTCTCCCGTGGAAGCCTGG + Intergenic
1196292623 X:113960978-113961000 GGGGCTCACGCCTGTAATCCCGG + Intergenic
1196828255 X:119757931-119757953 GGGCTTCTCTGCTGGAATCCTGG + Intergenic
1197049910 X:122045730-122045752 GGGCTTCTCCCATGAAAGCCTGG - Intergenic
1197222936 X:123930918-123930940 GTGCCTCACGCCTGTAATCCCGG - Intergenic
1197259447 X:124301928-124301950 GTGGCTCACCCCTGTAATCCTGG - Intronic
1197689656 X:129484942-129484964 AGGCTTCTGCCTGGTAATCCAGG - Intronic
1198251332 X:134881917-134881939 GAACTTCTCCCTTCTAATCCTGG - Intergenic
1198840178 X:140848123-140848145 GTGGTTCACACCTGTAATCCAGG - Intergenic
1199305413 X:146262084-146262106 GTGGTTCACACCTGTAATCCCGG - Intergenic
1199729568 X:150618383-150618405 TGGCTTGACACCTGTAATCCTGG + Intronic
1200156213 X:153977344-153977366 GTGGTTCACGCCTGTAATCCCGG + Intronic
1200204088 X:154303497-154303519 GGGGCTCACACCTGTAATCCCGG - Intronic
1201403302 Y:13626658-13626680 GTGGTTCACACCTGTAATCCTGG + Intergenic
1201782111 Y:17734820-17734842 GGGGCTCACACCTGTAATCCAGG - Intergenic
1201819442 Y:18171168-18171190 GGGGCTCACACCTGTAATCCAGG + Intergenic