ID: 1083434128

View in Genome Browser
Species Human (GRCh38)
Location 11:62631050-62631072
Sequence CGGAAAACATCAGAGATGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083434123_1083434128 -2 Left 1083434123 11:62631029-62631051 CCTGTGAGACTAGCATATTGCCG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1083434128 11:62631050-62631072 CGGAAAACATCAGAGATGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 271
1083434122_1083434128 5 Left 1083434122 11:62631022-62631044 CCATGTACCTGTGAGACTAGCAT 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1083434128 11:62631050-62631072 CGGAAAACATCAGAGATGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083434128 Original CRISPR CGGAAAACATCAGAGATGGA GGG Exonic
900315111 1:2052438-2052460 GGGAAAACAACAGGGAAGGAGGG - Intronic
900337214 1:2170209-2170231 CCGAAGATATCAGAGATGAAAGG - Intronic
902587599 1:17450310-17450332 TGGAGAACATCAGAGTTGGGAGG - Intergenic
904786295 1:32985503-32985525 CAGACAGCATCAGAGCTGGAAGG + Intergenic
904881647 1:33702162-33702184 GGGAAAAGAAAAGAGATGGAGGG + Intronic
905885633 1:41490445-41490467 AGGAAAAAGTCAGAGATGAAAGG + Intergenic
906428055 1:45730743-45730765 GAGAAAAGATTAGAGATGGAAGG - Intronic
907348512 1:53804853-53804875 AAGAAAACTTCAGAGAGGGATGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908167080 1:61469386-61469408 AGGAAAATACCAGAGAGGGAAGG - Intergenic
909827052 1:80139359-80139381 CAGAAAAACTGAGAGATGGATGG - Intergenic
916834078 1:168524200-168524222 TGGAAAACATCAAAGACAGAGGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923291297 1:232548785-232548807 CAGAACACATCACAGAAGGATGG + Intronic
924260202 1:242222050-242222072 CGAGAAACCTCAGAGATGAATGG - Intronic
1063926181 10:10979799-10979821 GGTAAAACATCTGAGATGGCAGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065635261 10:27726210-27726232 AGGAAAATATCAGAAATGTATGG + Intronic
1066435728 10:35395557-35395579 AGGAACACATCAGATATTGAGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070326797 10:75395103-75395125 AGGAAATCATCAGTGAAGGAGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072204758 10:93193457-93193479 CATTAAATATCAGAGATGGAAGG - Intergenic
1072825770 10:98604798-98604820 CAGAAAACTTCAGAGCTGAAGGG + Intronic
1073198041 10:101711046-101711068 GGGAAAAAATAATAGATGGAAGG + Intergenic
1075272425 10:121063941-121063963 GGGTAAACATCAGAGATCAAAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079090959 11:17479942-17479964 AGAACAACATCAGAGCTGGAAGG - Intergenic
1079148652 11:17877266-17877288 CCTAAAATATCAGAGCTGGAGGG + Intronic
1079304100 11:19307439-19307461 CGGGAAAAATAAGAGTTGGAAGG + Intergenic
1079838398 11:25364634-25364656 GTGAAAATATCAGATATGGAAGG - Intergenic
1080708396 11:34721356-34721378 CTGAAAACAACAGAGAAGGGCGG - Intergenic
1081363235 11:42205288-42205310 GGGAAACCATCAGTGAGGGATGG + Intergenic
1082818285 11:57525478-57525500 GGGAAGACATCAGTGATGGGAGG + Intergenic
1083434128 11:62631050-62631072 CGGAAAACATCAGAGATGGAGGG + Exonic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1086064362 11:82731297-82731319 CAGAAACCAACAGAGGTGGAAGG + Exonic
1087493189 11:98854177-98854199 TTGAAAACATTAGAGAAGGATGG - Intergenic
1089872089 11:121684345-121684367 CAGAAAACATCTGAGAAGGAAGG - Intergenic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1090081294 11:123614646-123614668 CAGCAAACATCAGAGACTGATGG - Intronic
1090966978 11:131607313-131607335 CGCAAAACAGCAGAGAGGCATGG - Intronic
1091030930 11:132187060-132187082 CTGAATACATCAGAGAAGCAGGG + Intronic
1091198464 11:133751756-133751778 CAAAAAATACCAGAGATGGAAGG - Intergenic
1091890646 12:4051556-4051578 CTGAAAGCATGAGAAATGGAGGG - Intergenic
1092994340 12:13934052-13934074 CAGAAAACAGCAGAAATAGAAGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096646704 12:53042292-53042314 ATGAAAACTTCAGAGATGGTAGG - Intergenic
1097421571 12:59387421-59387443 AAGAAAACATTAGACATGGATGG + Intergenic
1097470753 12:59987937-59987959 AGGAGAACATGAGACATGGAAGG - Intergenic
1099233323 12:80052705-80052727 AGAAAAACATCAAAGAGGGAAGG - Intergenic
1099802714 12:87476907-87476929 AGGAAAGAAGCAGAGATGGAGGG - Intergenic
1102025354 12:109711491-109711513 CATAGAACTTCAGAGATGGAGGG + Intergenic
1104111437 12:125708769-125708791 CAGAAAGCAACAGAAATGGACGG - Intergenic
1106135248 13:26968671-26968693 CAGAAAACCTCAGAGATGGGAGG - Intergenic
1106344282 13:28860666-28860688 AGGGAAACATCTGAGGTGGATGG - Intronic
1107593762 13:41938756-41938778 GGGAAAAAATCAAAGATGCAGGG - Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109747269 13:66641601-66641623 GGGGAAACAACAGATATGGAAGG + Intronic
1111395830 13:87669465-87669487 GGGAAAACATCATAGATATAAGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112734861 13:102404876-102404898 CAGAAAACATCAAAAATTGAGGG - Intergenic
1114896256 14:26994545-26994567 CAGAAAACAACAGAGGTGGCTGG + Intergenic
1115042810 14:28952140-28952162 AGGAAGGCATCAGAGAAGGAAGG - Intergenic
1115692712 14:35861433-35861455 CGGAAAATATCAGAGAAAAAGGG - Intronic
1116805017 14:49485411-49485433 CGTCAAACAGCAGAAATGGATGG + Intergenic
1119044393 14:71305078-71305100 AGGAAAACTTGAGAGATGGTTGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119198246 14:72733276-72733298 CAGAAAACAGGAGAGATGAATGG + Intronic
1120363773 14:83540336-83540358 CTGAAAAATTCAGAGATGAAGGG + Intergenic
1121441884 14:93954651-93954673 TGGAAAGCCACAGAGATGGAGGG - Intronic
1121882768 14:97515314-97515336 GAGGAGACATCAGAGATGGAGGG - Intergenic
1123771551 15:23534815-23534837 AGGAAAACATGAGATTTGGAGGG + Intergenic
1124015816 15:25874291-25874313 AGCAAAACAACAGAGATGGAGGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128175874 15:65555254-65555276 CAGAGAATATCAGAGCTGGAAGG - Intronic
1128422474 15:67506978-67507000 TGTAGAACATCAGAGCTGGAAGG - Intergenic
1129318910 15:74762945-74762967 CAGAAAACATGAGAGAGAGAAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130196131 15:81781943-81781965 CAGAAAGAAGCAGAGATGGATGG + Intergenic
1130521817 15:84667651-84667673 CAGAAAACATGAAATATGGAGGG + Intergenic
1130560183 15:84951914-84951936 GGGAAAACACCAGAGACAGAAGG + Intergenic
1130838205 15:87672532-87672554 CAGAAATCTTCAGAGTTGGAAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1138253664 16:55530967-55530989 CGTAAAATCTCAGAGCTGGAAGG - Intronic
1139922466 16:70468814-70468836 CCAAAAGGATCAGAGATGGAGGG - Intronic
1140450044 16:75063426-75063448 TGGGAGACATCAGAGATGAAGGG - Intronic
1140840775 16:78836926-78836948 AGCAAAATATGAGAGATGGAAGG + Intronic
1141291565 16:82722646-82722668 TGGAGAACATGAGAGATGGCAGG + Intronic
1141605293 16:85149770-85149792 CGGAGAACAGCAGGCATGGAGGG - Intergenic
1142952334 17:3493650-3493672 CATAAAACATCATAGCTGGAAGG + Intronic
1144218448 17:13078641-13078663 CGTAAAATATCAGAGTTGGAAGG + Intergenic
1145354191 17:22123307-22123329 AAGAAAATATCAGAGCTGGAAGG + Intergenic
1148679911 17:49467647-49467669 CATAAAACATCAGAGCTGGAAGG + Intronic
1148924210 17:51067968-51067990 CAGAAGACAACAGAGATGGAAGG - Intronic
1148994746 17:51699983-51700005 GGGTAGACATCAGAGATGAAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149302277 17:55316545-55316567 AGGAAAACATCAGGGCTGAAGGG + Intronic
1150118196 17:62574264-62574286 CCCAAAACATCAGATATGTATGG - Intronic
1150473978 17:65460392-65460414 TGGAAATCACCTGAGATGGAAGG - Intergenic
1150600484 17:66646614-66646636 CAGAAAACATCATAGAAGAAGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153673688 18:7436735-7436757 GGGAGAACATCAGAGATTTAAGG - Intergenic
1155296568 18:24390179-24390201 CTTAAAACATCAGAGAAGTATGG + Intronic
1155735065 18:29211296-29211318 CAGAAAACAACAGAAATAGATGG + Intergenic
1156634539 18:39011562-39011584 GGGAAAACGTCACAGAAGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157755313 18:50212254-50212276 CAGATAAGATCAGAGATGGAGGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158943240 18:62425580-62425602 GGGAAAACAGCAGGGAAGGAGGG - Intergenic
1161360496 19:3846360-3846382 GGCAAAACATCAAAGATGGCTGG - Intronic
1162578471 19:11513298-11513320 GGCAGAACCTCAGAGATGGAGGG + Intronic
1165083659 19:33327458-33327480 ACGTAAACATGAGAGATGGAGGG - Intergenic
1165122648 19:33570607-33570629 GGAAAAAAATCACAGATGGATGG + Intergenic
1165338872 19:35196120-35196142 CGGAAGATAACAGAGAGGGAAGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925013879 2:507094-507116 TGGAAGACATCAAAGAGGGACGG + Intergenic
925256525 2:2493990-2494012 CAAAAATCATCAGAGTTGGAAGG - Intergenic
925627489 2:5855777-5855799 GAGAAAACATCAGAGGTGGTGGG - Intergenic
926284928 2:11481748-11481770 CGGAAAAAATGAGTGAAGGAAGG - Intergenic
926594793 2:14778456-14778478 AGGAAAACATAAGATATGGTGGG + Intergenic
927339300 2:21963332-21963354 CAGCAACCAACAGAGATGGAAGG + Intergenic
927579333 2:24227618-24227640 CAGAAAGAAACAGAGATGGAAGG + Intronic
928171062 2:29003247-29003269 CCTAGAACATCAGAGCTGGAAGG - Intronic
928191122 2:29169293-29169315 ATGAAAACACCAGAGATAGAAGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930244918 2:48973799-48973821 CGGAGAACATCACAGTTGGCTGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932966962 2:76487602-76487624 GGGAAAAAATCAAAGATGTATGG + Intergenic
935230722 2:101093716-101093738 GGGAAAAAAAAAGAGATGGAGGG + Intronic
936047760 2:109200407-109200429 CAGAAGCCATCAGAGATGGAGGG - Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
938258820 2:129880950-129880972 CGGGCACCATGAGAGATGGAGGG + Intergenic
938771405 2:134504329-134504351 CAAAAAAGAACAGAGATGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939957151 2:148536662-148536684 CGGAAAACCTCACAGGTGAAGGG + Intergenic
942201556 2:173576617-173576639 CTGAGAACATCAGGGATGGTCGG - Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
944591604 2:201222917-201222939 CAGAAAGCATCAGATCTGGAAGG - Intronic
945945976 2:215995987-215996009 CTGGAAAGATTAGAGATGGACGG + Intronic
946040711 2:216781010-216781032 AGGAAAACTTCATAGCTGGAGGG + Intergenic
946409099 2:219507628-219507650 GGGCAAACATGAGAGATGGCTGG - Intergenic
948603992 2:239123335-239123357 GGGAACGCATCAGAAATGGATGG - Intronic
948805202 2:240450937-240450959 GGGAAAGCATGTGAGATGGAGGG + Intronic
1168798526 20:628650-628672 TGCAAAGCATCAGGGATGGAGGG - Intergenic
1169827440 20:9784721-9784743 GGGAAGACATCAGACATAGATGG + Intronic
1170898178 20:20435312-20435334 AGCAACACTTCAGAGATGGAGGG + Intronic
1171355348 20:24541067-24541089 CAGAAAAAATCAGAGCTGAAAGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171564453 20:26167447-26167469 GAGAAAATATCAGAGCTGGAAGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1175880968 20:62258854-62258876 AGCAAAACATGAGAGATGGCAGG + Intronic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177814106 21:25957375-25957397 TTGAAAACATCAGAGATTAAAGG + Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178010748 21:28283488-28283510 AAGAAAACATTAGAGATGAAAGG - Intergenic
1178720582 21:35005769-35005791 CTTAAAAGATAAGAGATGGAGGG - Intronic
1183112059 22:35657701-35657723 AGAAGAACATCAGAGCTGGAGGG - Intronic
1184466012 22:44669129-44669151 CGGACAAACTCAGAGATAGAGGG - Intronic
950968381 3:17162464-17162486 GGTGAATCATCAGAGATGGAAGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
952945231 3:38474497-38474519 CCAAACACATCATAGATGGATGG - Intronic
956907329 3:73780309-73780331 CTGAAATCATCAGAGTTGGTGGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959695236 3:109242300-109242322 CAGAAAACTTAAGAGTTGGAAGG + Intergenic
959750795 3:109832182-109832204 CAGAAAACATCAGAGAAGCCTGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960019266 3:112931636-112931658 GAGAAAGCAACAGAGATGGATGG - Intronic
960834531 3:121891994-121892016 CGAATAATATCAGAGATGGAAGG - Intergenic
960946622 3:122971172-122971194 GGGAATACATCAGAGCAGGATGG + Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964640131 3:158900386-158900408 AGGAAAACAAAAGAGTTGGAGGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
971037744 4:22713450-22713472 CTGAAACCAACATAGATGGATGG + Intergenic
971193354 4:24448367-24448389 CATAAAGCAGCAGAGATGGATGG - Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
971986644 4:33833820-33833842 AAGAAAATATCAGAGCTGGAAGG - Intergenic
972072653 4:35039744-35039766 GGGAATACAGGAGAGATGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975201553 4:71596230-71596252 TGGAAGACATGAGAGATGGTTGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977334257 4:95676171-95676193 CTGAACAGATCAGTGATGGAAGG - Intergenic
977450971 4:97197437-97197459 AGGAAAATATCAGTTATGGAGGG + Intronic
977738317 4:100444694-100444716 AACAAAACATCAGGGATGGAGGG + Intronic
978516580 4:109575092-109575114 CAGAGAACATCAGCGATGAAAGG - Intronic
978835242 4:113141456-113141478 TGAAAAACTTCAGAGCTGGAAGG + Intronic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982682220 4:158444987-158445009 GAGAAATCAACAGAGATGGAGGG - Intronic
983619868 4:169749756-169749778 TGTAAAACATTAGAGATGAAAGG + Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984469778 4:180154015-180154037 AGGAAGACATGAAAGATGGAAGG - Intergenic
984712666 4:182898624-182898646 CGGGAGCCCTCAGAGATGGAGGG - Intronic
985377202 4:189354362-189354384 CGGACAATATCGGCGATGGAAGG + Intergenic
987185187 5:15410587-15410609 CTGATAACATCAAGGATGGATGG - Intergenic
987965971 5:24872905-24872927 CAGAACACATAAGAGATAGATGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992509635 5:77420231-77420253 TGGAAAACCTCAAAGTTGGAAGG + Intronic
992896998 5:81254271-81254293 CTGAAAATTTCAGAGAAGGAGGG + Intronic
995729691 5:115225301-115225323 CATAAAACATCACAGATGAAAGG + Intronic
996667691 5:126079752-126079774 AGCAAAGCCTCAGAGATGGAGGG - Intergenic
998090339 5:139362942-139362964 CGGAAAACATTAGATGTGGCCGG + Intronic
998363645 5:141613575-141613597 CTTAAAACTTCAGAGTTGGAAGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006300103 6:33189409-33189431 CGGACACCATCAGGGAGGGAGGG + Exonic
1007325250 6:41054562-41054584 CAGAAAACATCTGAGCTGGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008612589 6:53197824-53197846 GGGAAAGAAGCAGAGATGGAGGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014853029 6:126364592-126364614 GGGATAACACCAGAAATGGAGGG - Intergenic
1015745706 6:136507325-136507347 CAGAAAACAAGAGAGAAGGACGG + Intronic
1016918218 6:149264805-149264827 CGGAAAACAGCAAAGATCAAAGG + Intronic
1017752000 6:157496761-157496783 CTGAAAACAACAGAAATGTAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023514239 7:40984636-40984658 CCTAGAACATCACAGATGGAAGG - Intergenic
1023931238 7:44707864-44707886 CGGCATACCTGAGAGATGGAGGG - Exonic
1024037255 7:45518115-45518137 AATAAAACATCAGAAATGGAGGG + Intergenic
1024672816 7:51612160-51612182 TGGAAAGCAGCAGAGAGGGAGGG + Intergenic
1024809103 7:53186474-53186496 AGGAAAAAATAAAAGATGGATGG + Intergenic
1025062670 7:55824104-55824126 CTGAAAACATCATTGATGAATGG + Intronic
1025273276 7:57546757-57546779 AAGAAAATATCAGAGCTGGAAGG - Intergenic
1027462730 7:78475686-78475708 CGGAATAAATCAGAGTTGGAAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030560062 7:111074096-111074118 CACAAAACATCAAAGCTGGAAGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032282596 7:130516631-130516653 AGAAAAACAACAGATATGGAAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035076258 7:156179472-156179494 CGAGACACATCAGAGATGGCAGG + Intergenic
1036048531 8:5170253-5170275 AAGAAAACCTCAGAGATGGTGGG + Intergenic
1036717322 8:11138006-11138028 CGGAAGACATCAGAGCAGAAGGG + Intronic
1037939186 8:22938648-22938670 GGGAGAAAATCAGAGAGGGAGGG + Intronic
1038861054 8:31389366-31389388 GCGAAAGCATCAGAGATGAAAGG - Intergenic
1039167616 8:34702493-34702515 TGGAAAACATCAAAAATGTATGG - Intergenic
1039383943 8:37114201-37114223 AGGAATACCTCAGAGATTGAAGG + Intergenic
1039440143 8:37589314-37589336 TTGAAAACATCAGTGCTGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041431959 8:57792299-57792321 TGGGAAACTTCATAGATGGATGG + Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1050808705 9:9717578-9717600 TTGAAAACAGCAGACATGGAAGG + Intronic
1051236151 9:15001319-15001341 TGTAAAACATTAGAGATGAAAGG - Intergenic
1053164549 9:35835258-35835280 GGGAATTCAGCAGAGATGGAAGG - Intronic
1053308610 9:37001413-37001435 CATAAAACAACAGAGATGGCAGG + Intronic
1055440873 9:76334775-76334797 CAGACAAGAACAGAGATGGATGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055859527 9:80731109-80731131 AGCAAAGCCTCAGAGATGGAAGG + Intergenic
1056118925 9:83467937-83467959 CAGACAACATCAGACAGGGATGG + Intronic
1056786370 9:89595202-89595224 TGGAAAATAGCAGAGATGGATGG + Intergenic
1057983756 9:99688521-99688543 CAGAAAAGATCAGAGAAAGAAGG - Intergenic
1058578504 9:106429574-106429596 GGTACAACATCAGAAATGGAAGG - Intergenic
1059751434 9:117251166-117251188 TGGAAAGCAACAGAGATGGAAGG + Intronic
1059801421 9:117753140-117753162 GGGAAAACTTCACAGAAGGATGG - Intergenic
1060252019 9:121994293-121994315 TGGAGAACATAAGAGGTGGAGGG + Intronic
1187261305 X:17687354-17687376 AGGAAAGCCTCAGAGATGAATGG - Intronic
1187621734 X:21063286-21063308 AGCAAAACCTCAGAGATGGAGGG + Intergenic
1189004866 X:36985195-36985217 ATGAAAACTTCAGAAATGGAAGG - Intergenic
1189044164 X:37572750-37572772 ATGAAAACCTCAGAAATGGAAGG + Intronic
1191101458 X:56733735-56733757 AGGACAGCATCAGAGAGGGATGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1193327727 X:80200797-80200819 CAGAAAACCTCAAAGATGGCTGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195303498 X:103555691-103555713 ATGAAAATATCAGAAATGGAGGG - Intergenic
1195572914 X:106416395-106416417 ATGATAACATCAAAGATGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic