ID: 1083434705

View in Genome Browser
Species Human (GRCh38)
Location 11:62634373-62634395
Sequence AAACTGGGGCAGGAGGAGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 518}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083434694_1083434705 15 Left 1083434694 11:62634335-62634357 CCCATATGCTACCAAGCGTGAGA 0: 1
1: 0
2: 1
3: 7
4: 79
Right 1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG 0: 1
1: 0
2: 4
3: 47
4: 518
1083434696_1083434705 4 Left 1083434696 11:62634346-62634368 CCAAGCGTGAGATTAACCTTATC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG 0: 1
1: 0
2: 4
3: 47
4: 518
1083434695_1083434705 14 Left 1083434695 11:62634336-62634358 CCATATGCTACCAAGCGTGAGAT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG 0: 1
1: 0
2: 4
3: 47
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083434705 Original CRISPR AAACTGGGGCAGGAGGAGAT GGG Exonic
900105745 1:980344-980366 AAAGCCGGGCAGGAGGAGTTGGG - Exonic
900309700 1:2027792-2027814 AAGCCTGGGCAGGAGGAGAAGGG + Intronic
900519979 1:3100759-3100781 AATGTGGGGCAGGAGGACCTGGG + Intronic
900928561 1:5721225-5721247 AAGCTTGGGAAGGAGGAGGTAGG + Intergenic
900950854 1:5857677-5857699 CAACAGGGGCAGGAGGAGGGAGG + Intergenic
901632585 1:10655154-10655176 AACCTGGGCCACGAGGAGAGGGG - Intronic
903178625 1:21594662-21594684 GAGGTGGGGCAGGAGGAGAGAGG + Intergenic
903183556 1:21617444-21617466 AAACTGGGGCAGCAGGATGAGGG + Exonic
903238114 1:21963885-21963907 TGACTGGGGAATGAGGAGATAGG - Intergenic
903600270 1:24533114-24533136 AGGCTGGGGCGGCAGGAGATAGG - Exonic
904147000 1:28400923-28400945 ATAGTGGTGCAGGAGGGGATAGG + Intronic
904494704 1:30880036-30880058 CACATGGGGCAGGAGGAGCTGGG + Intronic
904880178 1:33690387-33690409 AAAGCAGGACAGGAGGAGATGGG - Intronic
905324972 1:37145490-37145512 AGAAAGGGGCAGGAGGAGCTGGG - Intergenic
906569354 1:46822927-46822949 AACCTGGGGGAGGGGGAAATTGG - Intergenic
907338918 1:53719635-53719657 CAACTGGGGCAGGAGGAAGGAGG + Intronic
908125373 1:61025006-61025028 TTACGGGGGAAGGAGGAGATTGG + Intronic
908329078 1:63052542-63052564 AAACTGTGCCAGGAGGATATAGG - Intergenic
908855394 1:68421141-68421163 CAAATGGGGGAGGAGGAGATTGG - Intergenic
910709565 1:90165740-90165762 ATACAGGGGCAGGAGCAGATTGG - Intergenic
912037251 1:105333874-105333896 AAACTGAGGCAAGTGGAGAAAGG + Intergenic
913161373 1:116148916-116148938 AAACCGGGAAAGGAGAAGATGGG - Intergenic
913459761 1:119071660-119071682 AGAATGGGGCAAGAGGAAATGGG + Intronic
913681827 1:121193336-121193358 AGACAGGGGCAGGAGGGAATAGG - Intronic
913986606 1:143571290-143571312 ATACTGGGGCAGGAGCTGACAGG - Intergenic
914033662 1:143980962-143980984 AGACAGGGGCAGGAGGGAATAGG - Intergenic
914155784 1:145087010-145087032 AGACAGGGGCAGGAGGGAATAGG + Intronic
914205005 1:145519077-145519099 ATACAGGGGCAGGAGCTGATGGG - Intergenic
914484124 1:148092259-148092281 ATACAGGGGCAGGAGCTGATGGG - Intergenic
915710749 1:157895850-157895872 AAACTGGGTAAAAAGGAGATGGG - Intronic
916579625 1:166095670-166095692 AAAAGGGGGCAGGAGGAAAAGGG + Intronic
916599324 1:166276682-166276704 TAACTGGGGCAGGGGAAGAGGGG - Intergenic
917923947 1:179773476-179773498 AAACTGGGTGAGGAGTATATGGG + Intronic
918856739 1:189765224-189765246 TCACTGGGGCAGGGGGAGAGAGG - Intergenic
919750004 1:201031648-201031670 GAAAAGGGGAAGGAGGAGATAGG + Intergenic
919886160 1:201936491-201936513 AAACTAGAGCAGGAGGAGTGGGG - Intronic
920017296 1:202922887-202922909 AGACTGAGGCAGGAGGACCTGGG - Intronic
920189077 1:204180805-204180827 GGCCTGGGGCAGGAGGGGATTGG + Intergenic
920443652 1:205999197-205999219 AAGCTGGGGCAGGACGAGGAAGG + Intronic
920469143 1:206211849-206211871 AGACAGGGGCAGGAGGGAATAGG - Intronic
920848682 1:209613849-209613871 AAACTGGGGAAGGACAAGAATGG - Exonic
920875478 1:209830625-209830647 AAAGTGGGGCAGTAGCAGTTTGG + Intronic
921056129 1:211543825-211543847 GAACTTGGGCACGAGGAGAGTGG - Intergenic
921073687 1:211683230-211683252 ATGCTGGGGCAGGAGCAGCTTGG + Intergenic
921117805 1:212110931-212110953 AGACTGGGGAAGAAGGAGAAAGG - Intergenic
921302037 1:213760437-213760459 AAACTGGGGGAGCAGGAGGAAGG + Intergenic
921379052 1:214505192-214505214 AAAGTGTGACAGGAGGACATGGG + Intronic
921588765 1:216979181-216979203 GAACTGGGGCAGAAGAAGATAGG - Intronic
921949027 1:220909840-220909862 AAACTGGGGGAGGGGGACTTGGG - Intergenic
922468537 1:225861529-225861551 ACACTGGGGCAGGAGGAAAGGGG - Intronic
922878730 1:228962751-228962773 AAACTGAGAGGGGAGGAGATGGG - Intergenic
923036233 1:230287021-230287043 ACACGGGGACAGGAGGTGATGGG + Intergenic
923198207 1:231687768-231687790 GGACTGGGGCAGGGGGAAATGGG + Intronic
923330277 1:232917415-232917437 TATATGGGGCAGGAGGAGAAGGG + Intergenic
923411380 1:233713387-233713409 AGACTGGGTCAGAAGGAGTTGGG - Intergenic
923679382 1:236106951-236106973 AAACTGAGGCTGAGGGAGATGGG + Intergenic
924752585 1:246908791-246908813 AGGCTGAGGCAGGAGGAGAATGG + Intronic
1062782318 10:225447-225469 AAGCTGAGGCAGGAGGAGGCTGG - Intronic
1062854017 10:770307-770329 GGACTGGGGCGGGAGGAGCTGGG + Intergenic
1062854046 10:770402-770424 GGACTGGGGCGGGAGGAGCTGGG + Intergenic
1063163124 10:3434324-3434346 AGACTGGGGAAGGAAGAGAAAGG - Intergenic
1063227126 10:4026016-4026038 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
1063654531 10:7974629-7974651 AAACTGGGACATGAGGACATTGG + Intronic
1064102153 10:12473087-12473109 AATGTGGGGCAGGAGGGGAGAGG + Intronic
1064350068 10:14568330-14568352 ATACTGGGGGAGGAGGAGGCTGG + Intronic
1066719706 10:38324682-38324704 AAGATGGAGCAGGAAGAGATTGG - Intergenic
1067975927 10:51025233-51025255 AAGCTGGGGGAGGAGAAGTTTGG - Intronic
1069962413 10:72086990-72087012 AACCTGGGGAAGGAGGAGTAAGG + Intronic
1070121539 10:73582179-73582201 ACACTGGGCCAGGAGGAGCCTGG + Intronic
1070486048 10:76932790-76932812 AGACTGGAGCAGGAGGAACTTGG - Intronic
1070598889 10:77851983-77852005 ACAAAGGGTCAGGAGGAGATGGG + Intronic
1070951291 10:80433399-80433421 AAACTGGCCCAGGAGTAGAAAGG + Exonic
1071788682 10:88931792-88931814 AAAATGGGGCAGCCTGAGATAGG - Intronic
1071833720 10:89398070-89398092 ACACTGGGGGAGGAGGGAATAGG - Intronic
1072806939 10:98429746-98429768 AGTCAGGGGCAGGAGGGGATCGG - Intronic
1074141889 10:110680437-110680459 AAGCTGGGGGAGGAGGAGCTCGG + Intronic
1074449921 10:113550884-113550906 GAACTGGTTGAGGAGGAGATGGG - Intronic
1074518603 10:114196565-114196587 AAAGTGGGAAAGGAGGAGGTGGG - Intronic
1074518925 10:114198980-114199002 AAAGTGGGAAAGGAGGAGGTGGG - Intronic
1074945393 10:118276256-118276278 ATAATGGGGGAGGAGGAGAGAGG + Intergenic
1075397905 10:122141162-122141184 AAATTGGGGGAGGAGGAGGAGGG + Intronic
1075529873 10:123220004-123220026 CAGCAGGGGCAGGAGGAGAATGG - Intergenic
1075961014 10:126567760-126567782 AGACTGGAGCAGGTGGAGAAGGG + Intronic
1076345722 10:129777805-129777827 AACCTGGGGGCGGAGGAGTTCGG + Intergenic
1076582833 10:131524680-131524702 AAACTCAGGTAGGAGGTGATTGG - Intergenic
1077466177 11:2734796-2734818 AAACTGAGGCTGGAGGAGGCAGG - Intronic
1078241810 11:9536811-9536833 ATTCAGGGGCAGGAGGAGAGAGG - Intergenic
1078393032 11:10952872-10952894 AAACTGGAGCAGGAAGACAGAGG - Intergenic
1078439231 11:11350538-11350560 AAACTGAGCCAGGAGTAGAGTGG + Intronic
1081460669 11:43269852-43269874 TAACTGGGGAAAGAAGAGATGGG - Intergenic
1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG + Exonic
1083474319 11:62906178-62906200 AAGGTGGCGCAGGAGGAGAGAGG + Intergenic
1083480960 11:62946469-62946491 GACCTGGGGCAGGAGCAGAGAGG + Intronic
1083725484 11:64625817-64625839 GAAGTGGGGCAGGAGGTGGTGGG - Intronic
1083929452 11:65832871-65832893 AAACTGGGACAGGATGAGAAGGG - Intronic
1084887190 11:72218488-72218510 AGACTGAGGCAGGAGGTGAATGG + Intronic
1084918158 11:72446910-72446932 AAAGTGGGGCTGGAGGAAAAGGG + Intergenic
1085712076 11:78838673-78838695 AAAATGGAGGAGGTGGAGATGGG + Intronic
1085716540 11:78878524-78878546 GAAGTGGGGTAGGAGGTGATGGG + Intronic
1085739535 11:79067078-79067100 TAACTGGATCATGAGGAGATTGG - Intronic
1086228289 11:84538712-84538734 ACAGTGTGGCAGGAGGAGACTGG + Intronic
1087268288 11:96084467-96084489 AGACTGGGGGATGTGGAGATGGG + Intronic
1087375828 11:97338676-97338698 AAAGTGGGGCATGAAGAGAGTGG - Intergenic
1088528044 11:110777920-110777942 TAACTGGGGAAGGAGGGGGTGGG - Intergenic
1089607335 11:119648929-119648951 AGGCTGGGGCAGGAGGGCATGGG + Intronic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1090018008 11:123102851-123102873 AAAATTGGGCAGGAGGAGGCTGG - Intronic
1090748968 11:129729459-129729481 AGACTGTGGGAGAAGGAGATGGG - Intergenic
1091664556 12:2409920-2409942 AAAATGGGGCAGGAGAGGAAGGG + Intronic
1091988947 12:4938836-4938858 AAACAGGGGCCTGAGGAGAGGGG - Intergenic
1092902201 12:13070507-13070529 ACACTTGGGCTGGAGGAAATTGG + Intronic
1093442353 12:19213616-19213638 AAATTGAAGGAGGAGGAGATAGG + Intronic
1093592433 12:20918853-20918875 AAACAGGGGAAGGGGAAGATGGG - Intergenic
1094313682 12:29114327-29114349 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
1094701612 12:32875780-32875802 AGACTACAGCAGGAGGAGATGGG + Intronic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1095619244 12:44229160-44229182 AAACTGGTGGAGGAGCAGGTTGG + Intronic
1095782730 12:46078156-46078178 AAGCTGGAGCTGGAGGAGCTGGG + Intergenic
1096755745 12:53798015-53798037 AACCTGGGGAGGGAGGAGGTGGG - Intergenic
1097203986 12:57304423-57304445 GAACTGAGGCAGGAGGATAGGGG + Intronic
1098149344 12:67530339-67530361 AAAGAAGGGCAGGAGGAGAGGGG + Intergenic
1098735515 12:74097969-74097991 AGGCTGAGGCAGGAGGAGAAAGG - Intergenic
1099421431 12:82466883-82466905 AAAATTGAGCAGGAGTAGATTGG - Intronic
1099529898 12:83765135-83765157 TTATTGGGGCAGGAGGAAATGGG - Intergenic
1100197812 12:92267430-92267452 CAACTGGGGCTGGAGAAGAAGGG - Intergenic
1100769694 12:97908219-97908241 AAACTGAGGCATCAGGAGGTCGG - Intergenic
1101111383 12:101489895-101489917 AAGCTGGAGGAGGGGGAGATGGG + Intergenic
1101988572 12:109466403-109466425 TAACTGGGGAAGGAGGAAAGAGG + Intronic
1102036303 12:109772230-109772252 ACACTGGGGCATCAGGAGAGGGG + Intergenic
1102219499 12:111184958-111184980 AGGCTGAGGCAGGAGGAGAATGG + Intronic
1102324208 12:111965169-111965191 AAATGGGGGTAGGAGGAGCTGGG - Intronic
1102648341 12:114418456-114418478 AAAGGAGGGCAGGATGAGATAGG - Intergenic
1103007819 12:117435963-117435985 AAACTTGGCCAGGAAGAGCTGGG - Intronic
1103043243 12:117713524-117713546 AAATTGGGGCAGGAGGGAATGGG + Intronic
1103277869 12:119728350-119728372 ACACTGTGGGAGGAGGAGACAGG + Intronic
1103484717 12:121274644-121274666 AGCCTGGGCCAGGAGGAGAGGGG - Intronic
1104097979 12:125577189-125577211 AAACTGGCTCAAGAGGAAATTGG - Intronic
1104762847 12:131307742-131307764 AGGGCGGGGCAGGAGGAGATGGG - Intergenic
1104788560 12:131467406-131467428 AGATTGGGGCAGACGGAGATGGG + Intergenic
1104817078 12:131653641-131653663 AGGGCGGGGCAGGAGGAGATGGG + Intergenic
1105432043 13:20345316-20345338 AATCCGGGCCAGGAGGAGAGTGG + Intergenic
1105501953 13:20980558-20980580 AAACTTGGACAGGAAGAGGTGGG - Intronic
1105834305 13:24195106-24195128 AGCCTGGAGCAGGAGGAAATGGG - Intronic
1105889814 13:24674544-24674566 AAAAGGAGGCAGGAGGAGACTGG - Intergenic
1106049361 13:26175923-26175945 AAGCAGGGGGTGGAGGAGATTGG + Intronic
1106231348 13:27823550-27823572 CAACTGGGGCCTGGGGAGATGGG + Intergenic
1106893364 13:34270750-34270772 AAACTGGGGAAGATGGAGTTTGG + Intergenic
1107018263 13:35726153-35726175 AGCCTGGGGAAGGAGGAGAAGGG + Intergenic
1107255910 13:38426806-38426828 AAATAGGGGCAGGATCAGATTGG - Intergenic
1107906131 13:45062754-45062776 AAAAGGGGGCAGCAGGCGATTGG + Intergenic
1109974666 13:69815552-69815574 AAACTGGGGAGGGAGGAAAGTGG + Intronic
1110981907 13:81910998-81911020 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
1111068907 13:83136487-83136509 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
1111922194 13:94424184-94424206 AAATTGGGGAAGGAGGTGTTGGG - Intergenic
1111987161 13:95077159-95077181 ATACTGGGGCAGGTGCATATTGG + Intronic
1112907651 13:104444265-104444287 AAACTTGGGCAGGGGGACAGAGG + Intergenic
1113077414 13:106480779-106480801 AATCTGGGGGTGGAGGAGCTGGG + Intergenic
1113341962 13:109434470-109434492 AGACTGAGGCAGGAAGAGAGAGG + Intergenic
1113408233 13:110061703-110061725 AGACTGAGGCAGCAGGAGGTGGG + Intergenic
1113453853 13:110433242-110433264 AGCCTGGAGCAGGATGAGATGGG + Intronic
1113872272 13:113566516-113566538 AAACTGGGTCAGGATCAGACAGG - Intergenic
1114509172 14:23242676-23242698 AAGATGGGGCAGGAGGTGCTGGG + Intronic
1114519617 14:23325057-23325079 GAACTGGGGCAGGGGGAGGGGGG - Intronic
1114577186 14:23725846-23725868 AAAGTGGGGCAGGTGGAGAGAGG - Intergenic
1114978786 14:28135686-28135708 AAACTGGGGCAGAGAGAGGTGGG - Intergenic
1115013833 14:28585626-28585648 GGGCTAGGGCAGGAGGAGATGGG + Intergenic
1115197334 14:30815860-30815882 AGAGTGGGGCATGAGGAGATTGG - Intergenic
1115479961 14:33851067-33851089 AAGCCGGAGCAGGAGGAGCTGGG + Intergenic
1116117129 14:40669037-40669059 AAACGGGGGCAGGGGGAGTGGGG - Intergenic
1117647571 14:57867450-57867472 AAACAGGTGTAGGAGGAAATTGG - Intronic
1118078934 14:62335817-62335839 AAACTGGGGCGGAGGGAGAATGG + Intergenic
1118481968 14:66176104-66176126 ATCCTGGGGCAGCAGCAGATAGG - Intergenic
1118663517 14:68041196-68041218 CAACTGTGGCAGGAGGCGAAGGG - Intronic
1119418185 14:74489659-74489681 TCTCTGGGGCAGGAGGAAATGGG - Intronic
1119538039 14:75419124-75419146 AAACGCTGGCGGGAGGAGATGGG + Intergenic
1119612291 14:76073851-76073873 AAACGGGGGGAGGGGGAGAACGG - Intronic
1119704771 14:76776711-76776733 ACACTTGAGCAGGAGGTGATAGG + Intronic
1119776055 14:77249484-77249506 ACAGTGGGGCAGGTGGAGGTGGG - Intronic
1121406108 14:93720294-93720316 GAAATGGGACAGGAGGAGAGGGG - Exonic
1121739308 14:96240325-96240347 AAACTGGTCCAGAAGGAGACAGG - Intronic
1121742873 14:96266336-96266358 GAATTGGGGCTGGAGGAGAATGG + Intronic
1121832385 14:97063494-97063516 AGGCTGGGGCAGCAGGAGAGGGG - Intergenic
1121843800 14:97155919-97155941 AAACTGCTGGAGGAGGAGAGAGG + Intergenic
1123049630 14:105534744-105534766 AGACGGGGGCAGGAGGAGGAAGG + Intergenic
1123091841 14:105745418-105745440 GAACAGGGGCAGGAGGAGCAAGG - Intergenic
1124046831 15:26158241-26158263 AAACTGTGGCAGATGGAGATAGG + Intergenic
1125616808 15:41021688-41021710 AAACTGGGGAAGGGGGAGTGCGG + Intronic
1125930179 15:43594393-43594415 AGGCGGGGGCAGGAGGTGATGGG + Intronic
1125943347 15:43694225-43694247 AGGCGGGGGCAGGAGGTGATGGG + Intronic
1127332319 15:57951316-57951338 TAGCTGGGGCAGGAGGAAACTGG - Intergenic
1127778639 15:62291341-62291363 GAATGGGGGCAGGAGGGGATGGG - Intergenic
1128756660 15:70187920-70187942 AGAGTGTGGCAGGAGGAGGTTGG - Intergenic
1128925599 15:71652465-71652487 AAATGGGGGAAGGAGGAGAGAGG - Intronic
1129597512 15:76976024-76976046 AAGCTGGGGAAGGATGAGTTGGG + Intergenic
1129829868 15:78661683-78661705 AAACTGTGGCAGGTGGACCTTGG - Intronic
1129857120 15:78832305-78832327 AAACTGAAGCCAGAGGAGATGGG - Intronic
1132876956 16:2144237-2144259 GAAGTGGGGCAGGAGGAGCCAGG + Intronic
1133314020 16:4870913-4870935 AAAAGGGGGCAGGAGGATAATGG + Exonic
1133563468 16:6970961-6970983 AAATAAGGGCAGGAGGAAATGGG - Intronic
1133609212 16:7417399-7417421 AAACTGGGGGAACAGGATATGGG - Intronic
1133949356 16:10377520-10377542 ATACTTTGGGAGGAGGAGATAGG - Intronic
1134324725 16:13196704-13196726 AAACTGGGTCTGGAGGATACAGG + Intronic
1135017079 16:18932759-18932781 AAGCTGGTGCAGGAGGAATTTGG + Intergenic
1136083271 16:27867039-27867061 AAACTGTGGTAGGAGAGGATTGG - Intronic
1137835695 16:51590150-51590172 GACCTGGGGGAGGAGGATATTGG + Intergenic
1137835887 16:51592129-51592151 AAAGTGGGGGAGAAGGGGATGGG - Intergenic
1138090455 16:54169601-54169623 AGGCTGGGGCAGGAGGGGAGAGG - Intergenic
1138418130 16:56883054-56883076 AAACTGGGGAAGGAAAAGACTGG - Intronic
1138537225 16:57666591-57666613 AAGCTGGGGCAGGAGGCGGCAGG + Intergenic
1138723098 16:59104944-59104966 AAACAGGAGCAAGAGGAGATGGG - Intergenic
1139185939 16:64806114-64806136 AAACTGGGAGAGGAGGATGTGGG + Intergenic
1139307424 16:65999050-65999072 AAAATGAGGAAGGTGGAGATTGG + Intergenic
1139695001 16:68667721-68667743 AAACTTGGGCAAGAAGAGTTTGG - Intronic
1139792785 16:69453658-69453680 AGGCTGAGGCAGGAGGAGAATGG - Intronic
1139850554 16:69949602-69949624 AACCTGGTGCAGTAGCAGATGGG - Intergenic
1139879538 16:70172514-70172536 AACCTGGTGCAGTAGCAGATGGG - Intergenic
1140242812 16:73218947-73218969 AAGCTGGGGGAAGAGGAAATGGG - Intergenic
1140258061 16:73353747-73353769 AAAAAGAGGCAGGAGGAGAAAGG + Intergenic
1140372986 16:74423034-74423056 AACCTGGTGCAGTAGCAGATGGG + Intergenic
1140926083 16:79585278-79585300 AAGAAGGGGAAGGAGGAGATGGG - Intergenic
1141301846 16:82823238-82823260 AAAGTGGGGCAGCAGGGGAAGGG + Intronic
1143378117 17:6479162-6479184 AAGCTGGGAAAGGAGGAGAGAGG + Intronic
1144097674 17:11916580-11916602 AAACTGGGGCTTGGGGACATGGG - Intronic
1145905223 17:28512606-28512628 AACCTGGGGAAGGTGGAGGTGGG + Intronic
1146176101 17:30667552-30667574 AAACAGGGCTTGGAGGAGATGGG + Intergenic
1146467981 17:33102010-33102032 AAACTGGAGCAGGAAGATGTTGG - Intronic
1147158693 17:38558623-38558645 GAACAGAGGCAGGAGGAGAACGG + Intronic
1148055870 17:44795309-44795331 AATCTGGGGCAGGAGGGCAGAGG - Intergenic
1148087946 17:45006078-45006100 GGATTGGGGCAGGAGGAGAGGGG - Intergenic
1148219234 17:45850324-45850346 TGGCTGGGCCAGGAGGAGATGGG + Intergenic
1148764254 17:50028212-50028234 AAGCTGGGGCAGCAGGAGAGGGG - Intergenic
1148774795 17:50089279-50089301 ACACTGGGGGAGGAGGGGGTGGG - Exonic
1149040521 17:52182862-52182884 AAAGAGGGGCTGGGGGAGATGGG - Intergenic
1149338130 17:55658778-55658800 AAATAGGAGCAGGAGGAGAGAGG + Intergenic
1149565279 17:57636688-57636710 AAACTGAAGCAGGAGGAAAGAGG - Intronic
1149724090 17:58874944-58874966 AAAATGGGGCAGGAGGGGAGAGG - Intronic
1151088407 17:71407482-71407504 AAACTGGGGCTGGTGCAGGTGGG + Intergenic
1151499299 17:74478708-74478730 AGACTGGGGTGGGAAGAGATGGG + Intronic
1151535105 17:74734739-74734761 AGGCTGAGGCAGGAGGAGAATGG + Intronic
1151979352 17:77499462-77499484 AAACTGGGGGATGAGGGGGTAGG - Exonic
1152167955 17:78723224-78723246 ACACTGGGGCCGCAGGAGAGGGG - Intronic
1152421191 17:80194027-80194049 AAGCCGGGGCAGGAGGAGAGTGG - Intronic
1152425556 17:80216784-80216806 AAACTGAGGCACAAGGAGGTAGG + Intronic
1152581583 17:81167709-81167731 CACCTGGGGCAGAAGGAGACAGG + Intergenic
1152908379 17:82982930-82982952 CAGCTGGGGGTGGAGGAGATGGG + Intronic
1152934991 17:83131462-83131484 ACACAGGGGCAGGAGGAGTGGGG - Intergenic
1203182863 17_KI270729v1_random:80671-80693 AAGCTGGGGGAGGAAGAAATGGG + Intergenic
1153534498 18:6086527-6086549 AAAGTGAGGCAGGTGGAGACTGG + Intronic
1155823836 18:30413487-30413509 AGACTGGGGAGGGAGGAGAAAGG + Intergenic
1156105930 18:33660702-33660724 ACACTGGGGGAGAAGGAGTTTGG - Intronic
1156381591 18:36566721-36566743 AACCTGGGGCAGTAGTAGAGAGG + Intronic
1156689175 18:39685424-39685446 TTACTTGGGCAGGGGGAGATGGG - Intergenic
1157507459 18:48238821-48238843 AAGCTGTGGCAGGAGGGGAGAGG + Intronic
1157726010 18:49964519-49964541 AAAGAGGGGCAGGACCAGATGGG - Intronic
1157736358 18:50053289-50053311 TAGCAGGGGAAGGAGGAGATGGG + Intronic
1157886064 18:51367964-51367986 GGACTGGGGCAGGGAGAGATGGG - Intergenic
1158158272 18:54450403-54450425 AAATTGAGATAGGAGGAGATGGG - Intergenic
1158832848 18:61299335-61299357 ACACATGGGCAGGAGGAGAATGG + Intergenic
1158901471 18:61965965-61965987 AGGTTGGGGTAGGAGGAGATAGG - Intergenic
1159171549 18:64775057-64775079 AAAGTGGGGCAGGTAGAGGTGGG - Intergenic
1162159659 19:8702468-8702490 TGACTGGGGCAAGAGGAGAGTGG - Intergenic
1162274322 19:9640805-9640827 CAGCTGGGGGAGGAGGAGAGAGG + Intronic
1162509733 19:11110828-11110850 AAACTGAGGCATGAGGGGTTTGG - Intronic
1163183222 19:15618466-15618488 AGAATGGGCCAGGAGGAGATAGG + Intronic
1163218120 19:15895547-15895569 AAACTGAGGAGGGGGGAGATGGG + Exonic
1163313550 19:16528046-16528068 AACCTGGGGTGGGAGCAGATGGG - Intronic
1163645396 19:18486271-18486293 CAACAGGGGCAGGAAGAGAGAGG + Intronic
1164913008 19:32027464-32027486 GAACAGGTGCAGGTGGAGATCGG - Intergenic
1165922233 19:39306640-39306662 TAACTGGGGCCGGAGGAGACTGG - Exonic
1165938372 19:39403131-39403153 GATCTGAGGGAGGAGGAGATGGG + Intergenic
1166007368 19:39916661-39916683 AAACTGAGGCACGGGGAGATTGG - Intronic
1166104479 19:40590557-40590579 AAACAAGGGCAGGAAGGGATGGG - Intronic
1166128898 19:40733613-40733635 AGACAGAGGCAGGAGAAGATGGG - Intronic
1166343184 19:42150726-42150748 AAACAGGAGCAGGAGAAGCTGGG - Intronic
1166525452 19:43507388-43507410 GGACTGGGGGAGGAGGAGCTGGG - Intronic
1166778747 19:45328543-45328565 AGACTGGGGCAGGACAAGTTGGG - Intergenic
1166832123 19:45645204-45645226 AGGCTGGGGCAAGAAGAGATGGG + Intronic
1167266291 19:48484503-48484525 AAACTGGGGCAGGGTGAGACAGG + Intergenic
1167425884 19:49429300-49429322 GAACTGAGGAAGGAGGAGCTAGG + Intergenic
1167449825 19:49560548-49560570 AACCTGGGGCACGAGGGGAGAGG + Intronic
1168295838 19:55377085-55377107 AATCTGAGGGAGGAGGAGCTGGG + Intronic
1168651540 19:58095565-58095587 AAGTTGGAGCAGGAGGAGAGGGG - Intronic
925236560 2:2283870-2283892 AAACTGAGGCAGAGGGAGGTCGG - Intronic
925778369 2:7356896-7356918 AGACTCGGGCAGGTGGAGGTAGG - Intergenic
926158355 2:10470590-10470612 AAACTGAGGCAGGGAGAGGTTGG + Intergenic
926954001 2:18273317-18273339 ACCCTAGGGCAGGAGAAGATAGG + Intronic
927424692 2:22968951-22968973 AAATTGGGGAATGAGGAGAATGG + Intergenic
927441840 2:23124295-23124317 AATCTGGGGCAGGAGATGACCGG - Intergenic
927854991 2:26522438-26522460 AAGCTGGGACAGGAAGAGGTAGG + Intronic
927999127 2:27507661-27507683 ACCCTGGGGCAGAAGAAGATGGG - Exonic
928915007 2:36461186-36461208 AGACGTGGGCAGGGGGAGATTGG + Intronic
929101306 2:38317086-38317108 AAACTGAGGAAGGAGGAAAATGG + Intronic
929457942 2:42079323-42079345 AGATTGGGGCTGGAGGAGAGTGG - Intergenic
929563314 2:42969246-42969268 AAAGTGGGGCAGGGGGAGGAGGG + Intergenic
929956748 2:46464124-46464146 AGACTGAGGCAGGAGGAGGGGGG - Intronic
929964221 2:46521526-46521548 AGACTGAGGAAGGAGGAGAAGGG + Intronic
930193111 2:48480694-48480716 AAGCAGGGGAAGGAGGAGACGGG + Intronic
930594248 2:53366588-53366610 AATCTAGGGGAGGAGTAGATAGG - Intergenic
931819962 2:65941958-65941980 AAACTGGGGCAGGGGGCGGGGGG - Intergenic
932303559 2:70685818-70685840 AAACTGGGGGAGGAAGAGGGAGG - Intronic
932661226 2:73654422-73654444 AAGCTGGGGGAGGAGGACAAGGG - Intergenic
933103395 2:78288895-78288917 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
934699288 2:96426588-96426610 AATGTGGGGCAGGAGGTGAGGGG + Intergenic
937098035 2:119248352-119248374 AATCTTGGGCAGGAGGATGTGGG - Intronic
939360194 2:141161745-141161767 TAACTGTGGCATTAGGAGATGGG + Intronic
940006000 2:149010115-149010137 CAGCTGGGGCAGGAGGATAAAGG - Exonic
941187905 2:162340331-162340353 AGACTGGGGAAGGAGCAGTTTGG - Intronic
941828158 2:169922599-169922621 AAGCTGGGGGAAGAGGAAATGGG - Intronic
942900656 2:181113500-181113522 AAACAGAGGCAGTATGAGATAGG - Intergenic
943390841 2:187266281-187266303 ATGCTGGGGGAGGAGGAAATAGG + Intergenic
944210880 2:197205490-197205512 AAACTGGGGCTTGGGGAGTTTGG + Intronic
944626472 2:201574643-201574665 AAACTGGGACTGGAGGTGAGAGG - Intronic
946248607 2:218400386-218400408 AAACTGAGGCAGGAATAGAGAGG + Intronic
946607461 2:221421193-221421215 AGGCTGAGGCAGGAGGAGAATGG + Intronic
947382608 2:229559846-229559868 AGAGTGGGGAAGGAGGAGAGTGG - Intronic
947433781 2:230054531-230054553 AAAAGGGGGCTGGAGGAGAAAGG - Intronic
947907856 2:233778581-233778603 AACTTGGGACAGGAGGAGAAAGG + Intronic
948042731 2:234916605-234916627 TAACTGGGCAAGGAGGAGAGTGG + Intergenic
948741039 2:240046137-240046159 AAGCTGGGGCAGAGGGAGAGTGG + Intergenic
1169064954 20:2689969-2689991 AAACTGTGGCAGGAGGATGGGGG + Intergenic
1169098528 20:2925188-2925210 CAGCTGGGGGAGGAGGAAATGGG - Intronic
1169875757 20:10295369-10295391 AATCTGAGGAGGGAGGAGATGGG + Intronic
1169985660 20:11441228-11441250 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
1170437927 20:16349634-16349656 AAACTGGTGGTGGAGGATATGGG - Intronic
1170807424 20:19644763-19644785 AGAAGGGGGCAGGAGGAAATGGG - Intronic
1172267096 20:33625805-33625827 AAAATGAGGCAGGAGGGGCTGGG + Intronic
1172705904 20:36881709-36881731 AAACTGGACCAGGAGGGGAGGGG + Intronic
1173073477 20:39793128-39793150 TAGATGGGGCAGGATGAGATAGG - Intergenic
1173621059 20:44436327-44436349 AAACAGGCTCAGGAGGAGAGAGG + Intergenic
1173678163 20:44856135-44856157 AAAATATGGAAGGAGGAGATGGG + Intergenic
1173879634 20:46402240-46402262 AAACTGGGGGAAGAGTAGATGGG - Intronic
1174400617 20:50273906-50273928 GACCTGGGGCAGGAGGTGGTGGG - Intergenic
1175977629 20:62719582-62719604 GGGCTGGGGGAGGAGGAGATGGG - Intronic
1176076413 20:63250378-63250400 AAACTGGGGACAGAGGGGATGGG - Intronic
1177732375 21:25044088-25044110 AAAGGGGGACAGGAGTAGATAGG + Intergenic
1180045816 21:45304607-45304629 AAAGTGGGGAAGAAGGTGATAGG + Intergenic
1181331809 22:22098614-22098636 AACCTGGGGCAGGAAGAGAGGGG + Intergenic
1181882460 22:25991938-25991960 AATCTGGTGCAGGAGGTCATGGG - Intronic
1182144526 22:27989075-27989097 TAAGTGGGGCAGGAGGGGAGTGG + Intronic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182587313 22:31351957-31351979 AAACTGAGGAATGAGCAGATAGG + Intergenic
1182983355 22:34693904-34693926 AAAATGGGGCAAGAGAGGATAGG + Intergenic
1183170296 22:36182907-36182929 AGAGTGGGGCAGGAGCAGACAGG - Intergenic
1183349638 22:37327703-37327725 ATACTGGGGCAGTGGGAGAAGGG - Intergenic
1183655373 22:39181459-39181481 ACACTGCGGGAGGAGGAGAGGGG + Intergenic
1184171911 22:42764984-42765006 AAACTGAAGCTGGAGAAGATAGG - Intergenic
1184654490 22:45934283-45934305 GACCTGGGGCAGGAGGAGAGGGG + Intronic
1184756173 22:46517140-46517162 AAACTGAGGCAGTGGGGGATGGG - Intronic
1185092404 22:48783355-48783377 AGAGTGGGGCAGGAGGTGACAGG - Intronic
950119177 3:10470524-10470546 ACACTGGGGCAGGGGGTGAGGGG + Intronic
950286105 3:11746197-11746219 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
950384047 3:12642405-12642427 AGGCTGAGGCAGGAGGAGAATGG + Intronic
950788702 3:15455732-15455754 AAACTGGGGCAGCAGGGACTGGG + Intronic
952336654 3:32409247-32409269 AACCTGGGGCAAGGGGATATGGG - Intronic
952472479 3:33671014-33671036 AAACTAGAGCAGCAGGAGATGGG - Intronic
952526464 3:34215786-34215808 AAGCTGGAGCAGGAGGAGTGGGG + Intergenic
952675915 3:36030145-36030167 AAACTGTGGCAGGGGCAGAGAGG + Intergenic
952883653 3:38000281-38000303 AGACTGAGAGAGGAGGAGATGGG + Intronic
953923093 3:46965678-46965700 AAACTTGGCCAGGAGGCGGTGGG + Intronic
953947194 3:47159996-47160018 AAACTGGGTTAGGGTGAGATGGG - Intronic
955085525 3:55698620-55698642 AAACGGGGGCAGGGGGAGGCAGG + Intronic
955117373 3:56018855-56018877 AAACTGGGGAATCAGGATATGGG - Intronic
955200330 3:56846300-56846322 AAAATGGGGCAGGAGGAAATAGG + Intronic
955488063 3:59454761-59454783 ACAGAGGGGCAGGGGGAGATGGG - Intergenic
956168391 3:66413532-66413554 ACATGGGGGCAGGGGGAGATGGG + Intronic
956564900 3:70625278-70625300 CTTCTGGGGCAGGAAGAGATTGG + Intergenic
956645148 3:71447771-71447793 AGAATGGGGCAGGGGGAGAGGGG + Intronic
957184576 3:76925104-76925126 AGGCTGAGGCAGGAGGAGAATGG + Intronic
957311787 3:78529668-78529690 AGACTGGGGGAGGAAGAGGTTGG + Intergenic
957326802 3:78706230-78706252 AAGATGGGGCAGGTGGAGCTGGG + Intronic
957362533 3:79177513-79177535 AAAGTGGGGGAGGAGTGGATTGG - Intronic
957964055 3:87299385-87299407 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
958754503 3:98234617-98234639 CAACTGGAGCTGGAGTAGATAGG - Intergenic
958801756 3:98764032-98764054 GAACTGGGGATGGAGGAGACAGG + Intronic
959720625 3:109483469-109483491 AAATTGGGGATTGAGGAGATTGG + Intergenic
959884113 3:111479110-111479132 AGGCTGGGGCAGCAGAAGATGGG - Intronic
960797363 3:121501555-121501577 AGGCTGAGGCAGGAGGAGAATGG + Intronic
961050642 3:123742957-123742979 GAGCTGGGGGAGGAGGGGATGGG + Intronic
961464326 3:127072236-127072258 AGTCTGGGGCAGGAGGCGAGAGG + Intergenic
962062439 3:131944325-131944347 AATTTGGGGTAGGAAGAGATGGG + Intronic
962279551 3:134039644-134039666 TCACTGGGGCAGGAGGGCATGGG + Intronic
962581236 3:136799778-136799800 AAACTCAGGCAGGAGCAGAGGGG + Intergenic
962732914 3:138299690-138299712 AAAGTGGGGCACTAGGTGATGGG - Intronic
963727576 3:148939381-148939403 AAACTGGGCCGGAAGGAGAAGGG + Intergenic
963846436 3:150163164-150163186 AAACTGACGCAAGAGGAAATAGG - Intergenic
965505380 3:169509516-169509538 TACCAGGGGCAGGAGGAAATGGG - Intronic
965549843 3:169953111-169953133 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
966805372 3:183803630-183803652 AAGCTGGGGTAGGAGGGGAGTGG + Intronic
966805392 3:183803718-183803740 AAGCTGGGGTAGGAGGGGAGTGG + Intronic
966957469 3:184897752-184897774 AAACAGTGGCAAGAGGAGAAGGG - Intronic
967451251 3:189625908-189625930 CAATTGGGGCAGGAAGAGGTTGG - Intergenic
967457333 3:189703330-189703352 AGGCTGAGGCAGGAGGAGACTGG + Intronic
967879082 3:194286563-194286585 GAACCCGGGCAGGAGGAGAATGG - Intergenic
969106698 4:4811856-4811878 GAGCTGGGGCAGGAGGAGGCTGG - Intergenic
969121595 4:4915196-4915218 CAACTGGGGCTGCAGGAGAGAGG - Intergenic
970075958 4:12220932-12220954 AAACTGGGGAAGAAGGAAAAAGG + Intergenic
970133977 4:12902099-12902121 AAACTAGGGCAGTAGCAGAAAGG - Intergenic
970337198 4:15060602-15060624 AAACTGGAGAAGGAGCAGATAGG + Intronic
971292647 4:25359138-25359160 AAACCTGGGCAGCAGTAGATGGG + Intronic
971557153 4:28027571-28027593 AAACTGGGGATGGAGGAGTTAGG + Intergenic
973080130 4:45980403-45980425 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
973818756 4:54643697-54643719 CAACTAGGGGAGGAGGAGAGTGG - Intergenic
974579817 4:63781778-63781800 AAGCTGGGGCATGAGGAAAATGG - Intergenic
974784927 4:66607907-66607929 ATACTGGGGCAGTTGGAGATGGG + Intergenic
976162787 4:82221035-82221057 AACCTGGGTCAGGATGAGCTTGG + Intergenic
976364122 4:84214054-84214076 AAAATGGGGCAGTAGGAGGGAGG + Intergenic
978624494 4:110669241-110669263 AAACTGAGGCAGGAAGACACTGG - Intergenic
978981741 4:114955817-114955839 AAACTGGGGCAGGAAGAGAAAGG - Intronic
979834138 4:125340486-125340508 AGACTGAGGCAGGAGGAGAATGG - Intronic
980843464 4:138295517-138295539 AAACTGGGAAAGGAGTAGACAGG + Intergenic
982209086 4:153020502-153020524 TAACAGGTGCAGGAGGAGAGTGG - Intergenic
983811191 4:172064625-172064647 AAATTGTGGCAGGTGGATATGGG + Intronic
983828212 4:172291725-172291747 ATACTGGGGCAGGGGGAGGGGGG - Intronic
985103497 4:186480377-186480399 AAAGGAGGGCAGGAGAAGATTGG - Intronic
985777320 5:1851580-1851602 AGACAGGGGACGGAGGAGATGGG - Intergenic
985974430 5:3405064-3405086 AACCTGAGGCAGAAGGAGATTGG + Intergenic
986082267 5:4407581-4407603 AAACTGGTACAGGAGGCGAGGGG - Intergenic
986298873 5:6462511-6462533 AAGCAGGAGCAGGAGGAGCTGGG - Intronic
988321753 5:29706855-29706877 AAACTGGATCAGGAGAACATGGG + Intergenic
990926443 5:61030394-61030416 AAACTGGGGAATGAGAAAATGGG - Intronic
990936824 5:61160191-61160213 AAACTGGGGCTGGGGGAGGCGGG + Exonic
991416190 5:66395583-66395605 AAGTTGAGGCAGGAAGAGATGGG - Intergenic
992199123 5:74367102-74367124 ACACTCGTGCAGCAGGAGATTGG + Intergenic
993471947 5:88317038-88317060 AAAGATGGGAAGGAGGAGATAGG - Intergenic
993786169 5:92140183-92140205 AAACAAGGGCAGGAGAAGACAGG - Intergenic
993823275 5:92647550-92647572 AAACTCTGGCAGGGGGAGATAGG + Intergenic
995795956 5:115941536-115941558 ACACTGGGGCAGGGGGAGGAAGG + Intergenic
996862389 5:128082256-128082278 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
997276733 5:132599424-132599446 AAACTGGAGAAGGATGAGTTTGG + Intronic
997311977 5:132893841-132893863 TGTCTGGGGGAGGAGGAGATGGG - Intronic
997313190 5:132907720-132907742 AAACTGGGAAAGGAAGAGATAGG + Intronic
998419132 5:141968001-141968023 AAACTAAGGCAGGAGGGAATGGG - Intronic
999270680 5:150294814-150294836 AAACTTGGGCCACAGGAGATGGG + Intergenic
999948975 5:156628111-156628133 AAGCAGGGGCAAGAGGAGACTGG + Intronic
1000272282 5:159697443-159697465 AAACAGGGGCAGGAGGGAAGTGG - Intergenic
1000954198 5:167523038-167523060 AAAATGGAGCAGAGGGAGATGGG - Intronic
1001063585 5:168516625-168516647 ACACTGAGGCAGAAGGACATGGG - Intronic
1001299516 5:170523803-170523825 AGACTGGGGTAGGAGGAGAATGG - Intronic
1001721744 5:173862542-173862564 AAAATAGGGCAGAAGGTGATGGG + Intergenic
1001758415 5:174188107-174188129 AAAATGGGGGAGGGGGAGAAGGG - Intronic
1002074156 5:176698192-176698214 AGTCTGGGGCAGGAGGAGTTTGG + Intergenic
1002185540 5:177453199-177453221 ACTCTGGGGCTGGAGGTGATGGG - Intronic
1002298103 5:178242300-178242322 GAGCTGGGGCAGGAGGAGAGGGG - Intronic
1002866712 6:1128183-1128205 ATACTGGGGTAGGAGGAGCAGGG + Intergenic
1003372041 6:5537848-5537870 AAAGTGGAGGAGGAGGAGAATGG - Intronic
1004151199 6:13121359-13121381 AAACTGAGGCAGAAAGTGATTGG - Intronic
1004890708 6:20097776-20097798 AAATTGGGGCCTGAGGAGAAAGG - Intergenic
1005100183 6:22163942-22163964 AGACAGGAGCAGGAAGAGATTGG - Intergenic
1005490316 6:26341871-26341893 AAGCTGGGGCGGGAGGAAAGGGG + Intergenic
1005680757 6:28205812-28205834 AAACAGGGGCAAGAAAAGATTGG + Intergenic
1006181827 6:32158141-32158163 AAAGTGGGGGAGGGGGTGATAGG - Intronic
1006284122 6:33080313-33080335 AAACAGGGGCGGGAGGAGCTGGG - Intronic
1006517452 6:34552892-34552914 AGGGTGGGGCAGGAGGAGCTAGG + Intronic
1006867471 6:37221098-37221120 GAGCTGGGGCAGGGGGAAATGGG - Intronic
1006880068 6:37331625-37331647 AGACTGGGGCAGAAGGGGAACGG - Exonic
1007290989 6:40786697-40786719 TAACTGGGGCAGGGAGAGAAGGG - Intergenic
1009651427 6:66481372-66481394 AAACCCGGGCAGCAGTAGATGGG - Intergenic
1011029565 6:82907205-82907227 AAACTGTGGAAGGATGAGGTCGG + Intronic
1011738632 6:90337263-90337285 AACTGAGGGCAGGAGGAGATGGG - Intergenic
1011778966 6:90764978-90765000 AAACTGGGGACAGATGAGATTGG + Intergenic
1011961893 6:93101041-93101063 AGACTGGAGCAGAGGGAGATAGG + Intergenic
1012377174 6:98576474-98576496 AAACTGGGGCAGAGAGAGAGAGG + Intergenic
1015344838 6:132144212-132144234 AAATTGGGGGAGGAAGAGAGAGG + Intergenic
1015855469 6:137619692-137619714 AAACTGGGTCAGGTGAAGAGAGG - Intergenic
1016307204 6:142696795-142696817 AACCTGGGGCAGGAGCTGAGGGG - Intergenic
1018255708 6:161916901-161916923 AGGCTGGGGCAGGAGGAGAATGG - Intronic
1018479286 6:164173825-164173847 AACCTAGAGCAGGTGGAGATTGG + Intergenic
1018744092 6:166749546-166749568 AAATGGGGGCCCGAGGAGATGGG - Intronic
1018744112 6:166749594-166749616 AAATGGGGGCCCGAGGAGATGGG - Intronic
1018744178 6:166749754-166749776 AAATGGGGGCCTGAGGAGATGGG - Intronic
1018929907 6:168234160-168234182 TAACTGGGGGAGGAGGAGCACGG + Intergenic
1018930036 6:168234820-168234842 TAACTAGGGGAGGAGGAGAACGG + Intergenic
1018930471 6:168237012-168237034 TAACTAGGGGAGGAGGAGAACGG + Intergenic
1018930600 6:168237646-168237668 TAACTAGGGGAGGAGGAGAACGG + Intergenic
1019729490 7:2622473-2622495 TTGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019729499 7:2622503-2622525 GAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729503 7:2622518-2622540 CAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019729508 7:2622533-2622555 CAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729512 7:2622548-2622570 CAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729528 7:2622608-2622630 GAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019729567 7:2622720-2622742 AGGCTGGGGCAGGAGGAGATGGG - Intergenic
1019853871 7:3585084-3585106 AAACTAGGGCAGCAGGATGTAGG - Intronic
1020415867 7:7945123-7945145 AAACTGGGGCAGGCAGAGAAGGG - Intronic
1022288925 7:28982307-28982329 AAACTGGGCCAGGATGAAAGAGG - Intergenic
1022299598 7:29090631-29090653 AAACAATGGCAGAAGGAGATTGG + Intronic
1022505175 7:30905267-30905289 AGACTGGGCCAGGAGGCGGTGGG + Intergenic
1022680497 7:32541001-32541023 AGGCTGAGGCAGGAGGAGAATGG - Intronic
1022838161 7:34136552-34136574 AAACAGGGGAGGGAGAAGATAGG - Intronic
1023270254 7:38455170-38455192 AGGCTGAGGCAGGAGGAGGTGGG - Intronic
1023354458 7:39353142-39353164 AATCTGGGGCAGGCAGACATTGG - Intronic
1023401300 7:39794169-39794191 CCACTGAGGCAGGAGGAGCTGGG - Intergenic
1024450934 7:49542291-49542313 GAACTGAAGCAGAAGGAGATGGG + Intergenic
1028424288 7:90669118-90669140 AGAATGGAGGAGGAGGAGATGGG - Intronic
1029375713 7:100175959-100175981 AGGCAGAGGCAGGAGGAGATGGG + Intronic
1030272193 7:107681923-107681945 AGATTGGGGCGGGAGGAGGTGGG - Intronic
1032431422 7:131864994-131865016 AAACTGAGGCATGGGGAGGTTGG + Intergenic
1033779756 7:144654521-144654543 GAAGTGGGGGAAGAGGAGATAGG + Intronic
1034033207 7:147790325-147790347 AAATGTGGGCAGGAGGAGCTTGG + Intronic
1034313125 7:150107686-150107708 ATACCGGGGAAGGAGGAGGTAGG + Intergenic
1034440095 7:151081891-151081913 AAACTGGGTCCTGAGGAGAGAGG + Exonic
1034629927 7:152523018-152523040 AAACTGGGGGTGGGGGAGACTGG - Intergenic
1034793737 7:153992981-153993003 ATACCGGGGAAGGAGGAGGTAGG - Intronic
1037604046 8:20422589-20422611 AAACTGGGGCTGGAGGAAATGGG - Intergenic
1038410956 8:27359542-27359564 GAATTGGGGCAGGAGGAGCAGGG + Intronic
1038424996 8:27459196-27459218 AAAGAGGGGCAGGAAGAGAGCGG - Exonic
1040493586 8:47947046-47947068 AAAGTGGGCCAGGGTGAGATGGG - Intronic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1041085993 8:54256881-54256903 AAACTGGGGTAGGTGTATATGGG - Intergenic
1041091296 8:54303444-54303466 AAACTGGGTGAGGAGTATATGGG - Intergenic
1041730119 8:61054235-61054257 AGGCTGCTGCAGGAGGAGATAGG - Intergenic
1042136986 8:65642269-65642291 AAACTGGGTGAGGAGTAGACAGG + Intergenic
1042200780 8:66277982-66278004 AAACTGAGGCATGGGGAGACGGG + Intergenic
1042494791 8:69443927-69443949 CAACTGGGGGAGGGGGAGGTGGG - Intergenic
1042504639 8:69547166-69547188 CTACTGTGGCAGGAGGAGGTGGG + Intronic
1042696970 8:71564935-71564957 AAGCTGGGGTAGGAGGACCTAGG + Intronic
1042748776 8:72135531-72135553 GAGCTTGGGCAGGAGGGGATGGG - Intergenic
1043003789 8:74792792-74792814 AACCTGGGGCAGGAGATGATGGG + Intronic
1044608771 8:94071762-94071784 AGACTGGGGGAGGAGGAGTCAGG + Intergenic
1044617121 8:94153880-94153902 GAGCTGGGGCATGAGGAGATTGG + Intronic
1044621159 8:94191801-94191823 AAACTTAGAAAGGAGGAGATGGG - Intronic
1045529933 8:102974813-102974835 CAACTGTGGGAGGAGAAGATGGG - Intronic
1046025076 8:108712585-108712607 AAACTGGATCAGGATGAGAATGG - Intronic
1047170799 8:122490512-122490534 AAGATGGGGCAGGACGAGGTGGG + Intergenic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1047368305 8:124233118-124233140 AAACTGGGAGGGCAGGAGATGGG - Intergenic
1047527361 8:125645000-125645022 AAGGTGGGGGAGGAGGAGAAGGG - Intergenic
1047685760 8:127303299-127303321 AAACTTGGGCAGGAAGGGATTGG + Intergenic
1047723598 8:127665650-127665672 AAACTGAAGCAGGTGGAGTTTGG + Intergenic
1047952227 8:129944346-129944368 AATCTGGGGGAAGAGGAGACTGG + Intronic
1048126624 8:131642767-131642789 AAACTGGGGAAGGTGTACATTGG - Intergenic
1048628163 8:136209989-136210011 AAACGTTGGCAGTAGGAGATAGG - Intergenic
1049222651 8:141434979-141435001 AAACTGGGGCTGGAGGACCCTGG - Intergenic
1049559169 8:143299510-143299532 AGACTGAGGCAGGAGGATCTCGG + Intergenic
1051387219 9:16522155-16522177 AAAGGGGGGCAGGAGGAGAGGGG + Intronic
1052882004 9:33607087-33607109 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
1053494312 9:38538674-38538696 AGGCTGAGGCAGGAGGAGAATGG + Intergenic
1055018960 9:71648760-71648782 AAACTGGGAAAGGAGGAGACAGG + Intergenic
1055445886 9:76382065-76382087 TAACTGGAGGAGGAGGAAATGGG - Intergenic
1055587077 9:77766614-77766636 ACACCGGGGCAGGAGGAGTGTGG + Intronic
1056316612 9:85396419-85396441 AAACTGGAACAGGAGGATGTTGG - Intergenic
1057425380 9:94945025-94945047 AAATTAGGGCAGGAGGCGACTGG + Intronic
1057782704 9:98062815-98062837 AAACTGGGGGAAGAGTATATAGG + Intronic
1059501617 9:114758967-114758989 AAATGGGGGTAGGAGGAGAGGGG - Intergenic
1060433714 9:123574588-123574610 AAACTGGGTAAGGAGAATATGGG - Intronic
1060604825 9:124904269-124904291 AGACTGGGGTAGGAGGAATTGGG + Intronic
1060973734 9:127753378-127753400 AGGCTGGGGCAGGAGCAGCTTGG + Intronic
1061028866 9:128067976-128067998 AAACTGAGGGAGGCGGGGATTGG - Intronic
1061065107 9:128272887-128272909 AAACAAGGGCAGGGGGAGAAAGG + Intronic
1061844340 9:133378516-133378538 AAACTGAGGCACAAGGAGCTAGG - Intronic
1062152331 9:135027887-135027909 GAACTGGGGCAAGATGAGAGTGG + Intergenic
1185499169 X:584422-584444 AGAGTGGGGAAGGAGGAGGTTGG + Intergenic
1185683171 X:1905938-1905960 ATAGTGGGGAAGGAGGTGATGGG - Intergenic
1185785835 X:2890264-2890286 CAAGTGGTGCAGGAGGAGAAGGG - Intergenic
1189205968 X:39239069-39239091 AGACTTGGGCAGAAGGAGACTGG + Intergenic
1189271653 X:39756143-39756165 AAACTGGGGCGCCAGGAGATGGG + Intergenic
1189607735 X:42697837-42697859 ACACTGGTGCAGGAGGAGTGAGG - Intergenic
1190094279 X:47466617-47466639 AGGCTGAGGCAGGAGGAGAATGG - Intronic
1190443260 X:50496904-50496926 TAACTAGGGCAGCAGGAGAGAGG + Intergenic
1192220717 X:69195702-69195724 CAACTGGGCCAGGAGGGGACTGG + Intergenic
1193239701 X:79153390-79153412 AAACTGGAGCAGCAGGAAATGGG + Intergenic
1194062127 X:89216613-89216635 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
1195828857 X:109033213-109033235 AAACTGGGGTAGGGGGAGTGAGG - Intergenic
1198389024 X:136155050-136155072 GAAATGGGGCAGGAGAAGAGGGG - Intronic
1199560498 X:149158168-149158190 AAACAGGGCCAGTAGGAGAGAGG - Intergenic
1200077761 X:153560081-153560103 ACACAGGGGAAGGAGCAGATGGG + Intronic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200374737 X:155767650-155767672 AAACAGGAGGAGGAGGAGAAGGG + Intergenic
1200716050 Y:6545905-6545927 AGGCTGAGGCAGGAGGAGAATGG - Intergenic
1201288020 Y:12395545-12395567 CAAATGGTGCAGGAGGAGAAGGG + Intergenic
1201594595 Y:15653620-15653642 AGAAAAGGGCAGGAGGAGATGGG + Intergenic