ID: 1083436537

View in Genome Browser
Species Human (GRCh38)
Location 11:62647155-62647177
Sequence GCTTCATTCGGGACTTCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083436537_1083436545 16 Left 1083436537 11:62647155-62647177 CCTGGAGAAGTCCCGAATGAAGC 0: 1
1: 0
2: 0
3: 12
4: 70
Right 1083436545 11:62647194-62647216 GAAGATGAACTTCTGAGGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 225
1083436537_1083436546 17 Left 1083436537 11:62647155-62647177 CCTGGAGAAGTCCCGAATGAAGC 0: 1
1: 0
2: 0
3: 12
4: 70
Right 1083436546 11:62647195-62647217 AAGATGAACTTCTGAGGCAAGGG 0: 1
1: 0
2: 1
3: 28
4: 302
1083436537_1083436544 11 Left 1083436537 11:62647155-62647177 CCTGGAGAAGTCCCGAATGAAGC 0: 1
1: 0
2: 0
3: 12
4: 70
Right 1083436544 11:62647189-62647211 GATTGGAAGATGAACTTCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 198
1083436537_1083436547 30 Left 1083436537 11:62647155-62647177 CCTGGAGAAGTCCCGAATGAAGC 0: 1
1: 0
2: 0
3: 12
4: 70
Right 1083436547 11:62647208-62647230 GAGGCAAGGGCCCATGCTCCCGG 0: 1
1: 0
2: 1
3: 25
4: 271
1083436537_1083436540 -6 Left 1083436537 11:62647155-62647177 CCTGGAGAAGTCCCGAATGAAGC 0: 1
1: 0
2: 0
3: 12
4: 70
Right 1083436540 11:62647172-62647194 TGAAGCGACCCCGCTCTGATTGG 0: 1
1: 0
2: 0
3: 3
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083436537 Original CRISPR GCTTCATTCGGGACTTCTCC AGG (reversed) Exonic