ID: 1083438103

View in Genome Browser
Species Human (GRCh38)
Location 11:62656905-62656927
Sequence GGCCCTGAGAAGGGAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083438103_1083438106 -7 Left 1083438103 11:62656905-62656927 CCAACACTTCCCTTCTCAGGGCC 0: 1
1: 0
2: 5
3: 25
4: 364
Right 1083438106 11:62656921-62656943 CAGGGCCTCAGATCTGTGAAAGG 0: 1
1: 1
2: 1
3: 15
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083438103 Original CRISPR GGCCCTGAGAAGGGAAGTGT TGG (reversed) Intronic
900619888 1:3581845-3581867 GGCCCTGAGAACAGGAGGGTGGG - Intronic
900623734 1:3598846-3598868 GTCCCTGAGAAGGAAGGGGTGGG - Intronic
900766579 1:4509904-4509926 GGCCCTGAGAAGGAGGGTGGAGG + Intergenic
900932526 1:5746154-5746176 GGCGCTCAGAAGGGAAGAGGGGG + Intergenic
901158146 1:7154460-7154482 TGCCCAGAGATGGGAAGTGATGG - Intronic
901840683 1:11952231-11952253 GGCCCAGAGAAGGGAAAGGCTGG - Intronic
901885274 1:12218331-12218353 GGGCCTGAGCTGGGGAGTGTGGG + Intergenic
902069458 1:13722108-13722130 AGCCCAGAGAAGGGATGTTTGGG - Intronic
902368669 1:15992573-15992595 GGCCCTTTGAAGGGGAGAGTGGG - Intergenic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
902880835 1:19370810-19370832 GGCTCTGAGGAAGGAACTGTGGG - Intronic
903280260 1:22246050-22246072 TACCCTGGGAAGGGAGGTGTGGG + Intergenic
903468582 1:23568985-23569007 GGCGCTGGGCAGGGAAGTCTGGG + Intergenic
904267084 1:29324376-29324398 ACCCCTGAGAAGGGGAGTGAGGG + Intronic
904333183 1:29779142-29779164 GGTTCTGAGAAGGGATGTCTTGG - Intergenic
904357752 1:29952014-29952036 GTCCCTGAGAAGTGCAGTGGTGG + Intergenic
904482663 1:30803959-30803981 GGGCCTGAGAAGGGCATGGTCGG - Intergenic
904558934 1:31383939-31383961 GGCCCAGAGAAGGTCAGTGGTGG - Intergenic
905388731 1:37622788-37622810 GACCTTGAGAAGGGCAGTTTTGG + Intronic
905482342 1:38270291-38270313 GGCCCTGAGAACTGAACTGCTGG - Intergenic
905734469 1:40316203-40316225 GGCGCAGAGAAAGGAGGTGTAGG + Intronic
905907570 1:41629109-41629131 GGCTCAGAGAAGTTAAGTGTTGG - Intronic
906244544 1:44263694-44263716 GGCTCTGAGAAGAGAAGTCATGG + Intronic
906692596 1:47802407-47802429 GGCCCAGGGAAGGGAAGGGAAGG + Intronic
906833226 1:49057065-49057087 GGAACTGAGAGGGGAAGAGTAGG - Intronic
907048361 1:51313654-51313676 GGCCTGGAGGAGGGAAATGTGGG - Intronic
907685616 1:56608648-56608670 GACCCTGAGAAGGGAAGATAGGG + Intronic
907733847 1:57092721-57092743 TGCCCTGAGAGGGGAAGTGCAGG + Intronic
908967435 1:69782773-69782795 GCCACTGAGAAAGGAAGTGATGG - Intronic
909368957 1:74861903-74861925 GGCAGTGAGAAGGGAAATGTGGG - Intergenic
910644414 1:89498052-89498074 GAGGCTGAGAAGGGTAGTGTGGG + Intergenic
912418450 1:109527810-109527832 GGCCCTGGAAAGGGAGGTGAGGG - Intergenic
914858105 1:151366626-151366648 GGGCCACAGGAGGGAAGTGTGGG + Intronic
916070324 1:161166225-161166247 GGTCCTGAGGAGGGCAGTGACGG + Intergenic
916409918 1:164536723-164536745 GGAGCTGACAAGGGAGGTGTTGG - Intergenic
916998368 1:170326901-170326923 GGCCTGGAGAAGGGAACGGTGGG + Intergenic
917430719 1:174965577-174965599 AGCCCTCAGTAGGTAAGTGTGGG + Intronic
919398638 1:197081617-197081639 GGCAGTGAGAAGGGAAATGTGGG + Intergenic
919781505 1:201224272-201224294 GGGAATGAGAAGGGATGTGTGGG - Intronic
919986510 1:202679419-202679441 GGAGCTGAGAAGGGAAATATAGG - Intronic
920365931 1:205448456-205448478 GGTGCTGAGAAGGGGAGTGAGGG - Intronic
920594214 1:207252253-207252275 GAGCCTGAGAAGGGTAGTGGGGG - Intergenic
921032522 1:211345859-211345881 GGCACTGGGATGGGAAGAGTGGG - Intronic
921407673 1:214799125-214799147 GACCCTGACAAGGGGAGTGGTGG + Intergenic
922455279 1:225769225-225769247 CGCCCTGAGCTGGGAACTGTGGG - Intergenic
922468511 1:225861407-225861429 AGCCCTGAGGAGGGAAGCTTGGG - Intronic
923655287 1:235910511-235910533 CGCCCTGAGCATGGGAGTGTTGG - Intergenic
924271655 1:242339854-242339876 GGCCCAGGGAAGGGAAGGGGAGG + Intronic
1064251944 10:13712710-13712732 GGCCCAGAACAGGGAAGTGGAGG - Intronic
1064612057 10:17114011-17114033 GGCCCTGAGAATGTACCTGTTGG + Exonic
1069568277 10:69478245-69478267 GGCCTTGGGAAGGGAGGTGCAGG + Intronic
1069622195 10:69844670-69844692 GTCATGGAGAAGGGAAGTGTTGG + Intronic
1069884353 10:71614269-71614291 GGCCCTGAGCTGGGCATTGTTGG - Intronic
1070615005 10:77962753-77962775 GGCCCTGTAAAGGGAATAGTTGG + Intergenic
1073301824 10:102475556-102475578 GTCACTGAGATGGGAAGAGTAGG + Intronic
1073447740 10:103591334-103591356 GGCCCTGGGTGGGGAGGTGTGGG + Exonic
1074313597 10:112343023-112343045 GGCCCTGGGAAGGCCAGTTTGGG - Intergenic
1075406364 10:122198389-122198411 GGTCCTGTGAAGGGAATGGTTGG + Intronic
1076326515 10:129627601-129627623 GGCTGTGAGGAAGGAAGTGTTGG - Intronic
1077007853 11:367386-367408 GGTTCTTAGAAGGCAAGTGTTGG - Intergenic
1077178215 11:1200110-1200132 GGTCCTGAGATGGCAAGGGTGGG + Intronic
1080273002 11:30470714-30470736 GGCCCTTAGCTGGGAAGAGTGGG - Intronic
1080512581 11:32989620-32989642 GGCCATGGGAAGGGAAGGGATGG + Intronic
1080646457 11:34191675-34191697 GGCCCCAAGAAGGGAAGTGTGGG + Intronic
1081035337 11:38137139-38137161 ATCCATGAGTAGGGAAGTGTGGG - Intergenic
1081611236 11:44564853-44564875 GGCTCAGAGAAGGGAAGTCGAGG - Intronic
1081836916 11:46163344-46163366 GGCCCTGAGGTGGGAGGGGTAGG - Intergenic
1083261491 11:61525447-61525469 GGCCCTGAGGCGGGAGGAGTCGG - Intronic
1083438103 11:62656905-62656927 GGCCCTGAGAAGGGAAGTGTTGG - Intronic
1083454063 11:62766308-62766330 TGCCTGGAGAAGGGATGTGTGGG + Intronic
1083537725 11:63486648-63486670 GGGACTCAGAAGGGAAGGGTGGG + Intronic
1083719440 11:64597180-64597202 GACCCTGGGAAGGGCAGTTTGGG - Intronic
1083842674 11:65313809-65313831 AGCCCAGAGAAGGGAAATGGGGG - Intergenic
1084093271 11:66893340-66893362 GGCCCAGAGACGGGGAGTGAGGG + Intronic
1084366956 11:68707985-68708007 GGCCCTGCGAAGGGCAGAGCGGG - Exonic
1084509872 11:69596894-69596916 TCCCCTGAGAGGCGAAGTGTGGG + Intergenic
1084898999 11:72295645-72295667 GGCCCTGGGAAGGGAAGGAAGGG + Exonic
1085418687 11:76337222-76337244 GCCCCTGAGAGGGGCAGTATAGG - Intergenic
1085534238 11:77208548-77208570 GGCCCAGAGCAGGGAAGTGTGGG + Intronic
1085748778 11:79140548-79140570 AGCCCAGAAAAGGGAAATGTGGG - Intronic
1086655983 11:89355785-89355807 GTCCCTGAGAATGGAAATATTGG - Intronic
1088643326 11:111895248-111895270 GAGGCTGAGAAGGGTAGTGTGGG + Intergenic
1088737289 11:112738136-112738158 GGCCCTGACATGGGAGGTGAGGG - Intergenic
1089257506 11:117201645-117201667 AGCCCTGAGAAAGGAAGGGCAGG + Intronic
1089745769 11:120615857-120615879 GGCCCAGAGAAGAGAAGTAGGGG - Intronic
1090278836 11:125439077-125439099 AGCCCTGAAAAGGGTACTGTGGG + Intergenic
1092028128 12:5260234-5260256 GATTCTGAGCAGGGAAGTGTTGG - Intergenic
1093585788 12:20834898-20834920 GGCAGTCAGAAGGGAAATGTGGG - Intronic
1094169602 12:27478753-27478775 GGCCCACAGAAAGCAAGTGTTGG + Intronic
1094296524 12:28913078-28913100 GGCCCTGAAAGGGTATGTGTGGG - Intergenic
1094681003 12:32667007-32667029 GGCACTGAGAAGGCATTTGTAGG + Intergenic
1094864253 12:34510734-34510756 GGATCTGAGAAGGGATGTTTGGG - Intergenic
1096915959 12:55034152-55034174 GGCACTGAGAAAGGAGGTGGAGG + Intergenic
1097158058 12:57026984-57027006 AGCCCTGTGAAGGGAAATGCAGG + Intronic
1099826703 12:87784650-87784672 GGCCCGGCGAAGGGAGGGGTAGG + Intergenic
1100270670 12:93021672-93021694 GGTAATGAGAAGGGAAGAGTAGG - Intergenic
1100781334 12:98029844-98029866 AGCACTGAGAAGGGATGTCTTGG - Intergenic
1102100318 12:110273308-110273330 GGCGCTGATGATGGAAGTGTTGG + Intergenic
1102515865 12:113446282-113446304 GGCCCTGGGAAGGGCCCTGTAGG + Intergenic
1102705299 12:114875471-114875493 GGGCCTGGGAAGGGAGGAGTTGG + Intergenic
1105881500 13:24610137-24610159 GGCACTGAGCAGGGGACTGTGGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1110364539 13:74667284-74667306 GGTCCTCAGGAGGGGAGTGTGGG - Intergenic
1113770248 13:112903688-112903710 GTCACTGACAAGGGAAGTGATGG - Intronic
1113948572 13:114058648-114058670 GGGCCTGGGAAGGGCATTGTCGG - Intronic
1114531612 14:23400068-23400090 GGTCCTGGGAAAGGAAGAGTGGG + Intronic
1114633399 14:24173574-24173596 GGCCCTGAGTAGGTAAGTACAGG - Intronic
1115472492 14:33782948-33782970 CGCCTTCAGGAGGGAAGTGTAGG - Intronic
1119162297 14:72462765-72462787 GGCCCAGAGAAATGAAGTGATGG - Intronic
1119180454 14:72601362-72601384 GGTCCTGAGCAGGGGAGGGTTGG - Intergenic
1119194581 14:72708122-72708144 AGCCCAGAGAAGGCAGGTGTAGG + Intronic
1120701308 14:87702432-87702454 GAATCTCAGAAGGGAAGTGTGGG - Intergenic
1121569843 14:94939467-94939489 GGCCCTGAGAAGAGCGGTGGTGG - Intergenic
1122089397 14:99328257-99328279 TGCCCTGAGAAGGGGGGTGCTGG - Intergenic
1122779969 14:104139415-104139437 GGCCCGCAGAAGGGAAGTCCTGG - Intronic
1122817467 14:104320729-104320751 AGCCCGGAGGAGGGCAGTGTGGG - Intergenic
1122909422 14:104819802-104819824 GGCCCTGAGAAAGGGCGTGAAGG - Intergenic
1123876724 15:24630783-24630805 GGCCCTGAGAAGTGCAGTCCTGG - Intergenic
1124465372 15:29934521-29934543 GGGGCTGAGAAGGGAAGTGAGGG - Intronic
1124479076 15:30061865-30061887 GGCCCTGAGAGCTGAAGTCTGGG - Intergenic
1125501315 15:40241651-40241673 GCACCTGAGAGGGGGAGTGTGGG + Intronic
1125513153 15:40303513-40303535 GGCCATAGGAAGGGAAGTTTGGG - Intronic
1125896789 15:43309197-43309219 GGCCCTGAGGCAGGAAGTGGGGG + Intergenic
1126382804 15:48066182-48066204 GGGCCTTAGAGTGGAAGTGTTGG - Intergenic
1128143196 15:65316594-65316616 GGCTCCGAGAAGGGAGGTGGTGG - Intergenic
1128145338 15:65329655-65329677 GGCCTAGAGAAGGTGAGTGTGGG - Intronic
1128253532 15:66180366-66180388 TTCCCTGAGAAGGGACGTGGAGG - Intronic
1128311559 15:66634249-66634271 GGCCATGGGGAGGGAATTGTGGG - Intronic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129103926 15:73292109-73292131 GGCCTTGAGAAGGGAAGGAAGGG + Intronic
1129769512 15:78194187-78194209 GGCCCTGGGAGGGGCAGTGAGGG - Intronic
1130041611 15:80409880-80409902 GGCCCTGAGTTGGGAAGAGCTGG + Intronic
1131601299 15:93851467-93851489 GGGACTGAGAAGGAAAGAGTGGG - Intergenic
1131602848 15:93867205-93867227 GGCCTTGAGATGGGATTTGTTGG - Intergenic
1131998514 15:98156848-98156870 GGCACAGAGAAGGGAAGTCAGGG - Intergenic
1132600404 16:770406-770428 GGCCTGGAGGAGGGAAGTGGGGG + Intronic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1134402115 16:13919929-13919951 GAGCCTGAGAAGGCAAGCGTTGG - Intergenic
1134846711 16:17446833-17446855 GGCCCTGAGAAGGGAGCAGCGGG - Intronic
1136230823 16:28884275-28884297 AGCCCTGAGAAGGGATGGGCAGG - Intronic
1137798080 16:51238742-51238764 GGGCCTGAGAAGTGAAGAGGTGG - Intergenic
1138280939 16:55771778-55771800 GGCCCAGTGAAAGAAAGTGTAGG - Intergenic
1139332292 16:66202735-66202757 GTCCTGGAGAAGGGAAGTGATGG + Intergenic
1139499203 16:67347153-67347175 GGCCCTGGGAAAGTAATTGTAGG + Intronic
1140562994 16:76005752-76005774 GGCACTCAGAAGGGGAGGGTAGG + Intergenic
1141153716 16:81582397-81582419 GAGCTTGAGAAGGGATGTGTGGG + Intronic
1141377588 16:83546225-83546247 GCCTCTGAGAAGGGAAGAGCTGG - Intronic
1141631561 16:85290859-85290881 GTCCCTGAGCAGGCCAGTGTGGG + Intergenic
1142124322 16:88402650-88402672 GGCCCTGAGAAAGCAGGTGACGG - Intergenic
1142202995 16:88770018-88770040 GCCCCTGAGAGAGGAAGTGAGGG + Intronic
1142210076 16:88804580-88804602 GGCCCGGAGAAGGGCAGGCTGGG - Exonic
1142279147 16:89138612-89138634 GGCTCTGAGAAGGGAAGAGAGGG - Intronic
1142643858 17:1299860-1299882 GGCCCGGGGAAGGGAAGAGCAGG + Exonic
1143511228 17:7396226-7396248 TACCCTGAGATGGGAAATGTTGG + Intronic
1143543858 17:7585072-7585094 GGCCCAGAGAAGGGAAATAAAGG + Intronic
1145911596 17:28546463-28546485 GACCCTGAGAGGGGAAGCTTTGG - Intronic
1147338986 17:39742724-39742746 GTCCCTCAGAAGGGAAGGGAGGG + Intronic
1147376921 17:40027853-40027875 GGCCCTGAGGAGGGGTGTGGCGG - Intronic
1148618213 17:49015442-49015464 GGCAGTGGGAAGGGAAGTTTCGG - Intronic
1151192358 17:72407765-72407787 GGCCCAGCCAAGGGATGTGTGGG + Intergenic
1151459588 17:74246528-74246550 GCTCCTGAGAATGGAGGTGTGGG - Intronic
1151714545 17:75824833-75824855 GGGCCTGAGCAGGGAAGGGTGGG + Exonic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1154064332 18:11092813-11092835 GGCCCTGTGAAGGGATGAGGGGG - Intronic
1154123368 18:11669626-11669648 GGCTGTGAGAATGGGAGTGTGGG + Intergenic
1155870134 18:31016746-31016768 GGTACTGAGAAGGGATGTGAGGG + Intronic
1156410022 18:36818818-36818840 GTCCCTGAGAAGGAAAGATTAGG - Intronic
1156676118 18:39529308-39529330 GGAGCGGGGAAGGGAAGTGTTGG + Intergenic
1156860197 18:41827269-41827291 GCCTGTGAGAAGGGAAGTGAAGG + Intergenic
1157329903 18:46696230-46696252 GGTCCTGAGAGGGGAGGTTTGGG - Intronic
1157496982 18:48163073-48163095 GGGCCTGAGAAGGGATGTAGGGG + Intronic
1157941127 18:51930153-51930175 GGCAGTGTGAAGGGAAATGTGGG + Intergenic
1160537185 18:79600868-79600890 GGGTCTGAGAAGGGAGGTGGGGG - Intergenic
1160767432 19:814658-814680 GGGCCTGGGAAGGGCAGTGAGGG + Exonic
1161299408 19:3535669-3535691 GGCCCTGTGAGGGCACGTGTTGG - Intronic
1161355075 19:3814520-3814542 GGCCCTGAGAAGGGAAGGGATGG - Intronic
1161792702 19:6370100-6370122 TCGCCTGAGATGGGAAGTGTAGG + Intergenic
1161811740 19:6475417-6475439 GGCCCTGAGTGGGCAGGTGTGGG + Intronic
1162489894 19:10985842-10985864 TGCACTGGGAATGGAAGTGTTGG + Intronic
1163015286 19:14450877-14450899 GGGCCTGTGGTGGGAAGTGTGGG - Exonic
1163609507 19:18293576-18293598 AGCCCAGCGAAGCGAAGTGTGGG + Intergenic
1164337550 19:24344108-24344130 GAACCTGAGAAGGGAAATTTGGG + Intergenic
1164365071 19:27570567-27570589 GAACCTGAGAAGGGAAATTTGGG + Intergenic
1164523245 19:28994949-28994971 GGACCTCTGAAGGGCAGTGTAGG + Intergenic
1164899468 19:31906161-31906183 GTTCCCTAGAAGGGAAGTGTGGG + Intergenic
1165768529 19:38365139-38365161 GGCCCTGGGAGGGGAAGGTTGGG + Intronic
1166108629 19:40609951-40609973 GGACCCGAGAGGGGAAGCGTGGG - Intronic
1167473798 19:49689104-49689126 GGCCCTGAGGGTGGAAGGGTGGG - Exonic
1167494937 19:49812142-49812164 GGTTCTGAGGAAGGAAGTGTTGG + Intronic
1167959866 19:53097018-53097040 GGCCCTGGGAAGGGAGTTGGAGG - Intronic
1167963665 19:53126859-53126881 GGCCCTGGGAAGGGAGTTGGAGG - Intronic
1168267391 19:55230328-55230350 TGCACTGAGAAGAGAAGTTTTGG - Exonic
1168574946 19:57501762-57501784 GACCATGAGAAGGTAAGTGGAGG + Intronic
925305283 2:2844034-2844056 TGCCCTGAGTGTGGAAGTGTTGG - Intergenic
925747901 2:7059746-7059768 AGCACTGAGAAGGAAAGTGCTGG - Intronic
926271226 2:11368030-11368052 TGCCCTGAGAAGGCAGATGTGGG - Intergenic
927332771 2:21885561-21885583 GGCCCAGAGAAGTTAAGTCTTGG + Intergenic
928486148 2:31734327-31734349 GAGGCTGAGAAGGGTAGTGTGGG + Intergenic
928694438 2:33834864-33834886 GTCCCTGAAAAGGCATGTGTTGG - Intergenic
929995911 2:46826091-46826113 GGTCCTGAGAGGGCAAGAGTGGG + Intronic
930376133 2:50569132-50569154 GGGCCTGGGAAGGGTAGTGGGGG + Intronic
930808913 2:55520154-55520176 GCCCCAGAGAAGGGGAGTCTCGG - Intronic
931391138 2:61845165-61845187 GGACCTGAGAATGGAGATGTTGG + Intronic
932265342 2:70363036-70363058 GGCCCTGAGAAGGTGACAGTGGG - Intergenic
932327164 2:70871027-70871049 GGCCCTGGGAACAGAAGAGTCGG - Intergenic
932455906 2:71849883-71849905 TGGCCTGAGAAGAGAAGTCTGGG - Intergenic
932824230 2:74925271-74925293 GGACCTGAGAGGGGAAGAGAAGG + Intergenic
933356683 2:81219010-81219032 GAGGCTGAGAAGGGTAGTGTGGG - Intergenic
934077327 2:88439272-88439294 TGCCTTGATCAGGGAAGTGTGGG - Intergenic
935091623 2:99900426-99900448 GTCACTGAGAAGGGGAGTGGGGG - Intronic
936923842 2:117716465-117716487 GTCCCTGAGAAATTAAGTGTTGG + Intergenic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
940040054 2:149350857-149350879 GGCCCCGGCAAGGGTAGTGTGGG - Intronic
940280148 2:151980298-151980320 GGCTGTCAGAAGAGAAGTGTTGG - Intronic
941385031 2:164841763-164841785 GGGCCGGGGAAGGGAAGAGTAGG - Intronic
941466135 2:165829488-165829510 GGCTCTGAGAAGGTAAGGGTGGG + Intergenic
942694809 2:178629594-178629616 GGCGCTGAGAAGGGGAGAGCTGG + Intronic
943707126 2:191047336-191047358 GAACCTGAGGAGGGAATTGTGGG + Intronic
944237512 2:197453584-197453606 GGCCTTGAGAAGGGTAGTCTCGG + Exonic
944483040 2:200176859-200176881 GGGCATTAGAAGGGAATTGTGGG - Intergenic
944770165 2:202905863-202905885 GACACTGAGAAGGGTAGTGGGGG + Intronic
946008439 2:216545208-216545230 AGCCTTGAGTAGGGAAGTGGTGG + Intronic
946332715 2:219019334-219019356 GGCCCAGGGAAGGGAAGAATTGG - Intronic
946971769 2:225101255-225101277 GCCTCTGAGAAGGAAAGTGGTGG + Intergenic
947490868 2:230593548-230593570 GGACCTAAGAAAGGAACTGTGGG + Intergenic
948112637 2:235469062-235469084 GTCACTGGGAAGGGAAGTGGAGG + Intergenic
948529713 2:238596732-238596754 AGCCCTGAGAATGGAACTGTTGG + Intergenic
948711727 2:239829298-239829320 GACCCTGGGAAGGGAAATGGAGG + Intergenic
948937584 2:241177726-241177748 GGGCCTGAGCAGGGCAGTGCTGG - Intronic
1168799863 20:637476-637498 GGCCCAGAGAAGGGCAGCCTGGG - Intergenic
1170496440 20:16929688-16929710 AGCCCTGAGAATCCAAGTGTGGG - Intergenic
1171409897 20:24939259-24939281 ATCCCTGAGAATGAAAGTGTGGG + Intergenic
1172765778 20:37350035-37350057 GGCCCAGAGCAGGGAAGTGGTGG - Intronic
1172768953 20:37366531-37366553 GGCCTAGGGAAGGGAAGTTTAGG - Intronic
1173747163 20:45446624-45446646 AGCCCTGAGGAGGGAAGTGTGGG - Intergenic
1173749864 20:45468770-45468792 GGCCCTCAGGTGGGAAGTGGTGG + Intergenic
1174574626 20:51527595-51527617 GGCCCTCAGAAAGGATGTGTTGG + Intronic
1175155941 20:56971669-56971691 GGCCCAGAGAAGTGGGGTGTGGG - Intergenic
1175201083 20:57278100-57278122 GGTCCAGAGAAGGGAGGTGGTGG - Intergenic
1175409207 20:58754888-58754910 GGCCCTCAGCAGGAAAGTGCTGG - Intergenic
1175985258 20:62761233-62761255 GGCCTTGAGAAGGGGAATGTGGG + Exonic
1179083603 21:38196284-38196306 GGCCCAGACAAGGGAAGGGGAGG - Intronic
1179250043 21:39664694-39664716 TGCCCTGAGAAGGGCCATGTGGG - Exonic
1180593493 22:16959517-16959539 GGCCTTGATCTGGGAAGTGTGGG - Intergenic
1180920420 22:19518800-19518822 AGCCGTGAGAAGGGAGGAGTGGG - Intronic
1182490566 22:30668674-30668696 GAGGCTGAGAAGGGGAGTGTGGG - Intronic
1183165204 22:36142502-36142524 GGCCCTGGGAAGGGATCTCTGGG + Intronic
1183278193 22:36914585-36914607 GGCCCTGAGAATGAAAGGGCAGG + Intronic
1184326923 22:43795460-43795482 GGCCGTGAGAGGGGAGATGTGGG - Intronic
1184417875 22:44362772-44362794 GGTGCTGGGAAGGGAAGTGAGGG - Intergenic
1184645948 22:45895641-45895663 GGCCCTGATGAGGGAAGTCGGGG - Intergenic
1184866271 22:47203365-47203387 GGCCATGAGCAGGGAAATGAAGG - Intergenic
950558970 3:13711088-13711110 GGCCACAAGGAGGGAAGTGTGGG + Intergenic
951883787 3:27504556-27504578 AGCACTGAGAAGGGAGCTGTGGG - Intergenic
953236272 3:41110346-41110368 CTCCCTGAGAAGGAAAGGGTGGG + Intergenic
954077464 3:48191251-48191273 GGCCATGGGAAGGGAAAAGTTGG + Intergenic
954608895 3:51933917-51933939 GGCCCTGACAAGTGAAGGGCTGG - Intronic
954759787 3:52865791-52865813 GGCCCTGAGAAGGGAAACAGAGG - Intronic
954858749 3:53669628-53669650 GGTCTTGAGAAGGGAAGTAAAGG + Intronic
955249388 3:57263404-57263426 GAGGCTGAGAAGGGTAGTGTGGG - Intronic
957134270 3:76264778-76264800 GGCCCTGAGAAGAGTAGTATGGG - Intronic
959669875 3:108964461-108964483 GGGTCTGAAAAGGGAAGGGTAGG - Intronic
959777758 3:110188674-110188696 GCCACGGAGAAGGGAATTGTGGG - Intergenic
960958850 3:123054927-123054949 GTGGCTAAGAAGGGAAGTGTGGG + Intergenic
961041140 3:123679338-123679360 TGCCCAGAGATGGGAAGTGAAGG - Intronic
961396406 3:126594709-126594731 GGCCTTGAGAACTGAATTGTGGG + Intronic
964497670 3:157310904-157310926 GGCCCAGAGGAGGGAAGTACCGG + Intronic
964625886 3:158759528-158759550 GGCCCTGAGAGAGGATGGGTAGG + Intronic
967225941 3:187291466-187291488 GGCTCTGAGAAGGGAGCTGTGGG - Intronic
967800077 3:193647550-193647572 GACACTGAGCAGGAAAGTGTGGG - Intronic
968082054 3:195853269-195853291 GGCCCTGAGAACTGAACCGTGGG + Intergenic
968356913 3:198115647-198115669 GGAGCTGGGAAGGGCAGTGTGGG + Intergenic
968515753 4:1015001-1015023 GGCCCTGTCAGGGGAAATGTTGG + Intronic
968876210 4:3269203-3269225 GGCCCTGAGGAGGGGAGGGCAGG + Intronic
968900607 4:3429899-3429921 GGCCCTGAGACGGGTGGTCTGGG - Intronic
968949994 4:3685567-3685589 GCTGCTGACAAGGGAAGTGTGGG - Intergenic
969918292 4:10511520-10511542 GGCCCTGAGGAAGGAGGTGGAGG - Intronic
970384935 4:15546499-15546521 GGCCCTGAGAAGAGAAAGCTGGG - Intronic
970714234 4:18902404-18902426 GACTCTTAGAAGGGAAGGGTAGG - Intergenic
971299591 4:25430850-25430872 GGCCCAGAGGAGGGAAGGGAGGG - Intergenic
971468548 4:26992773-26992795 GGTCATGAGAAGAGAAGTGAAGG + Intronic
971740374 4:30511945-30511967 GTCCCTGGGATGGGAATTGTTGG + Intergenic
972927697 4:44032027-44032049 GGCTCTTATAAGGTAAGTGTAGG - Intergenic
973703061 4:53555150-53555172 GGCCCAGAGTAGGGAAGAGAAGG + Intronic
973788437 4:54356853-54356875 AGCCCTGAGCACTGAAGTGTGGG + Intergenic
974766166 4:66348962-66348984 GGCCCCGAGAAGGCAAGTGTAGG - Intergenic
977901381 4:102425989-102426011 GACCCAGAGATGGGAAGTGCAGG + Intronic
981589766 4:146347104-146347126 GGCCCAGAGAAGGGTAGAGGTGG + Intronic
982130530 4:152224980-152225002 GGTGCTGAGAAGGGAAGGGGAGG - Intergenic
985128051 4:186714645-186714667 GGCCCTGACAGGGGAGATGTCGG + Intronic
985193036 4:187398460-187398482 GGCTCTGAGAAGGTGAGTCTGGG - Intergenic
986780246 5:11058575-11058597 GGCAGTGCGAAGGGAAATGTGGG + Intronic
987670308 5:20998608-20998630 GGACCTGAGAAGGGAAGGGCAGG + Intergenic
990701048 5:58475319-58475341 GGCAATGGGAAGGGAAATGTGGG - Intergenic
991965018 5:72082167-72082189 GGCTCTGAGAGTGGAGGTGTGGG - Intergenic
992407831 5:76476322-76476344 AGCCCTGAGAAGTGAGGTGATGG + Intronic
992587795 5:78259363-78259385 GAGGCTGAGAAGGGAAGTGGGGG + Intronic
993241281 5:85389589-85389611 GGCCCTAAGAAGTCAAGAGTGGG - Intergenic
994002072 5:94792225-94792247 GGCCTGGAGAAGGGCAGTGCAGG - Intronic
996421845 5:123271048-123271070 AGCCATGAGCAGGGAAGAGTTGG - Intergenic
997454831 5:134008640-134008662 GGCTCTGAAAAGAGAAGAGTTGG - Intergenic
999239705 5:150120372-150120394 GGGTCTGAGTAGTGAAGTGTGGG + Intronic
999281477 5:150369306-150369328 GGCCCTGGGAAGGGCTGTGAGGG - Intronic
999727425 5:154447797-154447819 GGCCCAGAGATAGGAAGTGAGGG + Intronic
1000042208 5:157493162-157493184 TGCCCAGAGATGCGAAGTGTGGG - Exonic
1000188245 5:158881914-158881936 AGCCCTGTGAAGGGAGGTGGGGG - Intronic
1000234281 5:159343272-159343294 GGCCCTGAGGAGGGATTTGGTGG - Intergenic
1001286671 5:170428760-170428782 GGCATTGAGAAGGGAAAGGTGGG - Intronic
1001971514 5:175958603-175958625 GGCCATGAGAAGTCAACTGTTGG - Intronic
1002129849 5:177073959-177073981 GACCCTGTGAAAGGAAGTTTGGG + Intronic
1002245928 5:177885173-177885195 GGCCATGAGAAGTCAACTGTTGG + Intergenic
1002452347 5:179326070-179326092 GGCCCCAAGAAGGGAAATGGAGG - Intronic
1003646251 6:7915107-7915129 GGGCCTGAGAAGGGGAATGCTGG - Intronic
1005493381 6:26367881-26367903 GGACCTGGCAAGGGAAGTGTGGG + Intronic
1005502617 6:26443273-26443295 GGACCTGGCAAGGGAAGTGTGGG + Intronic
1005515387 6:26549766-26549788 GGCACTGAGCATGGAAGAGTTGG + Intergenic
1006296988 6:33174124-33174146 GGGCGTGAGAAGGGAAGGGCTGG - Intronic
1006336353 6:33422839-33422861 GGCACAGAGGAGGGAAGAGTTGG + Intronic
1007280351 6:40707870-40707892 GGCCCAGTGAAGGGATGGGTGGG - Intergenic
1007636089 6:43300599-43300621 GGGCCTGGGCAAGGAAGTGTGGG + Intronic
1007695141 6:43727251-43727273 GGCCCTGTGCTAGGAAGTGTGGG - Intergenic
1007943796 6:45807051-45807073 GACTCTGACAAGAGAAGTGTAGG + Intergenic
1010883103 6:81203352-81203374 GACTCTGATAAGGAAAGTGTGGG + Intergenic
1011013920 6:82734128-82734150 GACACTGAGAAGGGTAGTGAGGG - Intergenic
1011431070 6:87287439-87287461 AGCCCTGAGAAGGCAAATGAAGG + Intronic
1012528994 6:100211836-100211858 AGCCCTGGGAAGGGGAGTGGAGG - Intergenic
1015519416 6:134115414-134115436 GGCGCTGAGAAGCGAGGTGGGGG - Intergenic
1016466072 6:144327015-144327037 GTACCTGAGAAGGGATGTTTCGG + Intronic
1018087943 6:160321132-160321154 GGCCCAGAGTAGGAAAGTATAGG + Intergenic
1018735373 6:166683922-166683944 GGTCCTGAGAAGGGAAGGGGAGG - Intronic
1018903980 6:168064640-168064662 GGCCCTGAGCAGGCAGGTGTGGG - Intronic
1019568367 7:1696055-1696077 CGCCCTGAGACTGGAAGTCTGGG + Intronic
1019606636 7:1913433-1913455 GGCCTGGAGAAGGGAACCGTCGG + Intronic
1019728632 7:2617355-2617377 GGGCCTGGGAAGGGAAGGGCTGG - Intergenic
1020262688 7:6539522-6539544 GACCCTGAGAAGGCAGCTGTTGG - Intronic
1020398465 7:7745921-7745943 AGCCATGAGAAGGTAAGTCTCGG - Intronic
1023904553 7:44513095-44513117 GGAACTGAGAAGGGAAAAGTTGG + Exonic
1027573267 7:79899150-79899172 AGACCTGAGAAGTGGAGTGTGGG + Intergenic
1027726289 7:81810066-81810088 AGCACTTAGAAGGAAAGTGTCGG - Intergenic
1029115028 7:98232374-98232396 GGCCCTCAGAGGTCAAGTGTGGG - Intronic
1029253436 7:99252794-99252816 TGCCCTGAGCAGGGAAGAGAGGG - Intergenic
1029457327 7:100677854-100677876 GCCCCTGAGGCAGGAAGTGTGGG - Intronic
1030360056 7:108586296-108586318 AACCCTGACAAGGGAAGTTTTGG - Intergenic
1032100020 7:128967591-128967613 GCCCCTTTGAAGGGAAGTCTAGG - Intronic
1032780570 7:135162256-135162278 GGCCCTGGGAAGGGACCTGAAGG - Intronic
1033735180 7:144215014-144215036 GGCAGTGTGAAGGGAAATGTGGG + Intergenic
1033747876 7:144335955-144335977 GGCAGTGTGAAGGGAAATGTGGG - Intergenic
1034214713 7:149396466-149396488 AGCAGTGAGAAGGGTAGTGTGGG + Intergenic
1034272924 7:149812054-149812076 GGGCCTGAGCAGAGAGGTGTGGG - Intergenic
1034678616 7:152910883-152910905 GGCCCTGTGAAGGGAGGCCTGGG - Intergenic
1035034420 7:155885743-155885765 AGCCCTGGGAAGGGAAGGGCAGG - Intergenic
1035065873 7:156104931-156104953 GGGCCTGGGAAGGGAAGGGAAGG - Intergenic
1035125511 7:156605761-156605783 GGGCCTGAGAAGGGAAAGGCAGG + Intergenic
1038769817 8:30466961-30466983 TGCCCTGGGAAGGCAAGTTTTGG - Intronic
1039587242 8:38717625-38717647 TGCCCTGATAAGGGAAGTGAGGG + Intergenic
1040412612 8:47169506-47169528 AGCCCTGGGAAGGGCAGTATGGG - Intergenic
1044321246 8:90803907-90803929 GGCCCTGTCAAGGGAACTGGGGG - Intronic
1044891215 8:96838035-96838057 GGCAGTGAGAAGGGAAATGGAGG - Intronic
1045687873 8:104729858-104729880 GGGCCTGAGAAGGGAAGAGAAGG + Intronic
1047493944 8:125396553-125396575 GGCCCTGAGAGGGAAAGGGAAGG - Intergenic
1047513063 8:125530069-125530091 GTCCCAGAGAAGGGAAGCGCTGG - Intergenic
1047787353 8:128166829-128166851 AGCCCTGTGAAGGGATGAGTAGG - Intergenic
1047957447 8:129986317-129986339 GGCCTAGAGGAGGGAGGTGTGGG - Intronic
1048457049 8:134587697-134587719 TTGCCTGTGAAGGGAAGTGTGGG - Intronic
1049978272 9:880901-880923 GGCCCTCAGAAGGAAGTTGTAGG + Intronic
1051241369 9:15060144-15060166 TACCCAGAGAAGGGAAATGTAGG - Intergenic
1051889056 9:21924724-21924746 GGCCCTGGGTAGGGAAGGGAAGG - Intronic
1051997682 9:23238090-23238112 GGCCGTTAGAAGGCAAGTGCAGG - Intergenic
1052990932 9:34519067-34519089 GGACCTGAGAAGGGACAGGTGGG + Intronic
1056009608 9:82313425-82313447 GGCCCTGATAAGGAAAGAGTAGG + Intergenic
1056020650 9:82434789-82434811 GGCACTGACAAGGGATGTGGGGG - Intergenic
1057139565 9:92718372-92718394 GGCCCTGAGCAGGGGAGGGTAGG + Intronic
1057799447 9:98181201-98181223 GGCCATGAGAAGGGCACTGCCGG + Intronic
1058644561 9:107118752-107118774 GGCCCTGGGAGGGGATGTGAGGG + Intergenic
1059093468 9:111386806-111386828 GGACCTGGGAAGGGGATTGTAGG - Intronic
1059656251 9:116360256-116360278 GGCTCTGAGAAGGAGAGTCTGGG + Intronic
1060207839 9:121693080-121693102 GGCCCAGAAAGAGGAAGTGTGGG + Intronic
1060995565 9:127873478-127873500 GGGCCTGAGAGGGGAAGGGCAGG - Intronic
1061397779 9:130352908-130352930 GGCGCTGAGAAGGAAAGAGGTGG - Intronic
1061527481 9:131178806-131178828 TGCCTGGAGAAGGGAAGTGAGGG - Intronic
1061991159 9:134159428-134159450 GGCCCTGAGAAAGGCAGAGCTGG - Exonic
1062290128 9:135790655-135790677 GTCCCTGAGAAGGGAAAAGTCGG - Intronic
1062399730 9:136367117-136367139 GGCCATGTGACGGGCAGTGTGGG + Intronic
1187420215 X:19127489-19127511 GGGCCTGCGAAGTGAAGAGTTGG + Intergenic
1188003200 X:25001108-25001130 GGCCCTGGGAAAGCAGGTGTTGG + Intergenic
1197706612 X:129638951-129638973 GAACCTGGGAAGGGAAGTCTGGG + Intergenic
1198399421 X:136254701-136254723 GGGCCTGAGATGGGGACTGTGGG + Intronic
1199842624 X:151665551-151665573 GACACTGAGAAGGGAAGAATGGG + Intronic
1199988186 X:152967466-152967488 GTGACTGAGAAGGGAAGTGGTGG + Intronic
1200149802 X:153945804-153945826 GGCCCAGAGAAGGGGGGTGTGGG - Intergenic
1200163808 X:154022564-154022586 TGCCCTGGGAAGGGGAGGGTGGG + Intronic
1200213458 X:154357033-154357055 GGCCCAGAGAGGGGAAGAGCTGG + Intronic
1200445477 Y:3256137-3256159 GGCACTGCAAAGGGAAATGTGGG - Intergenic
1200671025 Y:6091574-6091596 GGGTCTGAGAAATGAAGTGTAGG + Intergenic
1202109479 Y:21405704-21405726 GGACATGAGATGGGCAGTGTAGG + Intergenic