ID: 1083444015

View in Genome Browser
Species Human (GRCh38)
Location 11:62695198-62695220
Sequence CCTTCCTACTCTGAGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083444015_1083444021 5 Left 1083444015 11:62695198-62695220 CCCCAAGACTCAGAGTAGGAAGG 0: 1
1: 0
2: 3
3: 20
4: 184
Right 1083444021 11:62695226-62695248 TCACAGGGATCACCCTCAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
1083444015_1083444020 -10 Left 1083444015 11:62695198-62695220 CCCCAAGACTCAGAGTAGGAAGG 0: 1
1: 0
2: 3
3: 20
4: 184
Right 1083444020 11:62695211-62695233 AGTAGGAAGGCTTCTTCACAGGG 0: 1
1: 0
2: 0
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083444015 Original CRISPR CCTTCCTACTCTGAGTCTTG GGG (reversed) Intronic
902655758 1:17866885-17866907 CCTTCCTGCACTGATGCTTGAGG + Intergenic
903377580 1:22876437-22876459 CCTTCCTTGGCTGAGACTTGGGG - Intronic
904117397 1:28172809-28172831 CATTCCAGCTCTGAGCCTTGGGG + Intronic
904349534 1:29895921-29895943 CCCTCCTGCTCTGATTCCTGTGG - Intergenic
904397865 1:30234744-30234766 CCTTCCTCCTGGGAGTTTTGGGG + Intergenic
905252483 1:36658637-36658659 CCTTCCTCCTTTGAGCCTTTGGG + Intergenic
905943938 1:41885937-41885959 CCTCACTGCTCTGAGCCTTGGGG - Intronic
906320000 1:44809848-44809870 CCTCCCCAGCCTGAGTCTTGGGG - Intronic
906526548 1:46496579-46496601 CCTTCCAACTCTGAGCTTTTGGG - Intergenic
907138130 1:52158464-52158486 CCTTTGAACTCTGAGTCTTCAGG - Intronic
910216021 1:84845453-84845475 CCTACCTGCTCTGAGTAGTGTGG - Intronic
912475332 1:109931093-109931115 CCTTCCTCCCCTGTGTTTTGTGG - Intergenic
912484802 1:110017760-110017782 CCTTCCTAGAGGGAGTCTTGGGG + Intronic
915759643 1:158297622-158297644 ACTTGCCACTCTGTGTCTTGGGG - Intergenic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
917164818 1:172099968-172099990 CCTTCCTGCTAAGACTCTTGAGG - Intronic
918314245 1:183309730-183309752 CCTTTCTACTCTTGGGCTTGGGG - Intronic
919682072 1:200445417-200445439 CCATCCTACTCAGAGTGATGTGG + Intergenic
920837647 1:209526471-209526493 CCTTCCTTTGCTGTGTCTTGGGG - Intergenic
921245286 1:213232390-213232412 CCTCCCTACTTTGAGTTGTGAGG + Intronic
923223505 1:231917608-231917630 CCTTCCTGCTCTGGATCTTGTGG + Intronic
1067237641 10:44465063-44465085 CCTTCCCACACTGAGTGCTGTGG + Intergenic
1067776484 10:49168132-49168154 CGTTCCTGGTCTGAGTTTTGAGG - Intronic
1068437169 10:57007583-57007605 TCTACCTTCTCTGAGTGTTGAGG - Intergenic
1069917678 10:71797465-71797487 CCTTCCTACTCTCAGCCTGGGGG - Intronic
1070286083 10:75084976-75084998 CCTTCCCACTTTGACACTTGAGG + Intergenic
1071390251 10:85166786-85166808 CCTTGCTGCTCAGAGTCTTGGGG + Intergenic
1072595887 10:96871371-96871393 TTTTCCTACTCTGATTCTTTAGG - Intronic
1075086925 10:119419838-119419860 CCTCCCTTCTCTGAGCCGTGGGG + Intronic
1076194006 10:128502376-128502398 GCCTCCTACTGTGAGTCTTTGGG + Intergenic
1076896669 10:133316612-133316634 CTTTCCATCTCTGTGTCTTGGGG - Intronic
1076896721 10:133316798-133316820 CTTTCCATCTCTGTGTCTTGCGG - Intronic
1078140905 11:8692390-8692412 ACTTCCCACTCTGAGTCTTCTGG + Intronic
1079907403 11:26266269-26266291 CCTTTAAAATCTGAGTCTTGGGG - Intergenic
1081440347 11:43073977-43073999 CTTTCCTACTTTGAGATTTGGGG - Intergenic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1084010276 11:66344613-66344635 CATTCCTGCTCTGAGTGTTGAGG + Intronic
1085627617 11:78085392-78085414 CCTTCCTACTCTTAGTCCCCTGG + Intergenic
1085719602 11:78901540-78901562 ACTTCCTATTCTGAGTCTCCAGG - Intronic
1088055460 11:105571153-105571175 CCTTCCGATTATGAGTCTTAAGG - Intergenic
1094159046 12:27370445-27370467 CTTTCCTGCACTGAGTCCTGGGG - Intronic
1094696267 12:32821953-32821975 CCCTCCTTCTCTGAGTATCGTGG - Intronic
1095043642 12:37473889-37473911 CCTCCCTACTCTGATTGTTTAGG + Intergenic
1096226125 12:49867899-49867921 GCCTCCTACTCTGGGTCCTGAGG - Exonic
1096862325 12:54538748-54538770 CTTTCCCACCCTGAGTCTTCAGG + Intronic
1097532084 12:60814727-60814749 CCCTCCTACTCTGTGTCTCTTGG - Intergenic
1098930582 12:76407880-76407902 ACTTACTATTTTGAGTCTTGGGG + Intronic
1100134732 12:91541637-91541659 CCTTCCAAATCTGATTCTAGAGG - Intergenic
1101000688 12:100354690-100354712 CCTTCCTGTTCTCAGTCTTGAGG + Intergenic
1101305077 12:103520107-103520129 ACCACCTATTCTGAGTCTTGTGG - Intergenic
1105508861 13:21034632-21034654 CCTTCTTACTCTGCCTCTGGGGG + Intronic
1106431709 13:29687124-29687146 CCTTCCTTATATGAGTCTTTAGG + Intergenic
1108525611 13:51283549-51283571 CCTTCCTGTTCTGAGCCCTGTGG - Intronic
1110736016 13:78937590-78937612 GGTTCTTACTCTGAGTTTTGTGG + Intergenic
1112375411 13:98835660-98835682 CCTTCCCATTCTGAGACTGGAGG + Intronic
1113032023 13:106004209-106004231 CCTTCCGACTCTGAGTCAGAAGG + Intergenic
1115302930 14:31904355-31904377 CCTTCCTCCTCTGAGCCTCATGG + Intergenic
1115317858 14:32045232-32045254 CCTTTCTATTCTGAATTTTGGGG - Intergenic
1117927237 14:60795240-60795262 CCTTTAGCCTCTGAGTCTTGAGG - Intronic
1120716233 14:87843907-87843929 CCTTCCTCCTCTTAGTATTTTGG + Intronic
1121310824 14:92934136-92934158 CGCTCCTGCTCTAAGTCTTGAGG + Intronic
1202942178 14_KI270725v1_random:161486-161508 CCTCCCTACTCTGATTATTTAGG + Intergenic
1124467446 15:29950839-29950861 ACTTCCTACTATGAGACTGGTGG - Intronic
1126291240 15:47081971-47081993 CCTCCCTACTCTGATTGTTTAGG - Intergenic
1126796181 15:52261925-52261947 GCTTCCTACACTGTGTCCTGAGG - Intronic
1127892718 15:63269437-63269459 CCCTCCTACCCTGTGGCTTGTGG + Intergenic
1128535368 15:68486200-68486222 CCTCCCTGCTCTGTGTCCTGAGG - Intergenic
1128811589 15:70577008-70577030 CCTTCCAACTCTGAGACTCGAGG - Intergenic
1129693401 15:77726376-77726398 CTTTCCTCCTCTGGGTCTTTGGG - Intronic
1130752630 15:86728528-86728550 CCTTTTTACTCAGAGCCTTGTGG + Intronic
1130834278 15:87633942-87633964 CCATCAGACTCTGATTCTTGGGG - Intergenic
1132025132 15:98398903-98398925 TCTGCCTGCTCTGTGTCTTGTGG - Intergenic
1133076737 16:3285790-3285812 CCTTCCTCCCCTGAGTGTTGGGG + Intronic
1133904491 16:10009528-10009550 CTTTCCTGGTCTGAGTCTAGGGG - Intronic
1138131306 16:54482389-54482411 CCTTCCAATTCTGTCTCTTGAGG - Intergenic
1138431944 16:56974691-56974713 CCTACCTTCTCTGAGCTTTGTGG - Intronic
1139873701 16:70128142-70128164 CCTTTCTCCTCCTAGTCTTGGGG - Intronic
1140362077 16:74353000-74353022 CCTTTCTCCTCCTAGTCTTGGGG + Intergenic
1141402896 16:83766202-83766224 CCTTCCTAATCTAACCCTTGGGG - Intronic
1141575359 16:84959921-84959943 CCTTTGTACTCTGTGGCTTGTGG - Intergenic
1142379710 16:89724340-89724362 AGTTCCCACTTTGAGTCTTGAGG + Intronic
1142594485 17:1022866-1022888 CCTTCCTCCCATGAGGCTTGGGG - Intronic
1143071489 17:4298601-4298623 ACTTTATACTCTGAGTCCTGTGG - Intronic
1143694984 17:8607635-8607657 CCTTCCTACCATGTGTCTGGGGG - Intronic
1145890577 17:28412274-28412296 CCTTCCTTCTATGAGTCCTCAGG + Intergenic
1146976390 17:37116520-37116542 CTTTCCTACTCACAGTCTTGGGG - Intronic
1147420561 17:40320304-40320326 CCTTCCTACTCCCAACCTTGAGG + Intronic
1147914815 17:43879948-43879970 CCTTCCCGCTCTGAGTCTTTCGG + Exonic
1148558574 17:48593067-48593089 CTTTCCTTCTCTGCGTTTTGGGG - Intronic
1149597390 17:57872434-57872456 CCTTCTTCCTCTGAGTCCCGAGG + Intronic
1152317037 17:79587184-79587206 CCTTCCTATTCTCAGGGTTGCGG - Intergenic
1152489617 17:80621492-80621514 GCTTCCTCCTCTGCGTCTCGGGG - Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162057125 19:8071488-8071510 CCTTCCCTGTCTGAGCCTTGGGG - Intronic
1162689173 19:12414467-12414489 CCCTCCTGCTCTGAGGCTAGGGG - Intronic
1167350921 19:48974224-48974246 CCCTCCTACTATGAGCCTTGGGG - Exonic
1167376483 19:49114783-49114805 CCTTGCTTCTCTGCGTCTCGGGG + Intronic
925037998 2:706548-706570 CCTTCCCACTCTTGGTTTTGTGG + Intergenic
925845733 2:8031684-8031706 GCTACTTACTCTGAGTCTTGGGG - Intergenic
925950941 2:8910677-8910699 CCTTTCTACTTTGAGAGTTGGGG - Intronic
926682651 2:15675559-15675581 CCTTCCTTCCCTGAGGCTTTGGG - Intergenic
927602563 2:24456962-24456984 CCTTCGTACCCTGAGTGTTGTGG + Intergenic
928523586 2:32116191-32116213 TCTTCCTTCTCTGAGGCCTGAGG + Exonic
930735778 2:54777147-54777169 ACTTCCTTCTGTGAGTATTGAGG - Intronic
932789468 2:74641318-74641340 ACTTCCTAATCTGAGTCCTGGGG - Intronic
932842607 2:75097625-75097647 CCTTCCTATTCTCAGTCTTGGGG + Intronic
934708027 2:96498255-96498277 CCCTCCTGCTCTGAGGGTTGAGG - Exonic
937052505 2:118903949-118903971 CCTTCCTCTTCTAACTCTTGAGG - Intergenic
940047120 2:149421474-149421496 CCCTACTACACTGAGTGTTGTGG + Intronic
940056670 2:149520382-149520404 ACTTCCTAGTCTCATTCTTGAGG - Intergenic
940336738 2:152536788-152536810 CCTTCATATTCTGAGGCTTAAGG - Intronic
940349044 2:152660723-152660745 CCTTAATAATCTGAGGCTTGAGG - Intronic
940461635 2:153970933-153970955 TGTTTCTACTCTGAGTATTGGGG - Intronic
945007220 2:205421436-205421458 CTTTTCTACTGTGTGTCTTGAGG - Intronic
945100959 2:206261835-206261857 CCTTTCAACTTTGAGTCTGGTGG + Intergenic
945266158 2:207893309-207893331 CCTTCCTTCTTTGGGTTTTGGGG + Intronic
947041488 2:225926348-225926370 GCTTCCTTCTCTGAGACTAGAGG + Intergenic
947456275 2:230256933-230256955 CCTTCCCTATCTAAGTCTTGAGG - Intronic
947934675 2:233993690-233993712 TCTTCCTACTTGGACTCTTGTGG + Intronic
1170109769 20:12792423-12792445 CCAACCTACACTGATTCTTGGGG + Intergenic
1171803041 20:29644820-29644842 CCTCCCTACTCTGATTGTTTAGG - Intergenic
1171841041 20:30211925-30211947 CCTCCCTACTCTGATTGTTTAGG + Intergenic
1172413208 20:34741953-34741975 CCTTCCTACTCTGGGAATTCTGG + Exonic
1172532953 20:35646310-35646332 CCTTCCCACTGTGTGACTTGTGG + Intronic
1172565500 20:35927098-35927120 ACTTCCTTCCCTGAGTATTGAGG - Intronic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1175500774 20:59449087-59449109 CCTTGCTTCTCTGAGTGTGGAGG + Intergenic
1176377639 21:6094346-6094368 CCTTCCTGCTCAGAGTCCTTGGG + Intergenic
1176580993 21:8525444-8525466 CCTCCCTACTCTGATTATTTAGG - Intergenic
1177246828 21:18536552-18536574 CCTTCTTACTCTCAGTCTATAGG + Intergenic
1177880125 21:26683896-26683918 ACTTCCTACTTTGAGTACTGAGG - Intergenic
1179745836 21:43443898-43443920 CCTTCCTGCTCAGAGTCCTTGGG - Intergenic
1180705203 22:17805245-17805267 CGTTCCTCTTCTTAGTCTTGTGG - Intronic
1181957658 22:26599807-26599829 CCTTCCTGCTCTGTGCCCTGGGG + Intronic
1184405553 22:44298661-44298683 CCTTCCCTCCCTGAGTCCTGTGG - Intronic
1184848419 22:47103196-47103218 CATTCCTACTCTTAGTCTTGGGG + Intronic
949531230 3:4957522-4957544 ACTTCCTACTCTGTCTCTTAGGG - Intergenic
951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG + Intronic
951253608 3:20423260-20423282 ACTTCTTACTCTGAGTCCTTGGG + Intergenic
953098986 3:39807695-39807717 CCTTCCGACTCTGCTTCATGGGG - Intergenic
954317014 3:49806677-49806699 CCTTCCTTCCAAGAGTCTTGGGG + Intronic
954615943 3:51968562-51968584 GTTTCCTGCTCTGAGGCTTGTGG - Exonic
955410886 3:58654622-58654644 CCATTCTGCTCTGACTCTTGAGG + Intronic
956400529 3:68874668-68874690 CCTTCCCTCTTTGAGTCTTTAGG - Intronic
960614896 3:119587531-119587553 CCTACCTTCCCTGAGTCTTTCGG + Exonic
964623994 3:158741377-158741399 CCTTCCTGCTGAGAGTCTGGTGG - Intronic
966102374 3:176286289-176286311 CCATCCTACTATGAGGCTTTAGG - Intergenic
969903306 4:10370134-10370156 CTTTACTACTCTAAGTCTTGTGG + Intergenic
970164374 4:13220852-13220874 CTTTGCTACTCTGAGCCTAGAGG - Intergenic
970180226 4:13384116-13384138 CCTTCCTAGTTTCACTCTTGCGG - Intronic
973679864 4:53306052-53306074 CCCAACTACTCTGAGTCTGGTGG + Intronic
974909369 4:68097873-68097895 CCTTCCTACCCTCATTATTGGGG - Intronic
979404720 4:120295388-120295410 CCTTCCTACTCTGTGGCTTAGGG + Intergenic
982309771 4:153972674-153972696 ACTCCCTACTCTGAGCCTTTGGG - Intergenic
982633748 4:157866040-157866062 CCTTCTTACTCTGAGGTCTGAGG - Intergenic
983904999 4:173172636-173172658 GCTGCCTACTCTGACTTTTGAGG + Intronic
986064294 5:4220707-4220729 GCTTCTTCCTCTGGGTCTTGAGG + Intergenic
987378080 5:17256219-17256241 CTTTTCTACTCTAACTCTTGTGG + Intronic
988884367 5:35539484-35539506 CCTTCCCACTCTAAGGATTGAGG + Intergenic
992847701 5:80769608-80769630 CAGTCCTATTCTGGGTCTTGAGG + Intronic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
997758104 5:136419463-136419485 CTTACCTGCTCTGAGGCTTGTGG + Intergenic
998364928 5:141623671-141623693 CTTTACTGCTCTGACTCTTGGGG - Intronic
998916324 5:147015566-147015588 TCTGCCTTCTCTGAGTCTTACGG + Intronic
999057825 5:148599188-148599210 CTTTCCTTCTCTGCATCTTGTGG - Intronic
1000483718 5:161812351-161812373 CCTTCAGACTCTGATTCTTCAGG - Intergenic
1003272251 6:4617588-4617610 GCTTCCTGCTCTGATTCTGGAGG - Intergenic
1003972742 6:11314593-11314615 ATTTCCTACACTGAGGCTTGTGG + Intronic
1005712527 6:28515656-28515678 CCTTCCTATTTTGAGGCTTTAGG + Exonic
1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG + Intergenic
1007236093 6:40392299-40392321 CCTCCTTTCTCTGACTCTTGAGG + Exonic
1007383062 6:41503063-41503085 CCTTGCTCCACCGAGTCTTGGGG + Intergenic
1008496854 6:52142959-52142981 CCTTCCTTCTCTAAGTTTGGGGG - Intergenic
1013856451 6:114579332-114579354 CCTTGCTACAGTGAGGCTTGGGG + Intergenic
1016514016 6:144873682-144873704 CCTTACTGCTCAGAGTCATGTGG + Intergenic
1017578832 6:155837652-155837674 CCTTCCCTCTGTGAGTTTTGAGG + Intergenic
1017851064 6:158306447-158306469 CCTTCCACCTCAGACTCTTGAGG - Intronic
1017851915 6:158311586-158311608 CCTTACTGCTTTGTGTCTTGAGG + Intronic
1017899431 6:158706288-158706310 CCTTCTTCCTTTGAGGCTTGGGG + Intronic
1019822935 7:3259477-3259499 CCTCCCTACTTTGAGTCATCTGG - Intergenic
1023640655 7:42253632-42253654 TCTTCCCACTCTGTGTCTTTTGG + Intergenic
1023751475 7:43377147-43377169 CCTCCCTACTCTGGGTCTCATGG - Intronic
1025289556 7:57703448-57703470 CCTCCCTACTCTGATTGTTTAGG + Intergenic
1028986340 7:97011963-97011985 CCTTCCTACTGTGAAACTTTGGG + Intergenic
1029695720 7:102211939-102211961 CCTTCCTCCTGTGGCTCTTGGGG - Intronic
1031188612 7:118516799-118516821 CCTTTCTTCTCTGAGCCTTATGG - Intergenic
1031701813 7:124935531-124935553 ACAGCCAACTCTGAGTCTTGAGG - Intergenic
1036067568 8:5399602-5399624 CCTTCCTACTCTGATATTTTAGG - Intergenic
1038658064 8:29472354-29472376 TCTTCCTCCTCTGAGGATTGAGG - Intergenic
1039559842 8:38504127-38504149 CCTCCCTGCTCTGAGTCCTGAGG - Intergenic
1040564663 8:48555000-48555022 CCCACCTCCTCTGAGTCATGAGG - Intergenic
1047332864 8:123907776-123907798 CCTTCCTATGCTCAGTATTGAGG - Intronic
1047785598 8:128151406-128151428 CTTTCCTACTCAGAGACTGGTGG - Intergenic
1049101067 8:140579410-140579432 TTTTCCTACTCTGTGTCTTTGGG + Intronic
1051112968 9:13661068-13661090 TCTTCCTACTCTTAGTGTTGGGG + Intergenic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1053130210 9:35610248-35610270 CCTTCCTAACCTGAGGCCTGGGG - Exonic
1053513345 9:38708288-38708310 CCTTCCTACGCTGTCTCATGGGG + Intergenic
1059004337 9:110384671-110384693 CCTTACTTCTCTGAGTCTGAGGG - Intronic
1060325309 9:122608830-122608852 ACTCCCAGCTCTGAGTCTTGGGG - Intergenic
1062110171 9:134777833-134777855 CCTCCCTGCCCTGAGTCCTGGGG - Intronic
1062424175 9:136498388-136498410 ACTTCTTCCTCTGAGCCTTGAGG + Intronic
1203611007 Un_KI270749v1:3493-3515 CCTCCCTACTCTGATTGTTTAGG - Intergenic
1189367233 X:40398115-40398137 CCTTCTTACTCTGAATTTAGAGG + Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1194799111 X:98249498-98249520 CCTTCCTCACCTGAGTTTTGGGG + Intergenic
1198921481 X:141733524-141733546 GCTTCCTAAACAGAGTCTTGAGG - Intergenic
1199937706 X:152591806-152591828 CTTTCCTTCTCTGAGTCATGAGG - Intergenic