ID: 1083450699

View in Genome Browser
Species Human (GRCh38)
Location 11:62743132-62743154
Sequence GGTGGTGCATGCTACTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083450699_1083450705 17 Left 1083450699 11:62743132-62743154 CCTTCCAAGTAGCATGCACCACC No data
Right 1083450705 11:62743172-62743194 TTTTGTATTTTTAGTAGATACGG 0: 1554
1: 206090
2: 140343
3: 62604
4: 38229
1083450699_1083450707 19 Left 1083450699 11:62743132-62743154 CCTTCCAAGTAGCATGCACCACC No data
Right 1083450707 11:62743174-62743196 TTGTATTTTTAGTAGATACGGGG 0: 765
1: 104717
2: 223485
3: 149506
4: 77413
1083450699_1083450706 18 Left 1083450699 11:62743132-62743154 CCTTCCAAGTAGCATGCACCACC No data
Right 1083450706 11:62743173-62743195 TTTGTATTTTTAGTAGATACGGG 0: 1440
1: 173865
2: 212424
3: 122053
4: 64976

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083450699 Original CRISPR GGTGGTGCATGCTACTTGGA AGG (reversed) Intergenic
No off target data available for this crispr