ID: 1083455878

View in Genome Browser
Species Human (GRCh38)
Location 11:62778298-62778320
Sequence CCTGGATGGCAAAGGGAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083455871_1083455878 23 Left 1083455871 11:62778252-62778274 CCAGGCTGACACATCTCTCTGCA 0: 1
1: 0
2: 2
3: 19
4: 245
Right 1083455878 11:62778298-62778320 CCTGGATGGCAAAGGGAACCTGG 0: 1
1: 0
2: 0
3: 19
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083455878 Original CRISPR CCTGGATGGCAAAGGGAACC TGG Exonic
901415206 1:9111601-9111623 CCTGGATGGCACAGTGGCCCTGG + Intronic
901635293 1:10667633-10667655 CCTGGATGGGGAAGGGAAGGGGG + Intronic
903318869 1:22529738-22529760 CCTGGATTGCCAGGGAAACCTGG - Exonic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903887890 1:26551560-26551582 CCTGGCAGGCCAAGGGAGCCAGG + Intronic
906415414 1:45618039-45618061 CCTGGAAGACAAACAGAACCTGG - Exonic
908398342 1:63746699-63746721 CCTGGGAGGCACAGGGGACCAGG + Intergenic
909775491 1:79479393-79479415 CCTGGATGGCACAAGGAATCTGG + Intergenic
912478141 1:109955535-109955557 GCTGGATGGCAAAGGGCATGAGG + Intergenic
913478900 1:119265715-119265737 CCTGGAAGATAAAAGGAACCAGG + Intergenic
913674064 1:121124981-121125003 CATGGATGGCAAAGAGATGCAGG - Intergenic
914025848 1:143912302-143912324 CATGGATGGCAAAGAGATGCAGG - Intergenic
914664283 1:149820023-149820045 CATGGATGGCAAAGAGATGCAGG - Intergenic
914671479 1:149873812-149873834 CATGGATGGCAAAGAGATGCAGG + Intronic
914923840 1:151866422-151866444 CGTGGCTGGCAAAGGGCTCCTGG + Intergenic
916153536 1:161820857-161820879 CCCTGCTGGAAAAGGGAACCTGG + Intronic
917929531 1:179813892-179813914 CCTGGACGGCAGAGGCAGCCTGG + Exonic
920049116 1:203152642-203152664 CCGGGATGGCAAAAGGAGCAAGG - Intronic
920127934 1:203708512-203708534 CCTGGATGGCACAAGGATCACGG + Intronic
920430041 1:205912893-205912915 CCAGGATGGAAAATCGAACCTGG + Intergenic
921400302 1:214714983-214715005 CATGGAGGCCAAGGGGAACCTGG - Intergenic
923025199 1:230198269-230198291 CCTGGGTAGGAAAGGGAGCCTGG + Intronic
924826858 1:247548859-247548881 CCTTGAAAGCAAAGTGAACCTGG + Intronic
1064313566 10:14234424-14234446 CCTGGATCTCAGAGGGATCCCGG + Intronic
1064715512 10:18172626-18172648 CCTGGATAGCAAGGGCAGCCTGG - Intronic
1067079092 10:43203552-43203574 CCTGCAAGGCGAAGGGAACCGGG - Intronic
1067553102 10:47248758-47248780 CCAGGTTGGCAAAGTGAGCCAGG + Intergenic
1068959690 10:62854071-62854093 GCTGGCTGGCAAAGGGAGCCAGG + Intronic
1068961040 10:62866914-62866936 CTTGGAAGCCACAGGGAACCAGG - Intronic
1069137110 10:64780839-64780861 CCTGAAAGGCAAAGAGAAACTGG + Intergenic
1069728402 10:70595817-70595839 CCTGGAGGGCAAACGGAAGGAGG + Intergenic
1070915967 10:80154906-80154928 CCTGAAAGGCAAAGGGATCTTGG - Exonic
1072519561 10:96219072-96219094 CCTCTGTGGCACAGGGAACCTGG + Intronic
1072671367 10:97432279-97432301 CCTGGAGGACAAAGTAAACCTGG + Intronic
1073453031 10:103620500-103620522 CCTGGCTGGCTGAGGGAACGGGG + Intronic
1074127244 10:110538693-110538715 CTGGGAAGGCAAAGGGAACTGGG + Intergenic
1074273920 10:111982958-111982980 CATGGATGGCAGAGGCAGCCAGG - Intergenic
1075146556 10:119887454-119887476 CCTCGAAGGCAAAGAGAAACTGG - Intronic
1076552241 10:131288809-131288831 CCAGGAAGGCAAAGGACACCAGG + Intronic
1081272078 11:41097122-41097144 CCTTGAAGGCATAGGAAACCTGG + Intronic
1081652411 11:44833182-44833204 CCTGGATGGACACGTGAACCTGG + Intronic
1083041073 11:59688117-59688139 CCTAGATGGCAAAGTGTACTTGG + Intergenic
1083268989 11:61561277-61561299 CCTGGAAGGCAGGGTGAACCAGG + Intronic
1083455878 11:62778298-62778320 CCTGGATGGCAAAGGGAACCTGG + Exonic
1083686965 11:64382340-64382362 CCAGTGGGGCAAAGGGAACCAGG + Intergenic
1083912464 11:65718250-65718272 CCGGGATGGCAAAGGAAAATTGG + Exonic
1084095769 11:66910203-66910225 CCTGGGTGACAAACAGAACCAGG + Intronic
1084290370 11:68161724-68161746 CAGGGATGGAGAAGGGAACCAGG - Intronic
1090280122 11:125448550-125448572 CCTTCATGGCAAAGAGAACTAGG + Exonic
1092099144 12:5869000-5869022 CCTGGAGGGGAAGGGGAAGCTGG + Intronic
1092196852 12:6554995-6555017 CCTGGATGGCAGAGACAAGCCGG + Intronic
1092255427 12:6924545-6924567 GCAGGATGGCAGAGGGAGCCAGG - Intronic
1092406393 12:8224573-8224595 CTTGGATGGGAAAAGCAACCTGG + Intronic
1093421675 12:18981087-18981109 CGTGGATGGCAAAGAGAAAAGGG + Intergenic
1094104941 12:26801146-26801168 GCTGCATGGCAATGGGGACCTGG - Intronic
1095956779 12:47811249-47811271 CCTGGCTGCAAAAGGGAATCAGG - Intronic
1096252261 12:50040779-50040801 CCTGGATGGCAGAGGACAGCGGG + Intergenic
1096934378 12:55255265-55255287 ACTGGGAGGCAAAGGGAACGAGG + Intergenic
1097130539 12:56807998-56808020 CCTGTAGAGAAAAGGGAACCTGG + Intergenic
1101196405 12:102387412-102387434 CCTGTATGGAAGAGGAAACCAGG + Intergenic
1102127997 12:110501559-110501581 CCTAGATGGCAAAGTTAAACGGG + Intronic
1102823595 12:115927781-115927803 CCAGGATGGGGAGGGGAACCCGG + Intergenic
1102823599 12:115927804-115927826 CTTGGATGGCAGAATGAACCTGG - Intergenic
1103837928 12:123838750-123838772 ACCTCATGGCAAAGGGAACCAGG - Intronic
1104221226 12:126786753-126786775 CCTGGAATGCACAGGGCACCTGG + Intergenic
1104593647 12:130104629-130104651 CCTGGATCTCAAAGGGGACTGGG - Intergenic
1107803615 13:44133447-44133469 CCTGGTTGGGGAAGGGAGCCTGG - Intergenic
1108848842 13:54704209-54704231 CCTCAAAGGCAAAGGGAAACTGG - Intergenic
1109279497 13:60339641-60339663 GCTAGAGGGCAAAGGGACCCTGG + Intergenic
1110008199 13:70297731-70297753 CATGGATGGCCATGGGCACCCGG - Intergenic
1113357835 13:109600390-109600412 GATGGATGGCACAGGGAACAGGG - Intergenic
1114148058 14:20001662-20001684 TCTTGATGGCAAAGGGTACAGGG + Intergenic
1115779744 14:36756187-36756209 CCTGGGTGGAGAAGGGAAGCGGG + Intronic
1121516866 14:94558301-94558323 CCTGGATTCCAAATGGAGCCAGG - Intergenic
1121569662 14:94937478-94937500 CCTGGATATTAAAGGGAAACAGG + Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124794576 15:32764526-32764548 CCTGGATGTCATAAGGACCCAGG - Intergenic
1126012552 15:44316958-44316980 CCTGGGTGACAGAGGGACCCAGG + Intronic
1127373317 15:58360005-58360027 CCAGGACAGCAGAGGGAACCAGG - Intronic
1131409902 15:92198883-92198905 GATGGATGGCAAAGGGGAGCAGG - Intergenic
1131453853 15:92567924-92567946 GATGGATGGCAAAGGGGAGCAGG + Intergenic
1131567691 15:93501808-93501830 CCTGGATGCCAAGGGGAAGACGG - Intergenic
1131627993 15:94144641-94144663 GGTGGAAGGCAAAGGGAAGCTGG - Intergenic
1132595674 16:748216-748238 CCCGGGTGGCAGAGGGAACATGG + Intronic
1132622889 16:876005-876027 CCTGGGTGGCAGTGGGACCCGGG + Intronic
1132725934 16:1338391-1338413 CCTGGATGGCGCTGGGCACCTGG - Intronic
1133214845 16:4285764-4285786 CCAGGATTGCAAAGGCAGCCTGG + Intergenic
1134189648 16:12111360-12111382 CATGGAAGGCAAAGGGCAGCAGG - Intronic
1136009380 16:27353063-27353085 CCAGGCTGCCAAAGGAAACCAGG - Intronic
1139299847 16:65935670-65935692 TCTGGATGGCAAAGGGAAGAGGG - Intergenic
1140879548 16:79185517-79185539 CCTGGATGACAAATGGATCTTGG - Intronic
1141301697 16:82821934-82821956 AATGTGTGGCAAAGGGAACCAGG + Intronic
1141850227 16:86640115-86640137 CCTGGTGGGCCAAGGGCACCTGG + Intergenic
1141868756 16:86769870-86769892 CCTGGATGCCAAAGGTCACGTGG + Intergenic
1142279440 16:89140098-89140120 CCTGGATGGCACTGGGGTCCAGG + Intronic
1142303762 16:89274346-89274368 ACTGGGTGGCTAAGGGAACACGG - Intronic
1143964917 17:10750232-10750254 ACTTGATGGCAAAGGGAAGGGGG + Intergenic
1144710306 17:17397361-17397383 ACTGGCTGGGAAAGGGACCCAGG + Intergenic
1147657206 17:42097844-42097866 CCCCGATGGCCTAGGGAACCCGG - Intergenic
1147919065 17:43905558-43905580 CCAGGAAGGCAAAGGGAAGAAGG - Intronic
1150165320 17:62935827-62935849 TCTGTCTGGCAAAGGGGACCTGG - Intergenic
1151018131 17:70580682-70580704 GGTGGAAGGCAAAGGGAAGCAGG - Intergenic
1152459923 17:80437181-80437203 TCTGGCTGGGAAAGGGGACCAGG + Exonic
1152683717 17:81683562-81683584 CCGGGATGGGAAAGGCGACCTGG - Exonic
1154215881 18:12415830-12415852 CCTGGCGGGCTAAGGGAAGCTGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158548819 18:58417694-58417716 GGTGGATGGGAAAGGGATCCTGG - Intergenic
1160435117 18:78845670-78845692 CCAGGTGGGCAAAGGGACCCTGG - Intergenic
1160989417 19:1854410-1854432 CCTGGATGGCAGAAGCATCCTGG + Exonic
1163251518 19:16128795-16128817 CCTGACTAGAAAAGGGAACCTGG - Intronic
1165395686 19:35562467-35562489 CCTGGATGGCAAAGGCGATGAGG + Exonic
1165482624 19:36073707-36073729 TTTGGATGGGAAAGGAAACCTGG + Intronic
1166142962 19:40815195-40815217 CAGGGATGGCAAAGAGATCCTGG - Intronic
1166333424 19:42091535-42091557 CCTTGATGGCAGCGGGAATCTGG - Exonic
1167423025 19:49414887-49414909 CATAGTAGGCAAAGGGAACCAGG + Intronic
1167948734 19:53009904-53009926 CCTGCATGGAAAAGGGGACCTGG - Intergenic
1168072043 19:53958808-53958830 CCTGGATGGCAGAAGGTACCTGG - Intergenic
1168106455 19:54168471-54168493 GCTGGGTGGCAAAGGTGACCAGG + Exonic
1168304278 19:55426662-55426684 ACTGGGTGGGAAAGGGAAGCAGG + Intergenic
925518055 2:4707104-4707126 CCTGGATGGAAATGAGAAACAGG - Intergenic
927886472 2:26721606-26721628 GCTGGATGGCAGAGGGCAGCTGG - Intronic
929820441 2:45269187-45269209 CCTGGGTGGGAAAGGGGAGCAGG + Intergenic
930052358 2:47226198-47226220 CCTGGAGGGAAAAGGCAAGCAGG - Intergenic
930296408 2:49560143-49560165 CCTGGAAGGCAAAGGCATCCAGG + Intergenic
931932833 2:67160389-67160411 GCTGAATGTCAAAGAGAACCAGG + Intergenic
932435921 2:71702517-71702539 CCTTGAGGGCCAAGGGACCCTGG + Intergenic
932616781 2:73236844-73236866 CCTGCAAAGCATAGGGAACCTGG + Intronic
938070504 2:128305835-128305857 CCAGGATGGTGCAGGGAACCTGG - Intronic
938592296 2:132751302-132751324 GCTGGAAGGCAAAGGGAAGCAGG - Intronic
941578355 2:167264560-167264582 CCTGGCTGGCAATGGGCACAAGG + Intergenic
941983193 2:171482893-171482915 CCTGGATGGCATTTGGACCCTGG - Exonic
946895588 2:224320001-224320023 CCTGGATGCCAAAGGCGAACCGG - Intergenic
947458959 2:230285849-230285871 CCTGTAGGGCAAAGGGAAAGCGG - Intronic
947840915 2:233207509-233207531 CGAGGAGGGCACAGGGAACCTGG - Exonic
949007483 2:241658007-241658029 CCTTGGTGCCAAAGGGTACCTGG - Intronic
1169151156 20:3290744-3290766 CTTGGAGGGCACAGGCAACCAGG - Intronic
1169260747 20:4136288-4136310 CCTGGAGGGCGCAGGGCACCTGG + Intronic
1171142038 20:22751631-22751653 TCTGGAGGGCAATGGGAACTGGG + Intergenic
1172446318 20:34995314-34995336 CCTGGAGGGCACACGGAACGGGG - Exonic
1174241056 20:49135005-49135027 CCTGGACAGCGAAGGGAGCCCGG + Intronic
1175887676 20:62302110-62302132 CCTGGATGGGAAAGGCCACAGGG - Exonic
1178015926 21:28346119-28346141 CATGGATGGCAAAGGGGAACTGG - Intergenic
1180135181 21:45857862-45857884 CCTGGATGGGATGGGGAAACAGG + Intronic
1181635565 22:24172850-24172872 CCTGGGTGGCAGGTGGAACCTGG - Intronic
1183465381 22:37977785-37977807 GCTGGATGGCAATGAGACCCTGG - Intronic
1183664786 22:39241080-39241102 GCTGGATGGCAAAGGGCAGTGGG + Intronic
1184057601 22:42062844-42062866 CCTGGATGCCTAAGGGATCCTGG + Exonic
1184112696 22:42404499-42404521 GCTGGAAGGGAAAGAGAACCCGG - Intronic
1184188208 22:42878349-42878371 GCAGGAAGGCCAAGGGAACCTGG + Intronic
1184832306 22:46996509-46996531 CTTACATGGCAAGGGGAACCAGG - Intronic
1185038368 22:48490965-48490987 CCAGGATCGCAAGGGAAACCCGG + Intronic
949519512 3:4837036-4837058 TCTAGATGGAAAAGGGAGCCAGG + Intronic
949605831 3:5652493-5652515 CAGGGATGGCAAAGGGACCCTGG + Intergenic
950569907 3:13793420-13793442 CCTGGCTGGCACAGGGGCCCGGG - Intergenic
951245010 3:20330867-20330889 CCTTTGTGGCAAAGGAAACCGGG - Intergenic
951728430 3:25783945-25783967 CCCGGAGCGCAAAGGGATCCGGG - Intronic
952006181 3:28845087-28845109 TCCGGATGGCTCAGGGAACCAGG + Intergenic
953429810 3:42829839-42829861 CCTTGACTGCAAAGGGCACCGGG + Intronic
954292813 3:49658637-49658659 CCTGTGTGGCAATGGAAACCAGG - Intronic
954427631 3:50451742-50451764 CCTGGATGGTGACTGGAACCTGG + Intronic
954587213 3:51746288-51746310 CCTTGAAGGCAAAGAGAAACTGG - Intergenic
955187136 3:56725185-56725207 CCTCAATGCCAAGGGGAACCAGG + Intergenic
955337476 3:58098778-58098800 CGTGGAAGACAAAGGAAACCAGG + Exonic
956029738 3:65024626-65024648 GCTGGAAGGCAAAGGGAATGTGG - Intergenic
960593516 3:119387966-119387988 CCTGAATGACATGGGGAACCAGG + Intronic
960971893 3:123145781-123145803 CCTGGATGGGCACGGGAACATGG - Intronic
961648857 3:128407559-128407581 CCTGCCTGCCAAAGGGAGCCAGG + Intronic
961830294 3:129619765-129619787 CCTGGCGGGGAAGGGGAACCTGG - Intergenic
961871621 3:129992722-129992744 CCTGGAGGTCACAGGGACCCAGG - Intergenic
962100546 3:132337725-132337747 CCTGTATGGGGAAGGGAAGCAGG - Intronic
964421392 3:156507388-156507410 TCTGTAAGGCAAATGGAACCAGG + Intronic
967012111 3:185445456-185445478 ACTGGATGGCAAAAGCAACAGGG - Intronic
967183930 3:186929913-186929935 CCTGGATGGTGAAGGGAGCGAGG - Intergenic
967513310 3:190337842-190337864 CCTTTATGGCAAAGGAAGCCTGG + Intronic
969299420 4:6288884-6288906 CCTGGGTGACAAAGGGAAGTGGG + Intronic
969759742 4:9173410-9173432 CTTGGATGGGAAAAGCAACCTGG - Intronic
973266954 4:48220527-48220549 GGTGGAAGGCAAAGGGGACCTGG - Intronic
974328838 4:60450295-60450317 GCTGGATGGCAAAGGAAATATGG + Intergenic
976658695 4:87516666-87516688 CATGGAAGCCAAAGGGCACCCGG + Intronic
977811525 4:101361143-101361165 TCTAGATGGTAAAGGGAATCTGG + Intergenic
979677301 4:123423977-123423999 CCTGGTTGGCTGTGGGAACCTGG - Intergenic
979773250 4:124556049-124556071 CCCGCAAGGCGAAGGGAACCAGG + Intergenic
981938082 4:150255334-150255356 CCTGGCTGGGGAAGGGACCCCGG - Intronic
982701340 4:158661949-158661971 CCTGGAAGGCAAAGAGAAACTGG - Intergenic
983767245 4:171499596-171499618 TATGGAAGGCAAAGGGAAGCAGG - Intergenic
987069779 5:14325388-14325410 CATGGAAGGCAAAGGGGAGCCGG + Intronic
987073774 5:14361528-14361550 CCTGGATAACAGAGGAAACCTGG - Intronic
989001304 5:36763221-36763243 ACTGGAGGGTAAAGGGAACCCGG + Intergenic
990308241 5:54514879-54514901 GCTGGGTGGCAGAGGGCACCAGG + Intergenic
991443958 5:66680381-66680403 CCTGGAGGACAAAGGGAGTCAGG - Intronic
994649287 5:102506339-102506361 AATGGATAGCAAAGGGAATCAGG + Intergenic
994700086 5:103122558-103122580 GCAGGCTGGCAAAGGCAACCTGG - Intronic
994774671 5:104027024-104027046 CCTGGATGGTAATGGTAATCTGG - Intergenic
995990594 5:118234341-118234363 CCTGGATGGTTAAGGGAAATAGG - Intergenic
996299195 5:121961142-121961164 CCTGGATGACAAAGAGAGACTGG + Intergenic
997523513 5:134538228-134538250 CCTGGAAGGCTGAGGGAAACTGG - Intronic
997813851 5:136997409-136997431 GCTGGATGGAGAAGGGAACATGG - Intronic
998957188 5:147450770-147450792 CCAGGAAGGCAAAGGGTACCAGG + Intronic
999182127 5:149677172-149677194 CCAGGATGGGAAAGGGCTCCAGG + Intergenic
1000177926 5:158776547-158776569 ACTGAATGGAAAAGGAAACCTGG + Intronic
1000178062 5:158777770-158777792 CCTGGTTTGAACAGGGAACCTGG + Intronic
1001308179 5:170590890-170590912 GCTGGCTGGGAAAGGGAGCCTGG + Intronic
1002313593 5:178329417-178329439 CCTGGCTGGCAGGGGGAGCCTGG - Intronic
1006113565 6:31763263-31763285 CCTGGAGGGCAAGGGGAGGCAGG - Intronic
1007685452 6:43664870-43664892 CCTCGTTGACAAAGGGAGCCTGG + Intronic
1007850241 6:44795643-44795665 TTTGCATGGCAAAAGGAACCTGG - Intergenic
1010877552 6:81126276-81126298 CTAGGATGGCTAAGGGAACTTGG + Intergenic
1013586370 6:111582429-111582451 CCTGGATGACAAAGGAGACTGGG + Intronic
1014701939 6:124699658-124699680 GTTGGAAGGCAAAGGGAAGCAGG - Intronic
1017699532 6:157054949-157054971 ACTGAATGGAAAATGGAACCAGG - Intronic
1018745353 6:166757602-166757624 GCTGGACGGCAAGGGGAGCCCGG - Intronic
1019688232 7:2394462-2394484 CTTTGATGGCAAGGGCAACCTGG + Intergenic
1019892758 7:3959823-3959845 CCTGAATGGCAAAGGAAAAGGGG - Intronic
1019906692 7:4070289-4070311 CCTGGAAACCAAAGTGAACCGGG - Intronic
1023085035 7:36561884-36561906 CCTGAGTGGCAAAGGGACCCAGG - Intronic
1023629417 7:42148854-42148876 CCAGGCAGGCAAAGGGAAGCTGG - Intronic
1025874009 7:65462897-65462919 CCTGGGGGGCAAAGGAAACTGGG + Intergenic
1026772845 7:73213160-73213182 CCTGGGTGGCAGAGGGCAACTGG + Intergenic
1026940175 7:74283205-74283227 CCCGTATGGCCTAGGGAACCAGG + Intergenic
1027013709 7:74766557-74766579 CCTGGGTGGCAGAGGGCAACTGG + Intergenic
1027074329 7:75179475-75179497 CCTGGGTGGCAGAGGGCAACTGG - Intergenic
1032098093 7:128949564-128949586 CCTGGAAGGCAAAGCCAGCCAGG - Intronic
1032609194 7:133392665-133392687 CCTGGATGGGAAAGGGCTACTGG + Intronic
1034442239 7:151091738-151091760 CCTGGATGGAGCAGGGTACCAGG - Intronic
1034936216 7:155202639-155202661 CCTTGATGGCAGAGGGCCCCGGG + Intergenic
1035623271 8:1051131-1051153 CCTGGATGGGACAGGGCACAAGG + Intergenic
1036009790 8:4709206-4709228 CCTCGATGGTAGAAGGAACCAGG + Intronic
1036263335 8:7257141-7257163 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036264638 8:7264763-7264785 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036265937 8:7272385-7272407 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036267239 8:7280007-7280029 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036268542 8:7287629-7287651 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036269846 8:7295251-7295273 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036298047 8:7551803-7551825 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036299352 8:7559452-7559474 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036300657 8:7567101-7567123 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036301962 8:7574746-7574768 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036303260 8:7582395-7582417 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036315379 8:7715680-7715702 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036316683 8:7723328-7723350 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036317990 8:7730976-7730998 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036319297 8:7738624-7738646 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036320606 8:7746271-7746293 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036321916 8:7753919-7753941 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036323225 8:7761567-7761589 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036324524 8:7769214-7769236 CTTGGATGGGAAAAGCAACCTGG - Intergenic
1036351510 8:8015093-8015115 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036352818 8:8022739-8022761 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036354107 8:8030387-8030409 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036418932 8:8578200-8578222 CCTGGATTGTAAATGGATCCAGG - Intergenic
1036846768 8:12175512-12175534 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1036868133 8:12417831-12417853 CTTGGATGGGAAAAGCAACCTGG + Intergenic
1042005634 8:64177292-64177314 CCTGAAGGGAAAAGGTAACCAGG + Intergenic
1042426640 8:68656753-68656775 CCAGGAAGGCAGAGGGATCCAGG - Intronic
1045480301 8:102586378-102586400 TCTGGATGGCACAGTGAACATGG - Intergenic
1049581239 8:143412032-143412054 CCTGGATGGCAAAGTCCAGCAGG + Intergenic
1049691553 8:143963102-143963124 CCTGTATGTCACAGGGAGCCAGG - Intronic
1049806574 8:144543639-144543661 CCTGCATGGAAAAAGGAATCAGG - Intronic
1051898264 9:22010672-22010694 CCTGGACAGGGAAGGGAACCGGG + Intronic
1052019942 9:23514279-23514301 TTTGGAGGGCAAAGGGAACAGGG - Intergenic
1052171676 9:25406054-25406076 CCTGGATCCCAAAGGGAAGGTGG - Intergenic
1052279472 9:26716490-26716512 CCTGGATCGTGAAAGGAACCTGG + Intergenic
1053614896 9:39754668-39754690 ACTGGAGGGCACAGTGAACCAGG + Intergenic
1053873074 9:42513941-42513963 ACTGGAGGGCACAGTGAACCAGG + Intergenic
1054238621 9:62587722-62587744 ACTGGAGGGCACAGTGAACCAGG - Intergenic
1054261967 9:62875614-62875636 ACTGGAGGGCACAGTGAACCAGG + Intergenic
1054269256 9:62952811-62952833 ACTGGAGGGCACAGTGAACCAGG - Intergenic
1054552752 9:66622244-66622266 ACTGGAGGGCACAGTGAACCAGG - Intergenic
1056099650 9:83288863-83288885 CCAAGATGTGAAAGGGAACCTGG - Intronic
1056788806 9:89612040-89612062 TCTGGATGGGAAAGGGACTCGGG - Intergenic
1057916516 9:99059900-99059922 CCTGGAGGGCCAGGGGGACCTGG - Exonic
1059439921 9:114301154-114301176 CCAGGAAGGCAAGGGGACCCCGG - Intronic
1059535390 9:115075814-115075836 CCTGTATGGAAAAGGGGACTGGG - Intronic
1060406270 9:123374575-123374597 CTTGGATGGGACAGGCAACCTGG - Exonic
1060473825 9:123970550-123970572 CCTAGATGGCACAGGCAGCCTGG + Intergenic
1061750719 9:132775117-132775139 AGGGGATGGCAAAGGGACCCTGG + Intronic
1061952959 9:133946348-133946370 CCTTGCTGCAAAAGGGAACCTGG + Intronic
1062362035 9:136192899-136192921 CGTCGCTGGCAGAGGGAACCCGG - Intergenic
1186299519 X:8184380-8184402 CCTGGATGGCCAGGAGAACCTGG + Intergenic
1188097722 X:26044087-26044109 CCTCGAAGGCAAAGAGAAACTGG - Intergenic
1192412554 X:70947257-70947279 GGTGGAAGGCAAAGGGAAGCAGG + Intergenic
1192716184 X:73644770-73644792 CCTGGATGACAGACGGCACCTGG - Intronic
1193695980 X:84708132-84708154 CCTGCATAGAAAAGGGAACTTGG + Intergenic
1195378610 X:104250657-104250679 CCTGGGTGGCATAGGGACCATGG + Exonic
1196127159 X:112112825-112112847 CCTTGAAGGCAAAGAGAAACTGG + Intergenic
1197990530 X:132312363-132312385 TCTGGATGGGTAAGGTAACCAGG - Intergenic
1198116420 X:133549269-133549291 CCTGGATGGCAATGGGCCCCTGG - Intronic
1198159144 X:133989745-133989767 CCTGGAGGGCAAAGGAAACTGGG - Intergenic
1199484612 X:148334322-148334344 GCAGGAGGGCAAAGGAAACCTGG - Intergenic
1199672173 X:150156322-150156344 ACTGGATAGAAAAGGGTACCAGG - Intergenic
1199975081 X:152890005-152890027 CTTGGATGGCAGAGGGAATGAGG + Intergenic
1200059464 X:153477807-153477829 CCTGGATGGCGAGGGTACCCTGG + Intronic