ID: 1083457135

View in Genome Browser
Species Human (GRCh38)
Location 11:62786814-62786836
Sequence CCGGGCGGCCGCGGAGCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083457135_1083457148 12 Left 1083457135 11:62786814-62786836 CCCACGGCTCCGCGGCCGCCCGG 0: 1
1: 0
2: 0
3: 32
4: 282
Right 1083457148 11:62786849-62786871 GCCGGCGGCAGCCCCGGACTCGG 0: 1
1: 0
2: 2
3: 18
4: 202
1083457135_1083457147 6 Left 1083457135 11:62786814-62786836 CCCACGGCTCCGCGGCCGCCCGG 0: 1
1: 0
2: 0
3: 32
4: 282
Right 1083457147 11:62786843-62786865 GAAGGAGCCGGCGGCAGCCCCGG 0: 1
1: 0
2: 2
3: 55
4: 515
1083457135_1083457146 -3 Left 1083457135 11:62786814-62786836 CCCACGGCTCCGCGGCCGCCCGG 0: 1
1: 0
2: 0
3: 32
4: 282
Right 1083457146 11:62786834-62786856 CGGGGACAAGAAGGAGCCGGCGG 0: 1
1: 0
2: 2
3: 16
4: 265
1083457135_1083457143 -6 Left 1083457135 11:62786814-62786836 CCCACGGCTCCGCGGCCGCCCGG 0: 1
1: 0
2: 0
3: 32
4: 282
Right 1083457143 11:62786831-62786853 GCCCGGGGACAAGAAGGAGCCGG 0: 1
1: 0
2: 2
3: 24
4: 269
1083457135_1083457150 17 Left 1083457135 11:62786814-62786836 CCCACGGCTCCGCGGCCGCCCGG 0: 1
1: 0
2: 0
3: 32
4: 282
Right 1083457150 11:62786854-62786876 CGGCAGCCCCGGACTCGGTGCGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083457135 Original CRISPR CCGGGCGGCCGCGGAGCCGT GGG (reversed) Exonic
900152077 1:1183117-1183139 CAGGGCCGCCGAGGAGCCCTTGG + Intronic
900240688 1:1615963-1615985 CCTGGCCGCCGCTGAGCAGTCGG + Intronic
900349542 1:2228149-2228171 CGGGCGGGCCGCGGAGCCGGCGG + Intergenic
900513465 1:3070724-3070746 CCGGGCGGGCCCCGAGCCGAGGG - Intronic
901007910 1:6180504-6180526 CCGCGCGCCCGCGGACCCGACGG + Intergenic
901109552 1:6784686-6784708 GCGGGCGGCGCCGGGGCCGTGGG + Intergenic
901433994 1:9235078-9235100 CGGGGCGGCGGCGGGGCCGGCGG - Intronic
901641342 1:10694603-10694625 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
906615840 1:47232256-47232278 CCGGGCGGGCGCGGGGCGGGCGG - Intergenic
906627011 1:47333795-47333817 CCGGGCGTCCGCGGCCCTGTCGG - Exonic
908128201 1:61050699-61050721 CCGCGCGGCCGCTGTCCCGTGGG - Intronic
908293107 1:62687938-62687960 CCGGGCCGCCGAGGAGCAGGAGG + Intronic
910759020 1:90717639-90717661 CCGGGCGGCAGCGGTGGCGGCGG + Intergenic
912174741 1:107141414-107141436 CCGGGCGGGAGCCGAGCCGACGG - Intronic
914286158 1:146228802-146228824 CCAGGCGGCCGCGGCGGCGGCGG - Exonic
914342464 1:146771625-146771647 CCGGGCTGCCGAGCTGCCGTGGG - Intergenic
914702935 1:150150347-150150369 CCAGGCCGCCGCGGCGCCGACGG - Intronic
914889723 1:151612149-151612171 CCGGGAGGCCTTGGAGGCGTAGG + Exonic
915936761 1:160094115-160094137 CCTGGCGGCCTCGGGGCCCTGGG + Exonic
916666931 1:166975351-166975373 GCGGGCGGCGGCGGAGCGGCGGG + Intronic
921046126 1:211479173-211479195 CCAGGCTGCCGCGGGGCCGCAGG + Exonic
922502953 1:226110287-226110309 CCAGGCGGCAGAGGAGCCGGGGG - Intergenic
922674486 1:227542312-227542334 CCAGGCGGCCCTGGAGCCCTGGG + Intergenic
922705617 1:227788633-227788655 CCGGGCGGCGGAGGAGCGGAAGG + Intergenic
922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836030 1:228625012-228625034 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837707 1:228631735-228631757 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839944 1:228640672-228640694 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922841067 1:228645144-228645166 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
1064354399 10:14604311-14604333 TCGGGCCGCCGCCGAGCAGTCGG - Intronic
1064443207 10:15371357-15371379 CCTGGCGGCTGCGGCGCCGAGGG + Intergenic
1065636728 10:27742526-27742548 CGGGGCGCCCGGGGAGCCGCCGG + Intronic
1069424724 10:68279148-68279170 CCGGACCGCCGCGGGGCCATGGG + Intergenic
1073061352 10:100735608-100735630 CCGGGCGGCGGCGGCGGCGAAGG + Intronic
1073290074 10:102409139-102409161 CCGGGCGGCCCGGGGGCCGAGGG - Intronic
1073363523 10:102918658-102918680 GCGGGCGGCTGCGCAGCGGTGGG + Exonic
1074592051 10:114822268-114822290 CTGGGCGGCCGCCGGGTCGTGGG + Intronic
1075032129 10:119030394-119030416 CCGGGCGGCCGCCGCCCCGGAGG - Exonic
1075572957 10:123558705-123558727 CAGGGAGGCCGTGGAGCCCTGGG + Intergenic
1075587158 10:123666312-123666334 CCGGGCGGCGGCGGCGCCGAGGG + Intergenic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1077028402 11:451898-451920 CCGGGTGGCTGCGGGGCCCTCGG + Intronic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077121146 11:909177-909199 CCGAGCGGCCGGTGAGCAGTGGG - Intronic
1077976491 11:7252680-7252702 CGCGGCGGCCTCGGAGCCGTGGG + Intronic
1078067938 11:8090136-8090158 ATGGGCGGCCCCGGAGCCGGCGG + Exonic
1081672628 11:44950363-44950385 GAGGGCGACCGCGGAGCCGGGGG + Intronic
1081899636 11:46617119-46617141 CCTGGCAGCCGCGGAGAGGTGGG - Exonic
1083436326 11:62646160-62646182 CCGAGGGGCCGCGGGGCCGCAGG + Intronic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084387745 11:68854790-68854812 CAGGGCGCCCGCGCAGCCGCGGG + Intergenic
1084972998 11:72781603-72781625 CCGGGCGGGCGCGGGGCGGGTGG + Intronic
1085197927 11:74683511-74683533 CCGGGCGGCGGCGGCGCTGGCGG - Intergenic
1091558773 12:1594712-1594734 CCGGACGGCCGCGGCGTCCTTGG - Intronic
1094025873 12:25959054-25959076 CTGGGCGGCCGCGGAGCTCCGGG + Exonic
1094041189 12:26122909-26122931 GGGGGCGGCCGCGGACCCGGCGG + Exonic
1095349147 12:41188782-41188804 CCCCGCGGCTGCGGAGCCGGCGG - Exonic
1096101236 12:48971609-48971631 CCCGGCGGCCGCGGCGGCGCTGG - Exonic
1096459502 12:51814473-51814495 CCGGGCGGCCGCTGCGCCGCAGG + Intergenic
1097232820 12:57522710-57522732 CCGGGCAGCGGCGGAGGCGGCGG + Intronic
1098105960 12:67069306-67069328 CCGGGCGGCGGCGGCGGCGGCGG + Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103308923 12:119989328-119989350 TGGGGCTGCCGCGGAGCCGGGGG + Intergenic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1103856556 12:123973836-123973858 CCGGGCGGCTGCGGAGGAGCCGG + Exonic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1105368468 13:19782323-19782345 CGGGGTGGCCGCGGGGTCGTGGG - Intronic
1105577943 13:21670432-21670454 CCCGGCGGCCGCAAAGCAGTCGG - Intergenic
1105809331 13:23980339-23980361 CCGGGCGACGGAGGAGCCGCGGG + Intronic
1106087640 13:26557746-26557768 CCGGGCGGCCGCGGCGCGGCGGG + Exonic
1107549036 13:41457954-41457976 CCGGGCGCGCGCGGAGCTGGTGG - Intronic
1107851336 13:44576276-44576298 CAGGGCGGCCGGGGACCCGAAGG + Exonic
1107940750 13:45378569-45378591 CCGGGCGGCATCGGACCCGTCGG + Intergenic
1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG + Intronic
1110860515 13:80341036-80341058 CCGGGCGGGCGCGGGGGCCTGGG + Intergenic
1112091897 13:96091108-96091130 TCGGGGGGCCGCGGCGCCGGAGG + Exonic
1112507131 13:99981888-99981910 CCAGGCGGCGGCGGAGGCGGCGG + Exonic
1112563309 13:100532499-100532521 CCGAAAGGCTGCGGAGCCGTGGG + Exonic
1112734367 13:102400527-102400549 GGGGGCGGCCGCGGAGCTGTGGG - Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113201068 13:107867601-107867623 GCGGGCGGCGGCGGGGCCGCGGG + Intergenic
1113656097 13:112068488-112068510 GGCGGCGGCCGCGGCGCCGTAGG - Exonic
1113660912 13:112105709-112105731 CCAGGCGCCGGAGGAGCCGTCGG + Intergenic
1114270674 14:21098321-21098343 GCGGGCGGCGGCGGAGCGGGCGG + Exonic
1116003263 14:39266887-39266909 TCGGGCGGCCGCGGTGGCGGCGG - Intronic
1119808540 14:77498416-77498438 CCGGGCTGCCGCGGACCAGCCGG - Intronic
1121221371 14:92288144-92288166 CCGGGCTGGGGCGGAGCTGTGGG + Intergenic
1122162232 14:99793147-99793169 CCGGGCGGCCTGGGAGCCGCAGG - Intronic
1122445016 14:101761779-101761801 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
1122719695 14:103715362-103715384 CCGGGCGGCAGCGGGGTCGGAGG - Intronic
1123706833 15:22956709-22956731 CGGGGCGGCAGTGGGGCCGTGGG - Intronic
1126163557 15:45635086-45635108 CCGGGCGTGAGCGGAGCCTTCGG - Exonic
1126467688 15:48975924-48975946 CGGGGCGGCCGCGGAGCTGGCGG - Intergenic
1127144085 15:56007193-56007215 CCGGGCGGCGGCGGCGGCGGTGG + Intergenic
1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG + Exonic
1128269139 15:66293562-66293584 CCCGGCGGCCGCGGAGTGGCGGG - Exonic
1128322628 15:66703696-66703718 CGGGGCGGCCCTGGAGCCGGCGG + Exonic
1129262144 15:74374424-74374446 CGGGGCGGGCGCGGACCCGGAGG + Intergenic
1129752782 15:78077571-78077593 GGGGGCGGCCGCGGAGCCCGGGG - Exonic
1131257316 15:90871365-90871387 CCGGGCGGCCGCGAGGACTTTGG + Intronic
1131825838 15:96322186-96322208 GCGGGCCGCCGCGGGGCCGAGGG - Intergenic
1132365060 15:101251321-101251343 CGGGGCTGGCGCGGCGCCGTGGG + Exonic
1132724362 16:1332480-1332502 CCGGGGGGCCGCTGCGCCCTCGG + Intergenic
1132789002 16:1674608-1674630 CAGGGCTGCTGCGGAGTCGTGGG + Exonic
1133232232 16:4372186-4372208 CTGGCCGGCCGCGGGGCTGTCGG - Intronic
1133784544 16:8963955-8963977 GCGGGCGGGCGCCGAGCCGGAGG + Intronic
1135047582 16:19168107-19168129 CGGGGCAGCCGTGGAGCCGAGGG - Intronic
1136365174 16:29806408-29806430 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1136485584 16:30570015-30570037 CCGGGGGGCGGCGGGGCCGGAGG - Exonic
1136590400 16:31214855-31214877 CCGCGTGGCCGGGGAGCCGGCGG + Exonic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1139991523 16:70943700-70943722 CCGGGCTGCCGAGCTGCCGTGGG + Intronic
1141697625 16:85627666-85627688 CCGGGGGGCCGGGGGGCCGGGGG - Intronic
1141839719 16:86567008-86567030 GCGGGCGGCCGCGGACCCAGCGG - Intergenic
1142136282 16:88453352-88453374 CCGAGCGGCCGCGGCGGCGGCGG + Exonic
1142136332 16:88453512-88453534 CGGGGCGGCCGCGGAGACCGGGG + Exonic
1142343419 16:89538481-89538503 CCGGGTGGACGAGGAGCCCTGGG + Intronic
1142810381 17:2393183-2393205 CCGCGGAGACGCGGAGCCGTAGG - Intronic
1143497210 17:7319071-7319093 CCTGGCTGCTGCGGGGCCGTGGG - Exonic
1144021163 17:11241065-11241087 CCGGGCGGCGGCGGCGGCGGCGG - Intergenic
1144656896 17:17042616-17042638 CCGGGCGGCGGCGGTGCGGGCGG + Intronic
1145828165 17:27893065-27893087 CCGGGCGGCCTCGGAGGAGCAGG - Intronic
1146181000 17:30698027-30698049 CCTGGCGGCCGCAGAGCAGCGGG + Intergenic
1147139661 17:38453963-38453985 CCCGCCGGCCGCGGAGCTGGTGG + Intronic
1147994870 17:44354920-44354942 CCGCCCGGCCGCCGAGCCTTCGG - Exonic
1150069782 17:62140594-62140616 CCGGGCGGCCGCAAGGCCGCAGG + Intergenic
1150239667 17:63621927-63621949 CCGCGCGCCCGCCGAGCCTTCGG + Intergenic
1151370712 17:73644799-73644821 CCGGCTGGGCGCGGAGCCGAGGG - Intergenic
1151783769 17:76265362-76265384 GCGGGCGGCGGCGGAGCGGGCGG + Exonic
1151836419 17:76585596-76585618 GCGGGCCGCCGGGGAGCCCTGGG + Intronic
1152245809 17:79184008-79184030 TCGGTCGGCCGCAGAGCCGGCGG - Intronic
1152575832 17:81140650-81140672 CCGGGGGACCGTGGGGCCGTGGG + Intronic
1152575919 17:81140901-81140923 CCGTGGGGCCGTGGGGCCGTGGG + Intronic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1154125598 18:11689620-11689642 CTGCGCGGCCTCGGAGCCGCCGG + Exonic
1155957497 18:31966232-31966254 CGTGGCGGCCGCGGCTCCGTTGG + Intergenic
1157848999 18:51030351-51030373 CTGGGCGGCCGCGGAGCCTAGGG - Exonic
1158601939 18:58863506-58863528 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1158939875 18:62397569-62397591 CCGGGGGGATGCGGAGCCATTGG - Intergenic
1159040707 18:63320459-63320481 CCGCGCGGCCGCGGCGCGGTGGG + Intergenic
1160147895 18:76379281-76379303 CCGGGCTGGCGCGCAGCCCTCGG - Exonic
1160507172 18:79433693-79433715 CCGGGGGGCCGTGAAGGCGTCGG + Exonic
1160566496 18:79789570-79789592 CCTGGGAGCAGCGGAGCCGTGGG - Intergenic
1160729291 19:633443-633465 CCGGGCGGCCGCAAGGCCGTAGG + Exonic
1160847853 19:1174185-1174207 CCGGCCGGGCGCGGAGCCCGCGG + Exonic
1160861200 19:1237834-1237856 CCCGGTGGCCGCGGAGCAGGCGG + Exonic
1160889699 19:1370774-1370796 CCGGGCGGCCCGCGAGCGGTCGG - Exonic
1160904594 19:1446270-1446292 CGGGGCGGCCGCGGCTCCATGGG + Intergenic
1162977598 19:14217552-14217574 CCTGGCGGCCGCAGAGCAGCGGG - Intergenic
1163027016 19:14518387-14518409 CTGGTCGGCGGCGGAGCCGGGGG - Exonic
1167048890 19:47067082-47067104 GGGGGCGGCCGAGGAGCCGGTGG + Exonic
1168073018 19:53963113-53963135 ACGGGCAGCCGGGGGGCCGTGGG - Exonic
1168350967 19:55675289-55675311 CGGCGGGGCGGCGGAGCCGTCGG + Intronic
924987767 2:287748-287770 CCGGGGGGGCGCGGAGCCCCGGG - Exonic
925292527 2:2757072-2757094 CCTGGCATCCGCGCAGCCGTGGG + Intergenic
929539875 2:42811120-42811142 CGGGGCGTCCGGGGAGCTGTGGG + Intergenic
933907947 2:86913982-86914004 CCGGGCGGCGGCGGCGGCCTCGG + Intronic
933907961 2:86914016-86914038 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933907986 2:86914080-86914102 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908006 2:86914129-86914151 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908033 2:86914206-86914228 CCGGGCGGCGGCGGCGGCCTCGG + Intronic
933908045 2:86914234-86914256 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908062 2:86914281-86914303 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908080 2:86914330-86914352 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908096 2:86914376-86914398 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908110 2:86914416-86914438 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908154 2:86914541-86914563 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908177 2:86914608-86914630 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908189 2:86914642-86914664 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908202 2:86914679-86914701 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908216 2:86914719-86914741 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908260 2:86914845-86914867 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908278 2:86914897-86914919 CCGGGCGGCGGCGGAGGCGGCGG + Intronic
933908290 2:86914931-86914953 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
934011418 2:87824710-87824732 CCGGGCGGCGGCGGCGGCCTCGG - Intronic
934011432 2:87824750-87824772 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011548 2:87825378-87825400 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011565 2:87825424-87825446 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011583 2:87825473-87825495 CCGGGCGGCGGCGGCGGCGACGG - Intronic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
936278723 2:111120773-111120795 GCCGGCGGCCGCGGCGCCGAGGG + Intronic
937917366 2:127105790-127105812 CCCGGCGGCCGCGCAGCGGGTGG + Intronic
938414529 2:131093341-131093363 CCGGGAGGCGGCGGAGACGCGGG - Exonic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941111687 2:161423875-161423897 CGCGGCGGCCGCGGCGCTGTTGG - Exonic
941367081 2:164621737-164621759 CTGGGCGGCCCCGGCGCCGCTGG + Exonic
943786379 2:191882243-191882265 CCGGGCGGTGGCGGAGCCGGGGG - Intergenic
946322245 2:218960851-218960873 CCTGGCGGCCGAGGAGGCGGCGG - Exonic
948724950 2:239928910-239928932 CCGGGTGGCCGCGGGGCGATGGG - Intronic
948823743 2:240564327-240564349 CTGGGCGGCCGTGGTGCCGTGGG - Intronic
1169557567 20:6767516-6767538 CCGGGCAGCCGCGGCGGGGTGGG - Intergenic
1171013810 20:21522638-21522660 GCGGGCGGCTGCGGAGTCGCGGG + Intergenic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172118587 20:32585085-32585107 TCGGGCGGCGGCGGCGGCGTTGG + Intronic
1172568870 20:35953765-35953787 CCGTGCGGCGGCGGATCCGCCGG + Exonic
1175715774 20:61253256-61253278 CCGGGCGGGCGCGGCGCGGGAGG + Intronic
1176207107 20:63895196-63895218 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1176237982 20:64063152-64063174 GCGCGCGGCCGCGGGGCCGAGGG + Exonic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178417090 21:32412738-32412760 GCGGGGGGCCGCGGAGCCGCTGG + Exonic
1179631805 21:42683546-42683568 CCAGGCGGCCCCGGAGGCCTGGG - Intronic
1179674908 21:42974752-42974774 CCGGGCGGCAGCGGCGGCGGCGG - Intronic
1180014640 21:45074389-45074411 GCGGACGGGCGCGGGGCCGTTGG - Intronic
1181312341 22:21952297-21952319 TTGGGAGGCCGCGGAGCCGGGGG + Intronic
1182321334 22:29480093-29480115 CCGGTCGGCCGGGGGGCCGCAGG + Intergenic
1182663980 22:31944329-31944351 CCGGGCGGCGGCGGCGGCGGTGG + Intronic
1183708193 22:39487766-39487788 CCGCCGGGCCGAGGAGCCGTTGG - Exonic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
1184767033 22:46577397-46577419 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
950153843 3:10708045-10708067 GCGGGCGGCGGCGGGGCCGCGGG - Intergenic
950530343 3:13549293-13549315 CCGAGGGTCCGCCGAGCCGTCGG - Intronic
950583489 3:13878167-13878189 CGGGGAGGCCGCGGCGCCGGCGG + Intronic
951080293 3:18444671-18444693 CCGGGCGGGCGCGCCGGCGTCGG + Intronic
954384306 3:50236305-50236327 CCGGGCGGCGGCCGGGCCGGCGG + Exonic
955769245 3:62372546-62372568 GCGGGCGGCGGCGGAGGCGGCGG - Exonic
960664219 3:120094382-120094404 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
961551647 3:127673157-127673179 CTGGGCGGCCGCGGAGAGGCGGG + Intronic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
961913500 3:130345857-130345879 TCGGGCGCCCGCGGCGCAGTTGG - Exonic
968653841 4:1770350-1770372 CCGGGCTGCCGCGGGGCCCAGGG - Intergenic
968659632 4:1793694-1793716 CCAGGCGGCCCGGGAGCCCTGGG + Intronic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968803196 4:2756304-2756326 CCGGGAGGCCGCGCGGCCGCCGG + Exonic
969436594 4:7192617-7192639 AGGGGCGGCAGCGGAGCCGGCGG - Exonic
969531868 4:7734788-7734810 GCGGGCGGCCGAGGAACCCTGGG - Intronic
969597833 4:8158897-8158919 CCGGGCGGCAGCGGGGGCGCGGG - Intergenic
970333010 4:15003721-15003743 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
972740363 4:41881755-41881777 CCGCGCGGCTGCGGCACCGTGGG - Intergenic
973293326 4:48490700-48490722 CCGGCCGGCCCCGGGGCCGAGGG + Exonic
973718726 4:53702563-53702585 CAGGGCGGCCGGGGAGCCCTGGG + Intronic
973945341 4:55949152-55949174 CCGGGAGGCCGCGCGGCCGCGGG + Intronic
975778963 4:77819611-77819633 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
986449490 5:7850759-7850781 GCGGGCGGCCGCGGAGGGGCGGG - Intronic
987132391 5:14871814-14871836 CCGGGCGGCGGCGGCGGCGGCGG - Intergenic
987374017 5:17217834-17217856 CCGCGCCGCCGCGGACCCGGGGG + Intronic
989011591 5:36877399-36877421 CTGGGCGGCCGGGGAGGCGTAGG + Intronic
989576459 5:42992664-42992686 CCGGGCGGCGGCGGCGGCGCTGG + Intergenic
990148398 5:52788359-52788381 CTGGGCGGGCGCGGGGCCGAGGG - Exonic
990825431 5:59893357-59893379 CCGGGCGGCGGCGGGGGCGGCGG + Exonic
990955026 5:61332324-61332346 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
991298164 5:65103019-65103041 CCCGGCGGCCGCCGAGGCGAGGG - Intergenic
996948182 5:129094766-129094788 CATGGCGGCTGCGGAGCCGGCGG + Exonic
997653009 5:135536029-135536051 CCGGGCTGCCGCGGGGGCGGAGG - Intergenic
998797477 5:145835306-145835328 CCGGGCCTCTGCGGAGCCCTGGG - Intronic
1002021214 5:176365561-176365583 CCCAGCGGCCGCGGCGCCATCGG - Exonic
1002817327 6:693075-693097 GCTGGCGGCCGCGGAGTCTTCGG - Exonic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1010379053 6:75205896-75205918 CCTGGCGGCCGCCGAGGCGTGGG + Exonic
1011277446 6:85643774-85643796 CTACGCGGCCGCGGAGCCGGGGG - Intronic
1011734251 6:90296380-90296402 CGGGGCGGGCGGGGAGGCGTGGG - Intronic
1013225587 6:108117852-108117874 CCGGCCGGCCTCGGGGCGGTGGG - Intronic
1014137656 6:117907614-117907636 CCGGGCGGCCGCGGCCCGGGAGG - Exonic
1015625937 6:135181192-135181214 CAGGGCGACCGCGGAGGCGGCGG + Intergenic
1017877570 6:158536977-158536999 CCGGCCGGGCGCGGAGCCTACGG + Intronic
1018494634 6:164337248-164337270 ACGGGCGCCCACGGAGCAGTTGG - Intergenic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1020089925 7:5333242-5333264 CCGGGCAGCCGAGGCGGCGTAGG - Intronic
1020418223 7:7969477-7969499 GCGGGCGGCGGCGGCGGCGTGGG + Exonic
1022095689 7:27139681-27139703 CCTGGGGGTCGCGGAGCCCTGGG - Intronic
1022099451 7:27160652-27160674 CTGGGCGGCCGCGGACCCCGCGG + Intergenic
1022363354 7:29684996-29685018 CGGGGCCGCCGCGGCGCCGCCGG + Intergenic
1023945151 7:44797002-44797024 CGGGGCGGCTGCGAGGCCGTTGG + Intronic
1025829832 7:65038832-65038854 CGGGGCGGACGCGGAGCGGTCGG + Intergenic
1025917087 7:65873832-65873854 CGGGGCGGACGCGGAGCGGTCGG + Intronic
1027202505 7:76072646-76072668 CCAGGCCGCCGGGGAGCCGAAGG + Intergenic
1029849328 7:103446065-103446087 GCGGGCGGCCGCGGGGCCGGGGG - Intronic
1033253188 7:139777817-139777839 CCGGGCGGCAGCGGCGGCGGCGG - Intronic
1034174475 7:149090329-149090351 CCGGGCGGACGGGGAGCGGACGG - Intronic
1034197944 7:149262365-149262387 CCGGGCGTCCGCGGGGCCGAGGG - Intronic
1034680765 7:152925761-152925783 CCGGAGGCCCGCGGAGCTGTGGG + Intergenic
1035171158 7:157018115-157018137 CCGCTCGGCCGCGGAGGCCTGGG - Intergenic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1035435550 7:158856699-158856721 CCGGGCGGCCGCGGTGTCCTCGG - Exonic
1043502955 8:80874322-80874344 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1046736065 8:117777821-117777843 CCGGGCGGCTGCGGGGCAGAGGG - Intergenic
1048072986 8:131040792-131040814 CCCTGCAGCCGCGGAGCAGTGGG - Exonic
1049693751 8:143973738-143973760 CCGGGCGACCGCGGTGTCGGCGG - Intronic
1049789542 8:144466485-144466507 CGCGGCGGCCGCGGAGCCCGGGG + Exonic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1052872796 9:33524210-33524232 CCGGGCTGGCGCTGAGCTGTAGG + Intergenic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053055158 9:34989674-34989696 CGGCGCGGAGGCGGAGCCGTGGG + Exonic
1053188214 9:36036969-36036991 CCGGGCGGCTCCAGAGCCGCGGG - Exonic
1053372659 9:37576010-37576032 CCGGGGGACCGCGGAGCCGCGGG + Intronic
1055514311 9:77020756-77020778 ACGGGCGGCAGCGCAGGCGTGGG - Exonic
1057198451 9:93127843-93127865 CCGGGAGGCCGGGGTGCCGCAGG + Intronic
1058053285 9:100427253-100427275 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1059234500 9:112750690-112750712 CCGGGCGGCCGCGGCGCCTCGGG + Intergenic
1060209020 9:121699215-121699237 CTGGGCGGCCGCGCGGCCGAGGG - Intronic
1060979824 9:127785691-127785713 CCCGGCGGAGGCGGCGCCGTCGG + Intronic
1061072931 9:128322885-128322907 CCGGGAGCCCGCAGAGCCGACGG - Exonic
1062040550 9:134402411-134402433 CCAGGCGCCCACAGAGCCGTGGG - Intronic
1062332718 9:136051594-136051616 GCGGGCGGCCGCAGAGGCGCCGG + Intronic
1189244858 X:39555522-39555544 CCCTGCTGCCGAGGAGCCGTAGG + Intergenic
1189534637 X:41923623-41923645 CCGGTCGGCTGCTGAGGCGTAGG - Intergenic
1198767100 X:140091363-140091385 CTGGGAGGCCGCGGCGCCATGGG + Intergenic
1199612731 X:149631762-149631784 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic
1200100743 X:153688275-153688297 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1200218409 X:154378925-154378947 CCGCGCGGGCGCGGAGCAGAAGG - Intergenic