ID: 1083458641

View in Genome Browser
Species Human (GRCh38)
Location 11:62796394-62796416
Sequence CAGGTGTGCCCTGTATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083458641 Original CRISPR CAGGTGTGCCCTGTATCTGC TGG Intronic
900697017 1:4018863-4018885 CAGGTTTGCCCTGAGTCAGCAGG + Intergenic
901089557 1:6632335-6632357 CAGGAGGGCCCTGCATGTGCAGG + Intronic
903371581 1:22839645-22839667 CATGTTTGCCATGTATTTGCTGG - Intronic
905167900 1:36093838-36093860 CAGGTGTGACCTAGATCAGCTGG - Exonic
905252176 1:36656523-36656545 CTGGTCTGGCCTGTACCTGCTGG + Intergenic
907653353 1:56317905-56317927 CAGGGGTGCCCTGAGCCTGCTGG + Intergenic
909412679 1:75373640-75373662 CAGATGTGCCCTGCTCCTGCAGG - Intronic
909919938 1:81368506-81368528 CATATTTGCCATGTATCTGCTGG + Intronic
911152518 1:94609004-94609026 CAGTTGTGTCCTGGAGCTGCAGG + Intergenic
911565993 1:99464110-99464132 CACGTGAGCCCTGTAGTTGCTGG - Intergenic
913191386 1:116416129-116416151 AAGGTGAGCCCTTTCTCTGCAGG - Intergenic
916040929 1:160960835-160960857 CAGGAATGGCCTGCATCTGCAGG - Intergenic
918444459 1:184603167-184603189 CAGCTGGGCCCTGGATCTGACGG - Intronic
918971498 1:191425819-191425841 CAGGCTTCCCATGTATCTGCTGG + Intergenic
919790731 1:201289150-201289172 CAGGAGTGGACTGTGTCTGCGGG - Intronic
920036473 1:203068826-203068848 TAGGTGTGCTCTGTATGTGAAGG - Intronic
922515956 1:226208558-226208580 CAGTTATGCCCTGGCTCTGCTGG - Intergenic
1063128350 10:3155084-3155106 CAGGTGTGCCCTGTGGCTCTGGG - Intronic
1063490499 10:6459416-6459438 CATGTGTGCTCTGGATGTGCAGG - Intronic
1065793181 10:29280491-29280513 CAGGAGGGCCCCGTCTCTGCTGG - Intergenic
1065821893 10:29533237-29533259 GCGGTGTGACCGGTATCTGCGGG + Exonic
1072443919 10:95481261-95481283 CAGGTGTGGCCTGGATGTGTAGG - Intronic
1075022739 10:118963552-118963574 CCGGGGTGCCCAGTGTCTGCGGG - Intergenic
1076489293 10:130846009-130846031 CAGGTGAGCCCTGGACCTACTGG + Intergenic
1076600668 10:131654990-131655012 CAGGCCTGCCCTGCACCTGCGGG - Intergenic
1077288224 11:1777085-1777107 GAGGTGTCCCCTGGGTCTGCAGG + Intergenic
1077326918 11:1967921-1967943 CAGGAATGCCCTTTATCTGAGGG + Intronic
1077392865 11:2308093-2308115 CAGGGGTGCCCTGCCCCTGCTGG + Intronic
1077543680 11:3159658-3159680 CAGGTGCACCCTGTCTCTGCCGG - Intronic
1079364061 11:19793751-19793773 CTGGAGTGCCCTGTATCATCTGG + Intronic
1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG + Intronic
1081958095 11:47111166-47111188 GATGAGTGCCATGTATCTGCTGG - Intronic
1083458641 11:62796394-62796416 CAGGTGTGCCCTGTATCTGCTGG + Intronic
1085625704 11:78070876-78070898 CATGAGTTCCCTGTGTCTGCAGG - Intronic
1086932376 11:92706493-92706515 CAGGTAGGCCCAGTATCAGCAGG + Intronic
1087501270 11:98957497-98957519 CAGGTGTTCCCTGGATATCCTGG + Intergenic
1089629977 11:119778476-119778498 CAAATGTGCTCTGTATCTGGTGG - Intergenic
1089895462 11:121926341-121926363 CAGCTGAGCCCTGTTCCTGCTGG - Intergenic
1090089768 11:123684840-123684862 CAGGTGTGGCATGTATCAACAGG + Intergenic
1202809900 11_KI270721v1_random:23101-23123 CAGGAATGCCCTTTATCTGAGGG + Intergenic
1096992510 12:55816880-55816902 CGGGTGGGCCCTGCATCTCCTGG - Intronic
1097200246 12:57272398-57272420 CATGTGTGGCCTGTATCTGTAGG - Intronic
1101542638 12:105678820-105678842 CAGATGTGCCCTTAATCTGGTGG + Intergenic
1102020664 12:109680068-109680090 CAGGCTTGCTCTCTATCTGCCGG - Intergenic
1103250311 12:119494341-119494363 GAGGTGTGTGCTGTACCTGCTGG - Intronic
1103716538 12:122948600-122948622 TAGGCCTGCCCTGTCTCTGCTGG - Intronic
1104820711 12:131675772-131675794 CAGGTGTGGGCTGGATTTGCAGG + Intergenic
1105574809 13:21640458-21640480 CAGGAGAGCCCTGTATCTTCAGG + Intergenic
1112564757 13:100543903-100543925 CTGGTGGGCCCAGGATCTGCTGG - Intronic
1112589662 13:100751524-100751546 GTGCTGTGCCCTGTGTCTGCAGG + Intergenic
1113441701 13:110334085-110334107 CAGGTGTGGCCTGTGTCCCCAGG + Intronic
1116264687 14:42672707-42672729 CAGGTGTGTGTTGCATCTGCTGG - Intergenic
1116992157 14:51287893-51287915 CAGGTGTGTCCAGTCTCAGCTGG + Intergenic
1119181757 14:72610165-72610187 CAGGTTTGCTTCGTATCTGCAGG + Intergenic
1122877998 14:104677645-104677667 CTGGTGTGGCCTGGTTCTGCTGG + Intergenic
1123039867 14:105486118-105486140 CAGGGGAGCCCTCTCTCTGCAGG - Intergenic
1126386933 15:48103072-48103094 CATGTGTTCTCTGTATCTCCTGG + Intergenic
1126504143 15:49383909-49383931 CAGGTGTCTCCTGTATTTGGGGG - Intronic
1127162334 15:56202524-56202546 CAGGTGTGAGCTATAGCTGCTGG - Intronic
1127992415 15:64130466-64130488 AAGGTATGCCCTGTGTCTCCTGG + Intronic
1131047506 15:89325598-89325620 TAGGTGTGACCCGCATCTGCAGG + Exonic
1131577180 15:93603778-93603800 CTGCTGTGGCCTGGATCTGCTGG - Intergenic
1132815299 16:1823037-1823059 GAGTTGTGCTCTGTGTCTGCAGG - Exonic
1133475833 16:6121126-6121148 CTGGTGTGTCCTGTATGTCCAGG + Intronic
1137432752 16:48431890-48431912 AAGGTGTGCGCTGAATCTCCAGG - Intronic
1138360844 16:56425721-56425743 CAGGTGCCCTCTGTGTCTGCGGG - Intergenic
1142157651 16:88539948-88539970 CTGGCCTGCCCTGTATCTGCCGG + Intergenic
1143786192 17:9257531-9257553 CACTTCTGCCCTGTAGCTGCAGG + Intronic
1144730814 17:17525189-17525211 CAGGTGTGGCCTGGGTCTGTTGG - Intronic
1146705557 17:34998426-34998448 CAGATGTGTCCTGGATCTGGAGG + Intronic
1150542404 17:66116192-66116214 TAGGTAAGCACTGTATCTGCTGG - Intronic
1151161272 17:72167797-72167819 CAGGTCTTCCCTGTCTCTGGAGG + Intergenic
1152307050 17:79527202-79527224 CAGGCGTGCTCTGCATCCGCAGG - Intergenic
1152452316 17:80389513-80389535 CTGGTGTGTCCTGTTTATGCTGG - Intronic
1152537170 17:80957516-80957538 CAGGGGTACCTTGTAGCTGCTGG + Intronic
1152841590 17:82572374-82572396 GTGGTGTGCCCTGTCTCAGCCGG + Intronic
1156474148 18:37395004-37395026 CAGGTGAGACTTGGATCTGCAGG - Intronic
1160012318 18:75115544-75115566 CAGGTATCCCCTGTTGCTGCTGG + Intergenic
1160849717 19:1184524-1184546 CACTTGTGCCCTGTAGATGCTGG - Intronic
1165413723 19:35678189-35678211 CAGGTGTGCCCTGAAACCCCAGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167655199 19:50759154-50759176 CTGGTGAGCGCTTTATCTGCTGG + Intergenic
925304662 2:2839763-2839785 CAGGTATGCCCTGTCCCTGAGGG - Intergenic
926911115 2:17853021-17853043 CAGGTGTGGTCTGTAGCTGAGGG - Intergenic
927443924 2:23141282-23141304 CAGCTGTCTCCTCTATCTGCTGG + Intergenic
927491778 2:23525751-23525773 CGGGTGGGCCCTGGCTCTGCTGG - Intronic
932426840 2:71643136-71643158 CAGCTGTGTCCTGTCTCGGCAGG - Intronic
933397567 2:81752630-81752652 TGGGTGAGGCCTGTATCTGCCGG + Intergenic
936949755 2:117966139-117966161 CATGTGTGCCCCATATCTGTTGG + Intronic
938138715 2:128779787-128779809 CAGCTGTGCCCTGGGTCAGCAGG - Intergenic
938812911 2:134870120-134870142 CAGCTGTGCCCTGCACCTTCTGG - Intronic
944024487 2:195146910-195146932 CAGGTGTGCCCTGTAGCTGATGG - Intergenic
945520074 2:210816019-210816041 CAGGTGTGCCCTACAACTCCTGG + Intergenic
947717368 2:232348627-232348649 CACGTGTGCCAAGTTTCTGCAGG + Intergenic
947999977 2:234559840-234559862 CTGCTGTGTCCTGTGTCTGCAGG - Intergenic
948395216 2:237640399-237640421 GAGGTGTGCGCTGAATGTGCCGG - Intronic
948613762 2:239185300-239185322 AGGGGGTGCCCTGTATCTCCTGG + Intronic
948710099 2:239820016-239820038 CAGGGGTGCCCAGGGTCTGCAGG + Intergenic
1169734211 20:8820166-8820188 CATGGGTTCTCTGTATCTGCTGG - Intronic
1172088598 20:32410172-32410194 CAGTAGTCCCCTTTATCTGCTGG + Intronic
1173808353 20:45940735-45940757 CAGGTGTGCACTGTATTGGATGG + Intronic
1174247349 20:49191570-49191592 CAGGTGTTCCCTGTTTCTTAGGG - Intergenic
1174892583 20:54412586-54412608 CAGGTGTGGACTGTATCTCAAGG - Intergenic
1175753483 20:61514922-61514944 CAGGTGTGCCCTGGGCCTCCAGG - Intronic
1178104953 21:29307732-29307754 CAGGTGTCCCCCTTATCTACAGG - Intronic
1178195802 21:30344202-30344224 CATGTGTGCCCTGATTCTTCTGG - Intergenic
1178720132 21:35000837-35000859 CAGGTGTTCCCTGCGTGTGCAGG - Intronic
1178914305 21:36698404-36698426 CAGTTGGGCCCTGTTTCCGCCGG + Intergenic
1181270177 22:21654014-21654036 GAGGTGTGCCCTGAACCTGCAGG + Intronic
949632588 3:5944445-5944467 CAGGAGTGCCCTGTTTTTCCAGG + Intergenic
950854249 3:16090665-16090687 CAGCCTTGCCCTGGATCTGCAGG - Intergenic
954611052 3:51944756-51944778 CACATGTGCCCTCTATCTTCAGG + Exonic
954917603 3:54162281-54162303 GAGGGGTGGCCTGTGTCTGCTGG + Intronic
956134248 3:66083218-66083240 CAGTTGTGACCTGTATATGGGGG + Intergenic
959780749 3:110230440-110230462 CAGATGTGTCCTGAATTTGCAGG - Intergenic
959997247 3:112693330-112693352 CAGGTGAGGCCTGTGACTGCAGG + Intergenic
960787708 3:121392274-121392296 CAGGAGTGCCCTGTTTTTCCAGG + Intronic
961389277 3:126542706-126542728 CAGGTGTGCCCTGCGCCCGCTGG - Exonic
964248653 3:154684514-154684536 TAGGTGAGGCCTGTAACTGCTGG - Intergenic
965250120 3:166332464-166332486 CAGGTCAGCCCTGGAACTGCTGG - Intergenic
966806187 3:183809602-183809624 CAGGTCTACACTGTATTTGCTGG - Intronic
968413236 4:406894-406916 AAGGTGTGCCCTGTCTGTGTGGG - Intergenic
968620218 4:1600525-1600547 CACGTGTGCACTGTCCCTGCAGG + Intergenic
969130782 4:4989836-4989858 CGGGTGGGCCATGTATGTGCAGG + Intergenic
969516196 4:7649441-7649463 CAGGTGTGCTCTGCAGCTGCAGG + Intronic
974372202 4:61032132-61032154 CAGTTGTCCCTTGTATCTGTGGG - Intergenic
977946454 4:102919677-102919699 CAGGAGTGCCCTGTTTTTCCAGG - Intronic
979783386 4:124684465-124684487 CAGATGAGCCATGTATGTGCAGG - Intronic
981103671 4:140857020-140857042 CAGTGGTAGCCTGTATCTGCTGG - Intergenic
983175047 4:164578417-164578439 AGGGTGTGCTCTGTATCTGCAGG + Intergenic
984040411 4:174726190-174726212 AAGGTATGCCTTGTTTCTGCAGG + Intronic
985230624 4:187812174-187812196 GAGCTGTGCTCTGTATCAGCTGG + Intergenic
988479137 5:31614799-31614821 CAGTTTTGCCCTGTATAAGCCGG + Intergenic
991976010 5:72184173-72184195 CAGGTTTGCCCTGTATGTCGCGG - Intronic
992457048 5:76925447-76925469 CAGGTGAACCCTGTTTCTCCTGG - Intergenic
993736802 5:91487109-91487131 CAGATGTGCCATGTTTCTTCAGG - Intergenic
995500883 5:112805591-112805613 GATGTGTGACCTGTATCTGTGGG + Intronic
996678419 5:126202782-126202804 CTGGTGAGGCCTGTAACTGCTGG + Intergenic
996725975 5:126673695-126673717 AAGCTGTGCCCTGTCTGTGCGGG - Intergenic
1002027745 5:176406798-176406820 CAGGTCTGGCCTGCACCTGCAGG - Intronic
1002805654 6:571759-571781 CAGGTGTTTCGTGTCTCTGCAGG - Intronic
1006214664 6:32430113-32430135 CAGGGGTGCCTTGTGGCTGCAGG + Intergenic
1006393786 6:33773832-33773854 CAGGTCTGCCCTGTAGATGAGGG - Intronic
1006656156 6:35595025-35595047 CATGTGTGCCCTATATGTGCAGG + Intronic
1009032972 6:58082360-58082382 CAGGTGTTCTCTGAATTTGCAGG - Intergenic
1009208588 6:60834127-60834149 CAGGTGTTCTCTGAATTTGCAGG - Intergenic
1011329087 6:86183975-86183997 CAGGTGAGGCCTGTGACTGCCGG - Intergenic
1013913781 6:115310310-115310332 TGGGTGAGCCCTGTAACTGCCGG - Intergenic
1016986816 6:149901367-149901389 CAGGGCTGCCTTGAATCTGCAGG + Intergenic
1018025782 6:159804635-159804657 CAGGTATGGCCTGTTTCTCCAGG + Exonic
1018388192 6:163323285-163323307 CAGGTGGGCCCTGCATTTCCGGG - Intergenic
1019191406 6:170253170-170253192 AAGGTGTGCCGTGTTTCAGCAGG - Intergenic
1019279845 7:194012-194034 GAGCTGTGCCCTGTGGCTGCTGG + Intronic
1020182070 7:5930450-5930472 CAGGAATGCCCTGTCTCTGCTGG + Intronic
1020300864 7:6794486-6794508 CAGGAATGCCCTGTCTCTGCTGG - Intronic
1022032475 7:26504952-26504974 CAGGTGCCTCCTGTCTCTGCAGG + Intergenic
1022149549 7:27587091-27587113 CAAGTGTGCCCTATTACTGCTGG + Intronic
1022669031 7:32438571-32438593 CAGGTGTGCCCTGAAGCTGTTGG + Intergenic
1024248319 7:47487355-47487377 CAGGCTTTCCCTGTAGCTGCCGG - Intronic
1029126764 7:98300123-98300145 CCTGTGTGCCCTGTGGCTGCTGG + Intronic
1032889696 7:136181345-136181367 CAGGTATGCTCTCCATCTGCTGG + Intergenic
1034969965 7:155412803-155412825 CTGCTGTGCCTTGTGTCTGCAGG + Intergenic
1035377354 7:158414227-158414249 CTGGTGTGCCCTGCATCATCGGG - Intronic
1042520187 8:69703317-69703339 CTTGTGTGCTCTGTATGTGCAGG - Intronic
1044525272 8:93243899-93243921 CAGGAGTGCCCAGTATGTACTGG + Intergenic
1046491552 8:114959303-114959325 AATGTGTACCCTGTGTCTGCAGG - Intergenic
1049829499 8:144691302-144691324 GATGTCTGCCCTGTGTCTGCTGG + Intergenic
1053115399 9:35496932-35496954 CAGGTGTGCTCAGTATCAGTGGG - Intronic
1053161808 9:35818623-35818645 CAGAGGGCCCCTGTATCTGCAGG + Intronic
1053461749 9:38276951-38276973 CAGAGCTGCCCTGCATCTGCAGG + Intergenic
1058396215 9:104557114-104557136 TAGGTGAGGCCTGTAACTGCTGG + Intergenic
1059001662 9:110354991-110355013 CAGGTGTGCCATATATCAGAAGG + Intergenic
1059391665 9:114003016-114003038 CATGGGTGCCCTGGATATGCGGG + Intronic
1060913771 9:127371423-127371445 AAGGTGTGCCCTGATTCTGTGGG + Intronic
1060939990 9:127537681-127537703 CAGGTGGGCCCTGTGTCTGATGG - Intronic
1061264788 9:129498534-129498556 CGGGTCTGCCCTGGATCTGCAGG + Intergenic
1062333186 9:136053469-136053491 CAGCTGGGCCCTGTGTCTCCTGG - Intronic
1195418052 X:104641716-104641738 CAGGTGTGGGCTGCAGCTGCCGG - Intronic
1198936326 X:141904851-141904873 CAGGTCTGCCCTGTTTCTGGGGG - Intronic
1200021663 X:153216524-153216546 GAGGTGTGCCCTGAATTTGAAGG + Intergenic
1202062105 Y:20898901-20898923 AAGCTGTGCCCTGTCTGTGCAGG + Intergenic
1202368381 Y:24181951-24181973 CCAGTGTGCCCTGTTTCTACTGG - Intergenic
1202502404 Y:25488166-25488188 CCAGTGTGCCCTGTTTCTACTGG + Intergenic