ID: 1083459885

View in Genome Browser
Species Human (GRCh38)
Location 11:62804117-62804139
Sequence GAGGGTTCTTTCCTGTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083459885_1083459897 26 Left 1083459885 11:62804117-62804139 CCTATCCACAGGAAAGAACCCTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1083459897 11:62804166-62804188 AGTTACTGGAAAACTGTGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 181
1083459885_1083459895 12 Left 1083459885 11:62804117-62804139 CCTATCCACAGGAAAGAACCCTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1083459895 11:62804152-62804174 CAGCATCAGGGAAAAGTTACTGG 0: 1
1: 0
2: 0
3: 11
4: 187
1083459885_1083459896 25 Left 1083459885 11:62804117-62804139 CCTATCCACAGGAAAGAACCCTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1083459896 11:62804165-62804187 AAGTTACTGGAAAACTGTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1083459885_1083459894 0 Left 1083459885 11:62804117-62804139 CCTATCCACAGGAAAGAACCCTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1083459894 11:62804140-62804162 TCTGTGGGAGGGCAGCATCAGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1083459885_1083459893 -1 Left 1083459885 11:62804117-62804139 CCTATCCACAGGAAAGAACCCTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1083459893 11:62804139-62804161 CTCTGTGGGAGGGCAGCATCAGG 0: 1
1: 0
2: 4
3: 19
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083459885 Original CRISPR GAGGGTTCTTTCCTGTGGAT AGG (reversed) Intronic
901776467 1:11563589-11563611 GAGGTTTCTTTGCTGTCGAGAGG + Intergenic
903973888 1:27136913-27136935 GTGGGCTCTTTCCTGAAGATGGG - Intronic
905403013 1:37716760-37716782 GAAGGTTCTTTCCTTGGGGTGGG - Exonic
907470121 1:54668263-54668285 GAGGAATCTGTCCTTTGGATAGG + Intronic
908853842 1:68400662-68400684 GTGGGTTCTTTCCAGTGTTTTGG + Intergenic
911556436 1:99350774-99350796 GAGGGTTCTTTCCTCTTCAATGG - Intergenic
913332014 1:117675486-117675508 GATGTTTGTTTCCTATGGATCGG - Intergenic
915264693 1:154708409-154708431 CAGGCTTCTTTCCTGGGGATGGG + Intronic
916594665 1:166232786-166232808 GAGGTTGCTGACCTGTGGATGGG + Intergenic
917997967 1:180460736-180460758 GAGGTTGCTGACCTGTGGATGGG - Intronic
920959296 1:210650337-210650359 CAGGGCTCTTTTCTGTGGCTGGG + Intronic
924124703 1:240838290-240838312 GAAGGTTCTTTCCTCTTGAATGG - Intronic
1065210850 10:23401646-23401668 TAGGGTTATTATCTGTGGATGGG + Intergenic
1065309294 10:24398668-24398690 CATGATTCTTTCCTCTGGATGGG + Intronic
1068254943 10:54497293-54497315 GAAGTTTCTTTCCTTTGGATGGG - Intronic
1069893283 10:71665230-71665252 GACGGTTCTTGCCAGCGGATAGG - Intronic
1072446435 10:95502768-95502790 GAAGATACTTTCCTGTGCATTGG - Intronic
1080225111 11:29951023-29951045 GAGGTTGCTTATCTGTGGATGGG - Intergenic
1080542332 11:33279917-33279939 GAGGGCTCTATCCTCTGAATGGG - Intronic
1081477343 11:43447552-43447574 GAGGGACCTGTCCTGTGCATTGG - Intronic
1081766635 11:45615799-45615821 GTGGGTTCTGTCCTGCGGCTGGG - Intergenic
1081770306 11:45646293-45646315 GAGACTTCTTTCCTCTGGGTAGG - Intergenic
1081783670 11:45731380-45731402 GAGGGTTCTTCCCTTGGGAATGG - Intergenic
1083459885 11:62804117-62804139 GAGGGTTCTTTCCTGTGGATAGG - Intronic
1084580518 11:70020272-70020294 GTGGGGGATTTCCTGTGGATAGG - Intergenic
1084935282 11:72583651-72583673 GTGGGGTCTTTACTGTGGACTGG - Intronic
1086611239 11:88758079-88758101 GAAGTTTCTGTCCTTTGGATTGG - Intronic
1087626832 11:100604757-100604779 GAGGTTGCTTACCTTTGGATGGG - Intergenic
1088050880 11:105514321-105514343 GAGTGATCTTTCAGGTGGATGGG + Intergenic
1088703292 11:112434318-112434340 GAGGCTGCTGTCCTTTGGATGGG + Intergenic
1090278742 11:125438338-125438360 CAGTGTTCTTTCCTGTGCAAAGG - Intergenic
1092128337 12:6090948-6090970 GAGGGTGCTGTCTTGTGGAAGGG - Intronic
1092774391 12:11929712-11929734 GGGGGTTCTTGCCTGGGGACTGG - Intergenic
1093429903 12:19072551-19072573 GAGGGTTCTCTCCTTGGGTTGGG + Intergenic
1095923643 12:47556684-47556706 GAAAGTTCTTTGCTGTGGAGAGG - Intergenic
1097907550 12:64935936-64935958 GAGGGTCCTTTCATGAGGAATGG + Intergenic
1098661682 12:73102236-73102258 GAGGATTCTTTCCAGTGTTTTGG - Intergenic
1100757758 12:97770765-97770787 AGGGGTTCTTTCCTGAGGAAGGG + Intergenic
1101530333 12:105567755-105567777 AATAGTTCTTTCCTGGGGATGGG + Intergenic
1101983257 12:109426030-109426052 CTGGGTTCTTTCCTGTCGTTGGG - Exonic
1102143959 12:110640299-110640321 GAGGTTTCTTTCCAGTTGGTTGG + Intronic
1102527519 12:113522212-113522234 GAAGCTTCTTTCCTGGGGAGCGG - Intergenic
1103314744 12:120043614-120043636 TAGTGCCCTTTCCTGTGGATGGG + Intronic
1104549433 12:129743049-129743071 GCAGATTCTTCCCTGTGGATTGG - Intronic
1107230559 13:38104614-38104636 GAGGGTTGTTACCAGTGGACTGG + Intergenic
1108965156 13:56289517-56289539 GAGGTTGCTGTCCTTTGGATGGG + Intergenic
1109105122 13:58240364-58240386 GAAGGTGCTCTCCTTTGGATGGG - Intergenic
1110172808 13:72522791-72522813 GAGGTTTCTTTCCTAGGGATAGG - Intergenic
1112851842 13:103715674-103715696 GAGGCTGCTATCCTGTGGTTAGG - Intergenic
1114787352 14:25616238-25616260 GAAGGTGCTGTCCTTTGGATGGG + Intergenic
1116150496 14:41135123-41135145 GAAGTTTCTTTCATGTAGATGGG - Intergenic
1116674361 14:47886791-47886813 GAGTGGTCTTTCCTGTGTATGGG + Intergenic
1119522469 14:75296005-75296027 GAGGGTTCCTTGCTGGGGGTGGG + Intergenic
1120336181 14:83158518-83158540 GAGGGCTCTTGCCTCTGTATAGG + Intergenic
1126101565 15:45121058-45121080 GAGGGCTCTTACCTGTGGTGGGG - Intronic
1132365851 15:101256150-101256172 GGGAGTTCCCTCCTGTGGATAGG - Intergenic
1133650597 16:7809360-7809382 GAGGGTTTTCTCCTATGCATAGG - Intergenic
1135869007 16:26131650-26131672 GAGGCATCCCTCCTGTGGATAGG - Intronic
1141405891 16:83792609-83792631 GGGGGTGCTGTCCTGTGTATGGG - Intronic
1143591206 17:7886535-7886557 GGGGGTGCTTTCTTGTGGGTCGG + Intronic
1144240935 17:13310762-13310784 GAGGGTTGTGTCCTGTGCATTGG + Intergenic
1148446574 17:47741517-47741539 GAGCCTTCTTTCAGGTGGATGGG + Intronic
1148958372 17:51372375-51372397 GGGGCTTGGTTCCTGTGGATAGG + Intergenic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1153570712 18:6470791-6470813 AATTGTTTTTTCCTGTGGATGGG + Intergenic
1155068870 18:22295391-22295413 GAGAGTTCTTTCATGGGGAATGG - Intergenic
1155779431 18:29812101-29812123 GAGGTTTCTGTCCTTTGCATGGG - Intergenic
1156062435 18:33096698-33096720 GAGGAATGTTTCCTGTTGATAGG - Intronic
1156896779 18:42255739-42255761 GAGGTTGCTATCCTTTGGATGGG + Intergenic
1158008583 18:52702234-52702256 GAGGGTGTTATGCTGTGGATAGG - Intronic
1159274108 18:66193490-66193512 GAGTGTTGTTTCCAGTGGACTGG - Intergenic
1160255420 18:77244103-77244125 GAGGGTTCTTCCATGTGGCTTGG + Intergenic
1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG + Intronic
1162994143 19:14323102-14323124 GGGGGTCCTGTCCTGTGCATTGG + Intergenic
1164559966 19:29283962-29283984 GCAGGTTCTTTCCTGGGGAAAGG - Intergenic
1165591629 19:36973848-36973870 GCGGGGTCTGCCCTGTGGATGGG + Intronic
1168057378 19:53870681-53870703 GAAGTTACTTTCCTGTGGCTAGG + Intronic
925603147 2:5629338-5629360 CAGGGCTCTTTCATCTGGATTGG - Intergenic
926412031 2:12614592-12614614 GAGGGTTCTTTGCTGTGCCCAGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928478496 2:31655813-31655835 GTAGGTTCTTTCCAGTGGAGTGG - Intergenic
930431912 2:51288633-51288655 GAGGCTTTTTTCGTGTGCATTGG - Intergenic
932122558 2:69115066-69115088 GAGGGGCCTGTCCTGTGCATTGG + Intronic
932925218 2:75965460-75965482 GAGGGTTCTTCCCTCAGGAATGG - Intergenic
935956932 2:108386436-108386458 GAGTTTTCTTTCCTGTGTCTAGG + Intronic
936798072 2:116231173-116231195 CAGGGTTTTTTCTTGTTGATAGG - Intergenic
948532475 2:238618671-238618693 GAGGGCTCTGGCCTGTGGTTAGG + Intergenic
1173992232 20:47312330-47312352 GAGAGTTCCATCCTGTAGATTGG - Intronic
1175496448 20:59417874-59417896 GAGGGTTCTTTACTGTGCCTGGG + Intergenic
1176521572 21:7828741-7828763 GAGGGATTTTTCCTGGTGATTGG + Intronic
1178655592 21:34458753-34458775 GAGGGATTTTTCCTGGTGATTGG + Intergenic
1179543949 21:42101870-42101892 GAGGGTCCTTTCCCGTGGGGTGG - Intronic
1182111074 22:27724093-27724115 GAGGGTTCTTCCCTTTGCCTAGG + Intergenic
1184555051 22:45228668-45228690 GAGGGATCTTTCCGGTGAAGAGG - Intronic
1185226758 22:49657810-49657832 GAGGGATATAACCTGTGGATGGG - Intergenic
950922970 3:16714671-16714693 GAGGTTGCTGACCTGTGGATGGG + Intergenic
952591422 3:34959738-34959760 GGGGGTGCTTTCATGTGAATAGG + Intergenic
953544545 3:43854731-43854753 GCTGCTTCTGTCCTGTGGATGGG + Intergenic
953606601 3:44416786-44416808 GAGTGGTCTTTGCTGTGGGTGGG - Intergenic
955141669 3:56275910-56275932 GATAGTTCTTTGCTGGGGATGGG - Intronic
959879280 3:111424202-111424224 GAAGTTGCTTTCCTTTGGATGGG - Intronic
959928962 3:111957767-111957789 GATGGTTATTTCCTGTGGCTAGG + Intronic
962001608 3:131304545-131304567 GAAGTTGCTTTCTTGTGGATGGG + Intronic
963532785 3:146491979-146492001 GAGGTTGCTGTCCTTTGGATGGG + Intronic
965490008 3:169323902-169323924 GAGGCTTTTTTCCTCTGCATGGG - Intronic
968766615 4:2474459-2474481 GAGAGTTGCTTCCTGTGGACAGG + Intronic
970170940 4:13290177-13290199 GAAGTTGCTTTCCTTTGGATGGG + Intergenic
971516751 4:27496795-27496817 GAGGGTGCTGACCTTTGGATGGG - Intergenic
973004224 4:44989194-44989216 GAGGGTTGTGTCCTGTGGTATGG - Intergenic
973746857 4:53971857-53971879 GAGGCTTCTTTCCTGATGATGGG - Intronic
973861228 4:55067048-55067070 AAAGGTTCTTTCCTTTGAATTGG - Intergenic
973934463 4:55828907-55828929 TTGGGTTTTTTCCTGTGGAAAGG - Intergenic
974130409 4:57747879-57747901 GAGGCTGCTGTCCTTTGGATGGG + Intergenic
976317647 4:83676002-83676024 GAGGGTTCTGTGCTGTGGAGGGG + Intergenic
976766258 4:88601499-88601521 GACAGTTCTCTCCTGTAGATTGG + Intronic
976961835 4:90986619-90986641 GAGGGTTATTGCATGTGGTTTGG - Intronic
979967550 4:127093524-127093546 GAGGTTTTTTTCATGTGTATTGG - Intergenic
980108803 4:128614885-128614907 CAAGGTGCTTTCCTGTGGCTAGG - Intergenic
983876503 4:172882807-172882829 GAGGTCTCTTTGCTGTGGATCGG + Exonic
985717612 5:1471531-1471553 GGAGGTTCTTTCCTGTGGCCTGG - Intronic
987147535 5:15006825-15006847 GATGGTTCTCTCCAGAGGATGGG + Intergenic
987720025 5:21621620-21621642 TAGAGCTCTTTCCTGTGGTTTGG - Intergenic
989588346 5:43090620-43090642 GAGAGCTCTTTCCTTTGTATTGG - Intronic
994333848 5:98540681-98540703 GAGGGTGCTGACCTTTGGATGGG - Intergenic
996142057 5:119923713-119923735 GAAGTTGCTTTCCTTTGGATGGG + Intergenic
1004605677 6:17193031-17193053 GAGGGTTCTTCCCTCAGGAAAGG - Intergenic
1006047991 6:31315162-31315184 CAGGGTCCTTTCGTGTGGTTTGG - Intronic
1006798037 6:36743434-36743456 GAGGGTTCTGGCCTCTGGCTGGG + Intronic
1007746713 6:44047679-44047701 GAGGATTCTTTCCAGAGGGTGGG - Intergenic
1008690232 6:53970859-53970881 GAAGGTTCATGCCTGTGAATGGG + Intronic
1012865936 6:104617702-104617724 AAGGCTTCTCTCCTTTGGATTGG - Intergenic
1017180106 6:151544044-151544066 GAAGGTTCTTGCCTCTGGAAAGG - Intronic
1017947786 6:159109736-159109758 GAGGGTGATTTCATGTGGACTGG + Intergenic
1019339885 7:503981-504003 GAGGATTCTGTCCTGGGGAAAGG - Intronic
1022440017 7:30425615-30425637 GAGGATGCTTTCCTGTTCATGGG - Exonic
1023709345 7:42975278-42975300 GAGGGTTCTTTGAAGAGGATAGG + Intergenic
1026549368 7:71354411-71354433 GAGGGTTCTTTTATTAGGATGGG + Intronic
1028157505 7:87448423-87448445 CAGGGTGCTTTCCTCTGGTTGGG + Intronic
1029593192 7:101520846-101520868 GAGGCTTCCTTACTGTGCATGGG - Intronic
1031210931 7:118825298-118825320 CAGGGTTTTTTTCTGTGTATTGG + Intergenic
1031717435 7:125125998-125126020 GAGTGCATTTTCCTGTGGATGGG + Intergenic
1031976554 7:128097362-128097384 GAGGTTTCTTTCCCCAGGATGGG + Intergenic
1033831966 7:145265843-145265865 GAGGGTTCTTCCCTCTTGAATGG + Intergenic
1036669474 8:10771794-10771816 GGGGGTGGTTTCATGTGGATGGG - Intronic
1038331116 8:26610164-26610186 CAGGTTTCTTTCCTTTTGATTGG + Intronic
1038425397 8:27461211-27461233 GAGGGTTCTTGGATGTGGAAGGG - Exonic
1040962653 8:53051493-53051515 GAAGTTGCTGTCCTGTGGATGGG + Intergenic
1041108784 8:54466847-54466869 GCACGTTCTTTCCTGTGGAGGGG + Intergenic
1043228578 8:77768510-77768532 GAGGGTCCTTTCCTGTCCATTGG - Intergenic
1043299131 8:78705272-78705294 GAGGCTGCTTACCTTTGGATGGG + Intronic
1043763630 8:84101232-84101254 GATGGTTATTTCCTGTGATTTGG + Intergenic
1045037825 8:98190226-98190248 GCAGCTTCTTTCCTGTTGATTGG - Exonic
1045150931 8:99406911-99406933 GAAGGTGCTTTCATTTGGATGGG + Intronic
1046960071 8:120102240-120102262 GAAGTTGCTTTCCTTTGGATGGG + Intronic
1048101900 8:131361420-131361442 GAAGTTTCTGTCCTTTGGATGGG + Intergenic
1048670686 8:136716118-136716140 GAGAGTTCTTACCTGTCAATGGG - Intergenic
1051576502 9:18622156-18622178 GAGGGTTATTTCATGGTGATTGG + Intronic
1052768300 9:32663965-32663987 CTGGGTTCTTTCCTGTGTCTGGG - Intergenic
1055309517 9:74964370-74964392 GAGGGGGCTCTCCTGTGGTTAGG - Intergenic
1057515429 9:95716462-95716484 GATTGTTCTTTCATGTGGTTGGG - Intergenic
1057819124 9:98317781-98317803 GAGGGTACATTCCAGTGGAACGG + Intronic
1060329763 9:122656420-122656442 GAGGGCTCTTTCTTATGAATAGG + Intergenic
1060511871 9:124240392-124240414 GAGAGGTGTTTCCTGTGGACTGG - Intergenic
1060603589 9:124894966-124894988 GAGGGTTCTCTGTTGTGGATGGG - Intronic
1060603595 9:124895000-124895022 AATGGTTCTTTGTTGTGGATGGG - Intronic
1061941217 9:133885088-133885110 GAGGGTTCTCTCCAGAGGACTGG + Intronic
1185819094 X:3184582-3184604 GAGGCTTCTATCCTGGGGCTGGG + Intergenic
1186126726 X:6422377-6422399 GAGGGTTCTTGCCTGTGAGCAGG + Intergenic
1186160709 X:6774300-6774322 GAGGGTTCTTGGCTGTGTCTAGG - Intergenic
1186265591 X:7830239-7830261 GAGGGTGTTTTCTGGTGGATGGG + Intergenic
1187617735 X:21016151-21016173 GATGGTTCTTGCCTTTGAATGGG - Intergenic
1188768401 X:34125209-34125231 GAAGTTTCTGTACTGTGGATGGG + Intergenic
1188835502 X:34949059-34949081 GAAGTTTCTGTACTGTGGATGGG - Intergenic
1189249493 X:39589058-39589080 CAGGTGTCTTTCCTCTGGATGGG + Intergenic
1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG + Exonic
1192784283 X:74322190-74322212 GAGGGATCTTTCCTGAGCAGGGG - Intergenic
1193504921 X:82330382-82330404 GAGGATTTTTGCCTGTGGAAAGG - Intergenic
1195172809 X:102285736-102285758 GAGGTTGCTGTCCTGTGGATGGG + Intergenic
1195186057 X:102401359-102401381 GAGGTTGCTGTCCTGTGGATGGG - Intronic
1198121345 X:133595404-133595426 TAGAGTACTTTCATGTGGATAGG - Intronic
1199044961 X:143159046-143159068 GAGGGTTCTTTCCTCATGAATGG - Intergenic
1199331230 X:146562105-146562127 AAGGGATATTTCCTGTGGCTTGG + Intergenic
1199489934 X:148387187-148387209 CAAGGTGCTTTCCTGTGGCTAGG - Intergenic