ID: 1083462937

View in Genome Browser
Species Human (GRCh38)
Location 11:62826734-62826756
Sequence AGGCACCCGCTACCAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 172}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083462937_1083462944 5 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462944 11:62826762-62826784 CCCAGCTACTGGGGAGGCTGAGG 0: 8071
1: 203079
2: 272255
3: 187387
4: 194223
1083462937_1083462942 -1 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462942 11:62826756-62826778 TATAGTCCCAGCTACTGGGGAGG 0: 294
1: 11223
2: 129373
3: 253056
4: 242941
1083462937_1083462948 28 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462948 11:62826785-62826807 CAGGAGAATCGCTTGCACCTGGG 0: 102
1: 23407
2: 107841
3: 183932
4: 191992
1083462937_1083462947 27 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462947 11:62826784-62826806 GCAGGAGAATCGCTTGCACCTGG 0: 164
1: 42249
2: 113438
3: 147152
4: 85774
1083462937_1083462938 -6 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462938 11:62826751-62826773 GTGCCTATAGTCCCAGCTACTGG 0: 99
1: 1472
2: 5374
3: 7977
4: 7474
1083462937_1083462946 9 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462946 11:62826766-62826788 GCTACTGGGGAGGCTGAGGCAGG 0: 6629
1: 176485
2: 235455
3: 172575
4: 171729
1083462937_1083462939 -5 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462939 11:62826752-62826774 TGCCTATAGTCCCAGCTACTGGG 0: 2754
1: 42924
2: 141888
3: 148353
4: 134112
1083462937_1083462940 -4 Left 1083462937 11:62826734-62826756 CCAGTCATTGGTAGCGGGTGCCT 0: 1
1: 0
2: 3
3: 22
4: 172
Right 1083462940 11:62826753-62826775 GCCTATAGTCCCAGCTACTGGGG 0: 265
1: 11500
2: 135463
3: 263916
4: 233021

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083462937 Original CRISPR AGGCACCCGCTACCAATGAC TGG (reversed) Intronic
901549805 1:9987494-9987516 AGGCACCCGCCACCTACGCCCGG - Intergenic
902409096 1:16202365-16202387 AGGCTCCCCCTCCCCATGACAGG - Intronic
902681313 1:18045837-18045859 AGCCACCCGCTAGCACTGGCCGG + Intergenic
905132392 1:35770677-35770699 AGGCACCCGCCACCAACCCCTGG + Intergenic
906742677 1:48197875-48197897 AGGCACCCGCCACCACTCCCGGG + Intergenic
906792145 1:48668444-48668466 AGCCACCAGCTACCAGAGACAGG - Intronic
909734641 1:78942054-78942076 AGGCACCTGCCACCCATGCCTGG - Intronic
910302309 1:85720155-85720177 AGGCACAAGCTACCAATGCCTGG - Intergenic
911317367 1:96371233-96371255 AGGCGCCCGCCACCAACGCCCGG + Intergenic
911538927 1:99135027-99135049 AGGTACCACCTACCAATGTCAGG + Intergenic
913674362 1:121127234-121127256 AGGCGCCCGCCACCCATGCCTGG + Intergenic
914026145 1:143914544-143914566 AGGCGCCCGCCACCCATGCCTGG + Intergenic
914664581 1:149822291-149822313 AGGCGCCCGCCACCCATGCCTGG + Intergenic
914671183 1:149871526-149871548 AGGCGCCCGCCACCCATGCCTGG - Intronic
916714233 1:167435788-167435810 AGGCACTCACTACCAGTGGCTGG - Intronic
917363004 1:174197654-174197676 ATGCGCCCGCAACCAATGCCCGG - Intronic
918326685 1:183417512-183417534 AGGGACCCGCTGCCTAGGACGGG - Intronic
919409149 1:197222242-197222264 AAACACCCGCCACCAACGACAGG - Intergenic
922374798 1:224951792-224951814 AGGCGCCCACCACCAATGCCCGG + Intronic
923476574 1:234338340-234338362 AGGCACCTGCCACCAGTGCCAGG + Intergenic
923665408 1:235994304-235994326 AGGCACCCGCCACCAAGCCCAGG + Intronic
1067980420 10:51078360-51078382 AGGCACGTGCCACCAATGCCTGG + Intronic
1068193648 10:53687153-53687175 AGGCACCCGCCACCACGGCCCGG + Intergenic
1070027132 10:72642431-72642453 AGTCACCCGCTTCCAATGTGTGG - Intergenic
1073409552 10:103329181-103329203 AGGTACCCGCCACCAACGTCTGG + Intronic
1073579542 10:104651911-104651933 GAGCAGCCACTACCAATGACTGG + Intronic
1075209679 10:120480600-120480622 TGGCAGCAGCCACCAATGACGGG + Intronic
1076174091 10:128352695-128352717 AGGCACCTGCCACCACTGCCCGG - Intergenic
1076383502 10:130040687-130040709 AGGCACCCGCCACCAAGCCCGGG - Intergenic
1077511379 11:2965671-2965693 AGGCACCCGCCAACCATGCCCGG + Intronic
1078590357 11:12635909-12635931 AGGCGCCCGCCACTAATGCCCGG + Intergenic
1082846576 11:57730592-57730614 AGGCGCCCACCACCAATGCCTGG - Intronic
1083462937 11:62826734-62826756 AGGCACCCGCTACCAATGACTGG - Intronic
1083818296 11:65150396-65150418 AGGCACCCACCCCCAATGCCTGG - Intergenic
1083855076 11:65389274-65389296 AGGCACCCTCTACCACCCACTGG - Intronic
1085923234 11:80983851-80983873 AGGCACCCGCCACCACTCCCAGG - Intergenic
1087736392 11:101839200-101839222 AGGCAGCCCCAACCAATGACTGG - Intronic
1090779005 11:129990200-129990222 AGGCACCCGCCACCCATGCCTGG - Intronic
1091189576 11:133679862-133679884 TGGCAGCCACTACCAATGTCGGG - Intergenic
1102659630 12:114514536-114514558 AGGCACCTGTTACAAAGGACAGG + Intergenic
1106161927 13:27209114-27209136 AGGCACAAGCCACCAATGCCGGG + Intergenic
1106739621 13:32625980-32626002 AGGCACGCACTACCAACGCCTGG + Intronic
1107480764 13:40784377-40784399 AGGCACCCGCCACCATGGCCAGG + Intergenic
1111939284 13:94592594-94592616 AGGCACCCGCCACCATGGACCGG + Intronic
1115224106 14:31085627-31085649 AGGCACACACCACCAATGCCTGG - Exonic
1115632931 14:35263542-35263564 AGGCACCTGCCACCCATGCCTGG - Intronic
1115685410 14:35791461-35791483 AGGCGCCTGCCACCAATGCCCGG - Intronic
1124657261 15:31518327-31518349 AGGCACAAGCCACCAATGCCTGG - Intronic
1129366011 15:75055361-75055383 AGGCACCCGCCACCATGGCCCGG + Intronic
1133640331 16:7710491-7710513 AGGCACCCCCTACCCATCCCAGG - Intronic
1134620273 16:15683486-15683508 AGGCACCCGCTACCACGAACCGG + Intronic
1135139772 16:19911575-19911597 AGGCATCAGCCACCAATGTCAGG - Intergenic
1136000579 16:27289541-27289563 AGGCACCCGCCACCAATGCCTGG + Intronic
1138501783 16:57450269-57450291 AGGCACCCGCCACCACTCTCAGG - Intronic
1140793810 16:78416563-78416585 AGGAACTTGCTACCAAAGACAGG - Intronic
1142023191 16:87796808-87796830 AGGCACCCGCCACCCACGCCAGG + Intergenic
1142953866 17:3506795-3506817 AGGCACCCGCCACCAAGCCCAGG - Intronic
1143209449 17:5173576-5173598 ATGCCCCTGCCACCAATGACTGG - Exonic
1143296621 17:5876241-5876263 AGTCACCCCTCACCAATGACAGG + Intronic
1144014756 17:11183375-11183397 AGGCACCCGCCACCACTCCCGGG + Intergenic
1144580340 17:16455520-16455542 AGGCACCCGCCATCCATGCCCGG + Intronic
1144618932 17:16803032-16803054 ATGCCCCTGCCACCAATGACTGG - Intronic
1144893775 17:18512663-18512685 ATGCCCCTGCCACCAATGACTGG + Intergenic
1145138453 17:20431611-20431633 ATGCCCCTGCCACCAATGACTGG - Intergenic
1147680932 17:42245047-42245069 AGGCATCTGCCACCAATGCCTGG + Intronic
1147680996 17:42245493-42245515 AGGCATCTGCCACCAATGCCTGG + Intronic
1147731551 17:42606851-42606873 AGGCATGCGCCACCAATGCCTGG - Intronic
1148281894 17:46354809-46354831 AGGCACACGGCACCAATGCCTGG - Intronic
1148304119 17:46572748-46572770 AGGCACACGGCACCAATGCCTGG - Intronic
1149144407 17:53472794-53472816 AGGCAGCCTCCACCAATGAGAGG - Intergenic
1149870687 17:60178620-60178642 ATGCCCCTGCCACCAATGACTGG + Intergenic
1150115906 17:62549253-62549275 AGGCACCCGCCACCACTCCCGGG - Intronic
1151791833 17:76310608-76310630 AGGCACATGCTACCAATGCCTGG + Exonic
1151793462 17:76325263-76325285 AGGCACCCGCTACCACGCCCGGG - Intronic
1158536610 18:58313740-58313762 AGGCACCCAGTACTAATGGCTGG - Intronic
1160202794 18:76809192-76809214 AGGCGCCTGCCACCCATGACCGG - Intronic
1160372814 18:78389072-78389094 TGGCACCCGCTACCACTAAGTGG - Intergenic
1160844556 19:1160671-1160693 AGGCACCCGCCACCACGGCCCGG + Intronic
1161301920 19:3546975-3546997 AGGCACCCGCCACCAACGCCCGG + Intronic
1161660594 19:5543423-5543445 AGGCGCCCGCCACCAATGCCCGG - Intergenic
1161787671 19:6337817-6337839 AGGCACCCACCACCAACGCCTGG + Intergenic
1164579401 19:29425282-29425304 AGGCACCCCCTGCCCACGACAGG + Intergenic
1165430754 19:35770730-35770752 AGGCACCCACCACCAATGCCTGG - Intronic
1165808735 19:38597465-38597487 AGGTACCAGCTCCCAATGAATGG - Exonic
1166399205 19:42465608-42465630 AGGCATGCGCTACCAAAGCCTGG - Intergenic
1166654770 19:44602750-44602772 AGGCACCCGCCACCAATGTCTGG - Intergenic
926637567 2:15198981-15199003 AGGCACCTGTCACCAATGCCCGG - Intronic
928514985 2:32036723-32036745 AGGCACCCGCCAACCATGCCCGG - Intronic
928627451 2:33154917-33154939 AGGCACCCACCACCAAGCACAGG - Intronic
928655516 2:33446998-33447020 AGGCACCCGCCACCAACACCTGG - Intronic
930147937 2:48026513-48026535 AGGCACCCACCACCACTGCCCGG + Intergenic
930798892 2:55421759-55421781 AGGCACCCGCCACCACCCACTGG + Intergenic
934473570 2:94577541-94577563 TGTCACCCGCTACGAATGCCGGG - Intergenic
934976187 2:98804225-98804247 AGGCCCCCACTGCTAATGACAGG + Intronic
937067194 2:119026302-119026324 AGGCACCCGCAGCCCAAGACAGG - Intergenic
937394380 2:121521714-121521736 AGGCAGCGGCTAACAAAGACTGG - Intronic
937880111 2:126858477-126858499 AGCAACCCCCAACCAATGACAGG + Intergenic
937939970 2:127277545-127277567 AGGCACCCGCCACCACAGCCTGG - Intronic
939471434 2:142626488-142626510 AGGCACTAGCCACCAATGCCTGG + Intergenic
942490429 2:176484412-176484434 AGGCACCCTCTACGAAGGAGAGG - Intergenic
946610008 2:221447983-221448005 AGGCACCCGCCACCCATGCTCGG + Intronic
948122351 2:235540292-235540314 AGGCACACGCCACCAACGCCTGG + Intronic
1169151370 20:3292140-3292162 AGGCACCTGCCACCAATGCCTGG + Intronic
1171758371 20:29140968-29140990 AGGCGCCCGCTACCACGGCCCGG - Intergenic
1173322597 20:42001643-42001665 AGGCACACGCTAACACTGCCAGG - Intergenic
1173577161 20:44119921-44119943 AGGCAGCCCATACCAATGACTGG + Intronic
1173671495 20:44802163-44802185 CTGCAGCTGCTACCAATGACTGG + Intronic
1175485593 20:59343560-59343582 GGGCCCCAGCTCCCAATGACAGG - Intergenic
1183085191 22:35482692-35482714 AGGCGCCAGCCACCAATGCCCGG - Intergenic
1183893145 22:40947532-40947554 AGGCACCCGCCACCAACGCCTGG - Intergenic
949477143 3:4458710-4458732 AGGCGCCCGCCACCAACGCCTGG - Intronic
951031092 3:17882404-17882426 AGGCACCTGCCACCCATGATGGG + Intronic
951956334 3:28258761-28258783 AGGCACCCGCCACCAAGTCCGGG + Intronic
953957291 3:47241127-47241149 AGGCACCACCTACCCAAGACAGG + Intronic
956366333 3:68507137-68507159 AGGCAGCCACTAGCAATGGCTGG + Intronic
958008031 3:87838263-87838285 AGGGTCCCTCTACCATTGACAGG - Intergenic
959077994 3:101771299-101771321 AGGCACCCACCACCAATGCCCGG - Intergenic
962484395 3:135828157-135828179 AGGCACATGCCACCAATGCCCGG - Intergenic
963528573 3:146446134-146446156 AGGCACCAGGGACCAATCACAGG - Intronic
970513130 4:16800816-16800838 AGGCGCCCGCCACCAACGCCCGG + Intronic
970886995 4:20997810-20997832 AGGGACCCGCTCCTAATGACTGG + Intronic
971713165 4:30143485-30143507 AGGCACCCACCATCAATGTCAGG + Intergenic
973334451 4:48942080-48942102 AGCCACCCATTTCCAATGACTGG - Intergenic
980794123 4:137658937-137658959 AGGCACACGCCACCCATGCCTGG - Intergenic
982717132 4:158820815-158820837 AGGCACCCTAATCCAATGACTGG - Intronic
983529680 4:168796380-168796402 AGACACCCGCCAGCAGTGACTGG - Intronic
984356201 4:178662467-178662489 AGGCGCCCGCCACCAATGCCGGG + Intergenic
984834590 4:184007985-184008007 TGACACCAGCTAACAATGACAGG + Intronic
986165092 5:5266247-5266269 AGGAACAAGCTACCAATGTCTGG + Intronic
991735928 5:69631362-69631384 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991739056 5:69652650-69652672 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991759142 5:69903781-69903803 AGGCACCTGCTGGCAATGGCAGG + Intergenic
991788194 5:70214341-70214363 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991790631 5:70232391-70232413 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991812422 5:70487001-70487023 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991815382 5:70507478-70507500 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991818517 5:70528767-70528789 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991838371 5:70778847-70778869 AGGCACCTGCTGGCAATGGCAGG + Intergenic
991880641 5:71214705-71214727 AGGCACCTGCTGGCAATGGCAGG - Intergenic
991883078 5:71232726-71232748 AGGCACCTGCTGGCAATGGCAGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997537407 5:134633213-134633235 AGGCACCCGCCACCACTGTCCGG + Intronic
1000955393 5:167536878-167536900 AGGCACCCGCCACCATTACCTGG - Intronic
1002624152 5:180513037-180513059 AGGTGCCCGCCACCAATGCCCGG + Intronic
1003790035 6:9536007-9536029 AGGCACCCACCACCAAAGCCCGG + Intergenic
1004288156 6:14342004-14342026 AGGCACCCGCCACCACCGCCTGG + Intergenic
1004459453 6:15822027-15822049 AGGCAAAGGCTACCCATGACTGG + Intergenic
1004696011 6:18033731-18033753 AGGCAGCCACCACCAATGATTGG + Intergenic
1005485817 6:26298291-26298313 AGGCGCCCACCACCAATGCCTGG - Intergenic
1008360870 6:50617024-50617046 AGGCACCCGCCACCAATGCCTGG - Intergenic
1009019611 6:57936853-57936875 AGGCACTTGCTGGCAATGACAGG - Intergenic
1010212859 6:73375933-73375955 AGGCACCCGCCACCACGGCCAGG + Intronic
1010431755 6:75785601-75785623 AGGCACGTGCTACCACTGCCTGG + Intronic
1011264548 6:85501511-85501533 AGGCACCCGCTACCACCCATGGG - Intergenic
1011959352 6:93068519-93068541 AGGCGCCCGCCACCATTGCCCGG + Intergenic
1012944546 6:105451608-105451630 AATCACCCCCAACCAATGACTGG + Intergenic
1013462514 6:110388675-110388697 AAGCACACGCTGGCAATGACAGG + Intergenic
1013591331 6:111621601-111621623 AGGCACCTGCCACCAATGCCTGG - Intergenic
1019536757 7:1533407-1533429 AAGCACCCTCTACCAAGGCCTGG - Intronic
1019734255 7:2642917-2642939 AGGTACCCGCCACCAATGCCTGG - Intronic
1019875289 7:3805388-3805410 AGGCTCCCGCTACCCAAGAAAGG - Intronic
1022505188 7:30905359-30905381 AGGCAGCAGCCACCAACGACAGG + Intergenic
1024162927 7:46697345-46697367 AGGCACAAGCCACCAATGCCAGG - Intronic
1026309081 7:69168058-69168080 AGGCACCCGCTACCAAGCCCAGG - Intergenic
1027815671 7:82967316-82967338 AGGCACGCGCCACCCATGCCCGG + Intronic
1033347093 7:140534055-140534077 AGGCACGTGCCACCAATGCCTGG + Intronic
1038001196 8:23392587-23392609 TGGCTCCCACTACCAGTGACAGG + Intronic
1040304860 8:46206723-46206745 AGGCACCCTCTTCCAAAGCCTGG - Intergenic
1040339021 8:46430578-46430600 AGGCACCCTGTACCAAAGCCTGG - Intergenic
1043974631 8:86570816-86570838 AGGCACCCGCCACCAAGCCCGGG + Intronic
1046485006 8:114875788-114875810 AGGCGCGCGCCACCAATGCCCGG + Intergenic
1047484240 8:125314431-125314453 AGGCACCCACCACCCATGCCTGG + Intronic
1048769122 8:137876850-137876872 AGGCACGAGCCACCAATGCCTGG - Intergenic
1052164555 9:25309112-25309134 AGGCACCCGCCACCATAGCCCGG + Intergenic
1052166708 9:25339380-25339402 AGGCACAGGCTACCACTGCCAGG + Intergenic
1053506367 9:38646779-38646801 AGGCGCCCGCCACCAACGCCCGG + Intergenic
1053684762 9:40510961-40510983 TGTCACCCGCTACGAATGCCGGG + Intergenic
1053934726 9:43139244-43139266 TGTCACCCGCTACGAATGCCGGG + Intergenic
1054099048 9:60926057-60926079 AGGCGCCAGCAACCAATGACTGG + Intergenic
1054120446 9:61201681-61201703 AGGCGCCAGCAACCAATGACTGG + Intergenic
1054297856 9:63346424-63346446 TGTCACCCGCTACGAATGCCGGG + Intergenic
1054395871 9:64650942-64650964 TGTCACCCGCTACGAATGCCGGG + Intergenic
1054430515 9:65156137-65156159 TGTCACCCGCTACGAATGCCGGG + Intergenic
1056389474 9:86127355-86127377 AGGCACCCACTACTGAAGACAGG - Intergenic
1057093693 9:92284388-92284410 AGGCCCCCAGCACCAATGACTGG - Intronic
1057413277 9:94838150-94838172 AGGCACCCGCCACCCATGCCTGG + Intronic
1057427029 9:94960265-94960287 AGGCACTCACCACCAATGCCTGG - Intronic
1058897509 9:109413087-109413109 AAGCACCTGCCACCAATGCCTGG + Intronic
1060928637 9:127473722-127473744 AGACACCCGCTCCCACTGCCAGG - Intronic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1061616304 9:131781795-131781817 AGGCACCTGCTAACCATGCCTGG + Intergenic
1062523060 9:136967093-136967115 AGGCACCCGCCATCTATGTCCGG + Intergenic
1186668738 X:11747382-11747404 AGGCACACGCCACCCATGCCTGG + Intergenic
1187957927 X:24538634-24538656 AGGCACCCGCCACCACCGCCCGG - Intronic
1189342227 X:40212672-40212694 AGGCACCCGCCACCCACGCCTGG - Intergenic
1192159527 X:68773534-68773556 AGGCATCCGCCACCTATGTCTGG + Intergenic
1195109015 X:101626765-101626787 AGGAACCCTCTTCCTATGACAGG + Exonic
1198657240 X:138927801-138927823 AGTCAGCCGCTACCATAGACTGG + Intronic