ID: 1083463435

View in Genome Browser
Species Human (GRCh38)
Location 11:62830658-62830680
Sequence AACTTATGGTAGAAGTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083463435 Original CRISPR AACTTATGGTAGAAGTATAT TGG Intronic
907766592 1:57418583-57418605 AACTTATGGTATAAAAATAAGGG - Intronic
909477767 1:76100761-76100783 AAGTTCTGGTAGAATTATCTGGG + Intronic
910141356 1:84030621-84030643 AACTTGAGAAAGAAGTATATGGG + Intergenic
910810595 1:91231694-91231716 AACTTATTTTACAAGTAAATTGG + Intergenic
911834005 1:102593040-102593062 AACTGTTGGAAGAACTATATGGG + Intergenic
915067252 1:153235484-153235506 AACATATGTAAGAAGTACATTGG - Intergenic
915675068 1:157521911-157521933 AAATTCTTGTAGAAATATATTGG - Intronic
916465198 1:165067118-165067140 AATGGATGGTAGAAGTACATGGG - Intergenic
916762614 1:167830976-167830998 AACATATGTAAGAAGTACATTGG - Intronic
919342690 1:196333696-196333718 GCGTTTTGGTAGAAGTATATAGG + Intronic
920958543 1:210642985-210643007 AACATATTGTAGATGTAAATAGG - Intronic
923692711 1:236211409-236211431 AACTTATATTAGAACTAAATGGG + Intronic
924190213 1:241543597-241543619 AACTTTTGCTATATGTATATTGG - Intronic
1063601683 10:7487429-7487451 AAATTATGGTATAACTACATTGG - Intergenic
1063881960 10:10540712-10540734 AATTATTGGTAGAAGTAGATGGG - Intergenic
1064214506 10:13388285-13388307 AAATGATGGTAGTAGTATTTTGG + Intergenic
1066132969 10:32412502-32412524 AACTGGTGGTAGAAGTTGATGGG + Intergenic
1069770532 10:70896329-70896351 AACTTTTAGTAGAATTGTATTGG + Intergenic
1073817954 10:107228241-107228263 AACTTGAGATAGAAATATATGGG + Intergenic
1073920644 10:108454308-108454330 AAGTTATTGTAGAAGAATTTAGG - Intergenic
1080171543 11:29309011-29309033 TACCTTTGGTAGAAGTGTATTGG - Intergenic
1080341284 11:31268287-31268309 AAATTTTGGTTGAAGTAAATGGG - Intronic
1081288274 11:41299898-41299920 AACTGATGGTTGATATATATAGG + Intronic
1081878846 11:46430485-46430507 AACTTACAGTAGAACTACATGGG - Intronic
1083010747 11:59396401-59396423 GACATATGGTAGAAATATAGAGG - Intergenic
1083463435 11:62830658-62830680 AACTTATGGTAGAAGTATATTGG + Intronic
1087544482 11:99566925-99566947 AACTTTTGCTAGAAATATATAGG - Intronic
1088330602 11:108647311-108647333 AACTTTTGGAACAAGTATTTTGG - Intergenic
1090584059 11:128190937-128190959 AACATATTGTAAAAGTATAAAGG - Intergenic
1094249702 12:28345833-28345855 AATTTATGATATAACTATATTGG - Intronic
1095187451 12:39217213-39217235 AAAATATGATAGAATTATATTGG + Intergenic
1095238732 12:39831812-39831834 AGCTTATGGTAGAAGGCTAAGGG - Intronic
1096003076 12:48145498-48145520 AACCTTTGGTAGAAGTTGATTGG + Intronic
1097596549 12:61639985-61640007 GAATTCTGGTAGAAGAATATTGG - Intergenic
1098610273 12:72448518-72448540 AACTTATGGTAGTAGTGTTCTGG + Intronic
1098612799 12:72482279-72482301 TACTTCTGACAGAAGTATATCGG - Intronic
1098744481 12:74218494-74218516 CACTTATGGAATAAGTAAATTGG + Intergenic
1099062572 12:77930237-77930259 AAATTATAGTGTAAGTATATTGG - Intronic
1099173236 12:79390653-79390675 AAATTATGGCATAACTATATTGG - Intronic
1099673246 12:85722017-85722039 AACTTCTGCTAAAATTATATTGG + Intergenic
1101610952 12:106291277-106291299 AAATTATGGTACATGTATCTAGG - Intronic
1102176037 12:110875669-110875691 ATCTTATGGAAAAAGTATAAGGG - Intronic
1104559409 12:129830568-129830590 AATTTATGGAAGAAGGATACTGG - Intronic
1107851946 13:44579070-44579092 AACCTCTGCTAGAAGTAAATAGG + Intergenic
1108023608 13:46155188-46155210 TACTTATGGTAGAATTACTTTGG - Intronic
1108509732 13:51145824-51145846 AATATATGTTAGAAGTACATTGG - Intergenic
1108963658 13:56269247-56269269 AACTCATGTTAGATGTATATTGG + Intergenic
1109063314 13:57649472-57649494 AAGTTATGATAGAAGTACAAGGG - Intronic
1109143668 13:58749444-58749466 AAATAATGGTGGAAATATATGGG - Intergenic
1110315734 13:74103902-74103924 AAGTTTTGTTAGAAGTCTATGGG + Intronic
1116758566 14:48980908-48980930 ATTTTATAGTAGAAGTATACAGG + Intergenic
1119247789 14:73127849-73127871 AACATATGTAAGAAGTACATTGG - Intergenic
1120376426 14:83713617-83713639 AAATTATGGTAGAGGTCTATGGG + Intergenic
1124021318 15:25926930-25926952 AACTTATTTTACAAGTAAATTGG + Intergenic
1126774726 15:52090814-52090836 AAATTATGATATAATTATATTGG + Intergenic
1127367045 15:58300863-58300885 TACTTCTGGTAGAAGGATAGAGG - Intronic
1131006193 15:88980554-88980576 TACATATGGTACATGTATATAGG - Intergenic
1134162274 16:11901174-11901196 AAGATAGGGTAGAAATATATCGG - Intronic
1137414546 16:48262834-48262856 AACTTATGGTAGAACTTCCTTGG + Exonic
1140349149 16:74245280-74245302 AAATTATGATACAACTATATTGG - Intergenic
1148576706 17:48717239-48717261 AACTTTGGGTGGTAGTATATGGG + Intergenic
1149699314 17:58642117-58642139 AACTTTTCCTAGAAGTAAATGGG - Intronic
1155923812 18:31632649-31632671 AAATTATGATAAAACTATATTGG - Intronic
1156381491 18:36565646-36565668 TACTTTTGGTAGAAATAAATAGG + Intronic
1157801401 18:50624333-50624355 AACTTATTGTACAAATATCTAGG - Intronic
1157931434 18:51828098-51828120 AAATAATGGAAGAAATATATGGG + Intergenic
1158167333 18:54555242-54555264 AACATATGTAAGATGTATATTGG + Intergenic
1159483126 18:69016770-69016792 AAGTTATGGCAGAGTTATATTGG - Intronic
1159589087 18:70312492-70312514 AACTCATGATTGAAGTAAATTGG - Intronic
1160182764 18:76649692-76649714 AACTTGTGGCAAAATTATATCGG + Intergenic
1165505909 19:36229321-36229343 AACTTATGACAGAGGTACATGGG - Intronic
1166442652 19:42828968-42828990 AACTTATTTTGGAAATATATTGG + Intronic
1168365034 19:55779017-55779039 AAGTTATGGAAGAAGAATGTGGG + Intergenic
926490488 2:13520259-13520281 AACTTATTTTGGAAGTAAATTGG - Intergenic
926709206 2:15863096-15863118 AAATTATGGCATAACTATATTGG + Intergenic
927490820 2:23519739-23519761 AATATATGTAAGAAGTATATCGG + Intronic
931473059 2:62559224-62559246 AACACTTGGTAGAAGAATATTGG - Intergenic
931608152 2:64072410-64072432 AACTTATTTTACAAGTAAATTGG + Intergenic
933742186 2:85542836-85542858 AACGTATTATACAAGTATATGGG + Intronic
935808566 2:106772979-106773001 AATTTATGTAAGAAGTACATTGG + Intergenic
936705165 2:115064020-115064042 AAATGATGGTAAAAGTAAATTGG - Intronic
936807425 2:116352849-116352871 AACGTAAGGAAGAAATATATAGG + Intergenic
940187689 2:151005016-151005038 TATTTATGGTAGAAAAATATAGG + Intronic
943411120 2:187549583-187549605 ATCTTATGTAAGAAGTTTATTGG - Intronic
943676202 2:190718446-190718468 AACATATGTAAGAAGTACATTGG - Intergenic
943850301 2:192712260-192712282 AACTTATAGTAGAACAATGTTGG + Intergenic
943874432 2:193044935-193044957 AAATTATAGTAGAAACATATAGG + Intergenic
945425955 2:209702360-209702382 AACTTATAGAACAAGGATATGGG - Intronic
945769517 2:214023495-214023517 AACTTAAGGTATAAGTACATAGG + Intronic
946712033 2:222516598-222516620 AACTTATCATATAAGTATACAGG + Intronic
1168990693 20:2093728-2093750 AAATTATGATATAATTATATTGG - Intergenic
1170023141 20:11858522-11858544 AATTTCTGGTAAAAGTAGATTGG + Intergenic
1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG + Intergenic
1176691989 21:9924437-9924459 AACTTATGGTATTAGGAGATGGG + Intergenic
1177670756 21:24223212-24223234 ACATTTAGGTAGAAGTATATTGG + Intergenic
1177723003 21:24931324-24931346 AACATATGTAAGAAGTACATTGG - Intergenic
1179612415 21:42560812-42560834 TACTTTTGGTACAAGTATTTGGG - Intronic
1181655670 22:24296095-24296117 AACTTGTGTTATATGTATATTGG + Intronic
1183838012 22:40472941-40472963 ATTTTATGGAAGAAGTATGTTGG - Intronic
949124829 3:434579-434601 AACTTATGGTAAACCTATATGGG + Intergenic
949837841 3:8288613-8288635 AACTCATGGAAGTAGTAGATAGG - Intergenic
950340665 3:12241200-12241222 AAATTATGATAAAACTATATTGG - Intergenic
956467161 3:69530454-69530476 CACTTATGGTAGAAGGGAATGGG - Intronic
958638162 3:96772219-96772241 AATATATGGAAGAAGTACATTGG + Intergenic
959990829 3:112630034-112630056 ACTTTATGGTAGAGGTACATGGG - Intronic
961346295 3:126265602-126265624 AACATATGTAAGAAGTACATTGG - Intergenic
964920285 3:161887749-161887771 AACTTATGGAAGAAGAAAAAGGG + Intergenic
966513572 3:180792029-180792051 CACTGATGGTGAAAGTATATTGG + Intronic
968820605 4:2847733-2847755 AATATATGCTAGAAGTACATTGG + Intronic
969110505 4:4841244-4841266 ATCTCATGGTAGAAATAAATGGG + Intergenic
970680753 4:18504948-18504970 AAATAATGGGAGAAGTATATGGG + Intergenic
970876306 4:20874587-20874609 AACTTCTGGTAGATATATAATGG + Intronic
971735759 4:30449349-30449371 AACTTAAGGTATATCTATATGGG + Intergenic
972906568 4:43755867-43755889 AAATTAAAGTAGAAGTGTATTGG - Intergenic
972949295 4:44299368-44299390 AACTTTTGGTAAAAATATCTTGG - Intronic
974354289 4:60792131-60792153 AAATTATGTAAGAAGTATGTGGG + Intergenic
976563477 4:86528244-86528266 AACATATGCAAGAAATATATGGG - Intronic
978048823 4:104169568-104169590 AAAATATGGCAGAAGTACATTGG + Intergenic
978282954 4:107038545-107038567 AACTTAAGTTAGGAGTATACTGG + Intronic
978701202 4:111648359-111648381 AACTTATTTTAGAAATATAAAGG + Intergenic
979387479 4:120086556-120086578 GACATCTGGTCGAAGTATATAGG - Intergenic
979708865 4:123753671-123753693 GGCTTATGATAGAAGTATAGAGG + Intergenic
980325989 4:131346987-131347009 AACAGATGGTTGAAGTTTATAGG + Intergenic
980612495 4:135177744-135177766 AACTTATTGTACAAATAAATTGG + Intergenic
981217431 4:142187248-142187270 AAATTATGGTAAAATTACATGGG - Intronic
981245969 4:142538470-142538492 ATATTATGGTTGAAGTATAAAGG - Intronic
983075554 4:163321549-163321571 AACTCACTGTAGAATTATATAGG + Intergenic
984100437 4:175477875-175477897 AATATATGTAAGAAGTATATTGG - Intergenic
984480325 4:180292538-180292560 AAATTGTGGTAGAACTCTATTGG + Intergenic
985226841 4:187770531-187770553 AACATATGGACGAAGTACATGGG + Intergenic
988453350 5:31364722-31364744 AACTTATGGAACAACTACATAGG - Intergenic
990430395 5:55729102-55729124 AACTCTGGGTAAAAGTATATGGG - Intronic
991043233 5:62196584-62196606 AACATATGTAAGAAGTACATTGG + Intergenic
991171925 5:63637509-63637531 ACTTTCTGGTAGAAGTTTATAGG + Intergenic
994786324 5:104168866-104168888 AACATATTTTAGAAGTATCTTGG + Intergenic
1003706534 6:8537826-8537848 AATTTTTGCTAGATGTATATTGG + Intergenic
1009014497 6:57882481-57882503 ATATTTTGGTATAAGTATATAGG - Intergenic
1010373232 6:75135940-75135962 AACTGATGCTAGAATTATTTTGG - Intronic
1013203223 6:107922048-107922070 AATTTATGGGAAAAATATATAGG - Intronic
1013621178 6:111890954-111890976 AACCTATGTTAGAAATATTTGGG + Intergenic
1013933321 6:115562900-115562922 CAATTATGGTAGAAATTTATAGG + Intergenic
1013981808 6:116139145-116139167 AAATTCTAGTAGAAGAATATTGG + Intronic
1014712615 6:124825222-124825244 ACCTTATAGTACATGTATATGGG + Exonic
1014860267 6:126457873-126457895 CCCTCATGGTAGAAGTATTTGGG + Intergenic
1015718733 6:136218400-136218422 AATTTATGTTACAATTATATAGG - Intergenic
1017572494 6:155761833-155761855 AACTTATGGTATAAATTTGTGGG + Intergenic
1020522196 7:9205296-9205318 AACTTATTTTACAAGTAAATTGG + Intergenic
1021883919 7:25120004-25120026 AACTTATGGTAAAATTATAAAGG + Intergenic
1026620149 7:71943026-71943048 AATTTATGTAAGAAGTACATTGG - Intronic
1027938919 7:84647401-84647423 AATTTATAGTAAAAATATATAGG - Intergenic
1030328563 7:108248479-108248501 ACCTCATGGTAGAAGTCCATGGG + Intronic
1030750817 7:113229690-113229712 AACATATGGGTGAAGTATTTTGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1041311616 8:56523233-56523255 AACTTAGGCAAGAAGTAAATGGG - Intergenic
1041371510 8:57165633-57165655 AACATATGTAAGAAGTACATTGG + Intergenic
1044031562 8:87244142-87244164 AACATATGTAAGAAGTACATTGG + Intronic
1044800977 8:95955892-95955914 AACTTCTGGGAGAAGTATAGAGG - Intergenic
1044894251 8:96872719-96872741 AACATACGGTAGAATTAAATTGG + Intronic
1045128447 8:99121069-99121091 ACCTTATATTAGAAGGATATGGG + Intronic
1047125164 8:121951808-121951830 AACATATGTAAGAAGTACATTGG - Intergenic
1048759725 8:137780803-137780825 AATTTATGGTAAAAGTTGATGGG - Intergenic
1050119688 9:2295663-2295685 AAAATCTGGTAGAAGGATATGGG + Intergenic
1050632947 9:7579880-7579902 TACTTCTGGTTGAAGCATATGGG - Intergenic
1053777084 9:41555502-41555524 AACTTATGGTATTAGGAGATGGG - Intergenic
1054364646 9:64322982-64323004 AACTTATGGTATTAGGAGATGGG + Intergenic
1054728661 9:68678156-68678178 AACTTATGGCTGAAGTCCATGGG + Intergenic
1055772541 9:79732809-79732831 AACATATGGAAGTAGTATGTGGG - Intergenic
1058848231 9:108983530-108983552 AACTTACTGTTGAAGTATAAAGG - Intronic
1059901657 9:118934322-118934344 GACTTTTGATAGAAGAATATGGG + Intergenic
1060702419 9:125768368-125768390 AACTTATTTTAGGAGTATAAAGG - Intronic
1185681344 X:1891017-1891039 AACATATGTAAGAAGTACATTGG + Intergenic
1185811454 X:3114261-3114283 AACATATGTAAGAAGTACATTGG + Intergenic
1187622995 X:21079377-21079399 AACAATTGGTAAAAGTATATAGG + Intergenic
1188520813 X:31035476-31035498 AAGTTGTGGTAGAAATATTTAGG - Intergenic
1189719076 X:43896531-43896553 ATCTTTTGGTAGAATGATATTGG - Intergenic
1193744979 X:85266407-85266429 AACTTATGCCAGAATTCTATGGG + Intronic
1194123108 X:89984774-89984796 AACTTTTAGTAGAAGCATAGGGG - Intergenic
1198424278 X:136499141-136499163 TACTTATTGTACATGTATATTGG + Intronic
1198524727 X:137489710-137489732 AACTTTTGGGAGAAGAGTATGGG + Intergenic
1198882266 X:141294456-141294478 TAATTATGGTAGAGGGATATGGG + Intergenic
1200475966 Y:3642220-3642242 AACTTTTAGTAGAAGCATAGGGG - Intergenic
1200495835 Y:3882179-3882201 AAATTGTGGTATCAGTATATTGG + Intergenic