ID: 1083473555

View in Genome Browser
Species Human (GRCh38)
Location 11:62900669-62900691
Sequence CAGATTTAAGAGGAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083473549_1083473555 -6 Left 1083473549 11:62900652-62900674 CCAGCCAGGATGGTGGCCAGATT No data
Right 1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG No data
1083473550_1083473555 -10 Left 1083473550 11:62900656-62900678 CCAGGATGGTGGCCAGATTTAAG No data
Right 1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG No data
1083473548_1083473555 -5 Left 1083473548 11:62900651-62900673 CCCAGCCAGGATGGTGGCCAGAT No data
Right 1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083473555 Original CRISPR CAGATTTAAGAGGAGGAGGC TGG Intergenic
No off target data available for this crispr