ID: 1083476262

View in Genome Browser
Species Human (GRCh38)
Location 11:62917536-62917558
Sequence GTTCACCCCATTCCACAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083476262_1083476267 5 Left 1083476262 11:62917536-62917558 CCCTTCTGTGGAATGGGGTGAAC 0: 1
1: 0
2: 1
3: 23
4: 206
Right 1083476267 11:62917564-62917586 GGATGAGTGTTTGTGTGTGAGGG 0: 1
1: 0
2: 11
3: 140
4: 1601
1083476262_1083476266 4 Left 1083476262 11:62917536-62917558 CCCTTCTGTGGAATGGGGTGAAC 0: 1
1: 0
2: 1
3: 23
4: 206
Right 1083476266 11:62917563-62917585 AGGATGAGTGTTTGTGTGTGAGG 0: 1
1: 1
2: 20
3: 155
4: 1265
1083476262_1083476269 30 Left 1083476262 11:62917536-62917558 CCCTTCTGTGGAATGGGGTGAAC 0: 1
1: 0
2: 1
3: 23
4: 206
Right 1083476269 11:62917589-62917611 TATGCATTGCTGAGCAAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 123
1083476262_1083476268 26 Left 1083476262 11:62917536-62917558 CCCTTCTGTGGAATGGGGTGAAC 0: 1
1: 0
2: 1
3: 23
4: 206
Right 1083476268 11:62917585-62917607 GGTATATGCATTGCTGAGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083476262 Original CRISPR GTTCACCCCATTCCACAGAA GGG (reversed) Intronic
900565008 1:3327874-3327896 GTTACCCCCATTCCACAGATGGG + Intronic
901014967 1:6223698-6223720 ATTGACCCCATTCCACAGATGGG + Exonic
902743059 1:18453596-18453618 GTTCTCCTCATTTCACAGGAGGG - Intergenic
903847775 1:26288696-26288718 CATCTCCCCATTGCACAGAAAGG - Intronic
905413971 1:37792398-37792420 GTTCCCCTCATGCCACAAAATGG - Intergenic
906349349 1:45044390-45044412 TTTCACCACATTCCCCAGACTGG - Intronic
912471752 1:109911301-109911323 GCTCACCCCATTGCACGGAGGGG + Intronic
914829924 1:151163721-151163743 TTTCACCACATTGCCCAGAATGG + Intronic
915703781 1:157823897-157823919 GCTGACCCACTTCCACAGAATGG + Intergenic
918072608 1:181143988-181144010 CTTCACCCCATTCCCCAGCCTGG + Intergenic
919235967 1:194842966-194842988 GATCACTGCGTTCCACAGAAGGG + Intergenic
920736333 1:208536288-208536310 CTTCACCCCATGCCAGAGAAAGG + Intergenic
924464142 1:244284969-244284991 TCTCACCCCATTTCACAGATGGG + Intergenic
924664028 1:246051314-246051336 TTTCACCACATTGCACAGGATGG + Intronic
1063368933 10:5508390-5508412 GTTAACCCCATTTCAGAGACTGG + Intergenic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1067450524 10:46379445-46379467 GCTCAAACCATTCCTCAGAAAGG + Intronic
1067586719 10:47480306-47480328 GCTCAAACCATTCCTCAGAAAGG - Intronic
1070647899 10:78214211-78214233 GGCCATCCCATTCCACAGGAGGG + Intergenic
1070660980 10:78305007-78305029 GGTCACCCCACTTCACAGACTGG - Intergenic
1071449521 10:85780753-85780775 ATTGACCCCATTTTACAGAAGGG - Intronic
1072880571 10:99223204-99223226 GTTTACCCCATTTGACAGATGGG - Intronic
1074963561 10:118469342-118469364 GCACACCCCAGTCCACAGAAAGG - Intergenic
1075090928 10:119443909-119443931 GACCACCCCAGTCCACAGCAAGG - Intronic
1075093548 10:119456669-119456691 TTCCACCCCAAACCACAGAATGG + Intronic
1075836690 10:125459830-125459852 TTTCATCACATTTCACAGAAAGG + Intergenic
1076091893 10:127693688-127693710 TTTCACCACATTGCACAGGATGG - Intergenic
1076540801 10:131213576-131213598 GTTGTCCCCATTCCATAGACGGG - Intronic
1077497642 11:2894121-2894143 GTTGTCCCCATTTCACAGATGGG + Intronic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1079111781 11:17609376-17609398 ATTCGCCCCATTTCACAGAGAGG + Intronic
1081606734 11:44531807-44531829 ATTCTCCCCATTCTGCAGAAGGG + Intergenic
1081758812 11:45562790-45562812 GTCAACCTCATTCCACAGATGGG - Intergenic
1082809777 11:57472637-57472659 GTTATCCCCATTTCACAGATGGG - Intronic
1083266210 11:61548110-61548132 GGTCACCCCACTCCCCTGAAAGG + Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1083544577 11:63538803-63538825 GATCATCCCATTGCACAGATGGG - Intronic
1083937264 11:65876424-65876446 TATCACCCCATTTCACAGATAGG + Intergenic
1084700678 11:70784676-70784698 GCTCAGCCCATGCCACAGAGGGG - Intronic
1086963142 11:93000631-93000653 TTTCACCACATTACTCAGAATGG - Intergenic
1087553452 11:99682619-99682641 GTTCAACCTATTACACAGAACGG - Intronic
1088199154 11:107311427-107311449 GTTTGCACCATGCCACAGAAGGG + Intergenic
1089021909 11:115224633-115224655 ATTCACCCCAGTCCAGAGGAAGG + Intronic
1089635270 11:119807857-119807879 GCTCACCCCCTTCCACAGGTGGG - Intergenic
1089912288 11:122113240-122113262 ATTCATCCCATTTCATAGAAAGG + Intergenic
1090183244 11:124718912-124718934 GTGCACCCCATTACACAGTGGGG + Intergenic
1091389498 12:117494-117516 GCTCAGCCCATCCCACAGGAAGG - Intronic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1093399028 12:18720559-18720581 ATTACCCCCATTCCACAGATAGG - Intronic
1094474556 12:30831389-30831411 GTTAACCCAATTTCATAGAAAGG - Intergenic
1097472724 12:60015361-60015383 GTGAACACCATTCCACAGGAAGG + Intergenic
1097993638 12:65863476-65863498 GTTCACCTCATACTGCAGAAAGG - Intronic
1098656007 12:73030234-73030256 TTTCAACCCTTTCCACAAAAAGG + Intergenic
1098750442 12:74286239-74286261 GATCATCAAATTCCACAGAATGG + Intergenic
1101652903 12:106693970-106693992 TTTATCCCCATTTCACAGAAGGG + Intronic
1102469909 12:113153953-113153975 GTCCACCCCATTTTACAGATAGG + Intronic
1102561238 12:113763867-113763889 GATCCCCTCATTCCACAGATGGG + Intergenic
1102772833 12:115493463-115493485 GTTGATCCCATTCCACAGGTGGG - Intergenic
1103197569 12:119058421-119058443 GTTGTCCCCATTTTACAGAAAGG + Intronic
1103920851 12:124398472-124398494 GATCACCCCATTTTATAGAAGGG + Intronic
1104391174 12:128391670-128391692 ATTGTCCCCATTCCACAGATAGG + Intronic
1104666269 12:130649544-130649566 TTTTTCCCCATTGCACAGAACGG - Intronic
1104962053 12:132493056-132493078 GATGCCCCCATTCCACAGATGGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1105440417 13:20410788-20410810 GTTGTCCCCATTTCACAGATGGG + Intronic
1105787026 13:23759718-23759740 GCCCACCCCTTTCCACAGAATGG - Intronic
1111964239 13:94845229-94845251 GGCCACCATATTCCACAGAAGGG + Intergenic
1113582116 13:111437288-111437310 GTTATCCCCATTTCACAGATGGG + Intergenic
1113927463 13:113949750-113949772 GATGACCCCACTCCACAGATGGG - Intergenic
1115347075 14:32354398-32354420 ATTATCCCCATTTCACAGAATGG - Intronic
1117375023 14:55111974-55111996 GCACAGCCCATTCCACAGGATGG - Intergenic
1120983887 14:90315628-90315650 GTTCAATTCATTCTACAGAATGG - Intronic
1121869652 14:97395370-97395392 GTTGTCCCCATTCCACAGATGGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122234108 14:100322479-100322501 GTGCTCCCCATTTCACAGATGGG - Intergenic
1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG + Intergenic
1124401568 15:29353175-29353197 ATTCTCCCCATTGCACAGAATGG + Intronic
1125745262 15:41993312-41993334 ATTCTCCCCATTCCACAGACAGG - Intronic
1127538409 15:59913105-59913127 GTTCTTCCCATTCCCCAGGACGG - Intergenic
1128713063 15:69886348-69886370 TTTCATCCCATTTCACAGATGGG - Intergenic
1129291310 15:74570000-74570022 GTTGGACCCATTCCACAGATAGG - Intronic
1130750986 15:86712990-86713012 CTACAACCCATCCCACAGAAGGG + Intronic
1131272377 15:90955150-90955172 TTTCAGCCCATTTCACAGACCGG + Intronic
1131446578 15:92503094-92503116 CTTCCCCCCATCCCACAGAGTGG + Intergenic
1132044431 15:98551344-98551366 TTTAATCCCATTCCACAGATTGG - Intergenic
1132649582 16:1014429-1014451 GTCCACCCCACTCCACGGACTGG - Intergenic
1135566157 16:23512640-23512662 GTTCAAACCAGTCCAAAGAATGG - Intronic
1137621543 16:49879717-49879739 TTTCTCCCCGTTCTACAGAAGGG + Intergenic
1140833500 16:78772684-78772706 GTTTAGCTCATTCCACAGGAGGG + Intronic
1142727084 17:1823644-1823666 GTAGACCCCATTTCACAGCAGGG + Intronic
1144966411 17:19079339-19079361 ATTATCCCCGTTCCACAGAAGGG - Intergenic
1144981507 17:19172718-19172740 ATTATCCCCGTTCCACAGAAGGG + Intergenic
1144986717 17:19205521-19205543 ATTATCCCCGTTCCACAGAAGGG - Intergenic
1146910703 17:36646716-36646738 GTTCTCCCCATTTTACAGATGGG + Intergenic
1146911472 17:36651076-36651098 ATTACCCCCATTCCACAGATGGG - Intergenic
1147263591 17:39222646-39222668 CTTCTCCCCATGCCAGAGAATGG - Intronic
1149975740 17:61264066-61264088 GTTAACCCCATTTTACAGACAGG - Intronic
1151259340 17:72904530-72904552 CTTCACCACATTCCTCAGAGTGG - Intronic
1151538066 17:74749660-74749682 GTTCACCCCAGTCCGCAGATGGG + Intronic
1152070378 17:78131263-78131285 TTTCACCCCATTTGACAGATGGG + Exonic
1153226586 18:2905102-2905124 GTTCACGCCATACAATAGAATGG - Intronic
1153427333 18:4980159-4980181 GTTCACCCCCTTCTGCAGATAGG + Intergenic
1155425949 18:25707676-25707698 CTTCAACACATTTCACAGAAAGG - Intergenic
1155894893 18:31312641-31312663 GTTTTCCCCATTCCACAGCCTGG + Intergenic
1157514649 18:48302194-48302216 TTCCTCCCCATTCCCCAGAAAGG + Intronic
1159105186 18:63996485-63996507 TTGCAACCCATTCCACATAAAGG - Intronic
1160965355 19:1744896-1744918 TTTATCCCCATTCCACAGATGGG + Intergenic
1161228249 19:3158051-3158073 TTTTATTCCATTCCACAGAAGGG - Intronic
1161337250 19:3721332-3721354 GTTTGCCCCATTCCACAGAGGGG - Intronic
1162049912 19:8026860-8026882 GTTCACCCCATTTTACAGCAAGG + Intronic
1162216820 19:9141640-9141662 GTTCACCAAATTCCACATACTGG + Intronic
1162339818 19:10085867-10085889 ATTCTCCCCATTTCACAGAGGGG + Intergenic
1163587659 19:18172904-18172926 CTTCTCCCCATTACACAGAAGGG + Intronic
1163697645 19:18772068-18772090 CTTGTCCCCATTCCACAGACGGG + Intronic
1165325887 19:35114673-35114695 GTTCACCCCGTTCCGGTGAAGGG + Intergenic
1165718471 19:38062418-38062440 GTTCTCCCCACTTTACAGAAGGG - Intronic
925015276 2:519424-519446 GATCTCCACATTCCTCAGAAAGG + Intergenic
926449260 2:12982520-12982542 TTTAACCCCATTTCTCAGAAAGG + Intergenic
929156590 2:38793890-38793912 GTTCAAACCATTGCCCAGAAAGG - Intergenic
930780623 2:55222085-55222107 GTTCATCCAATTTCTCAGAAAGG - Intronic
931598299 2:63975270-63975292 GTTCACCCTATGCCCAAGAATGG - Intronic
932420857 2:71600566-71600588 GGGCACCCCCTCCCACAGAATGG - Intronic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
934691640 2:96365206-96365228 GTTCCCCCCTTTCCACATACAGG - Intronic
942447702 2:176088960-176088982 GTTCTCTCCATCCCAAAGAAGGG + Intergenic
942794302 2:179798303-179798325 GGACACCCCATTCCTCAGAGTGG + Intronic
945194145 2:207222534-207222556 GTTCATTCAATACCACAGAATGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947477929 2:230468107-230468129 GTTCCCCCCATTTGACAGATGGG + Intronic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
949024783 2:241762011-241762033 GTTCCCTCCATTCCCCCGAAGGG - Intronic
1170628244 20:18045932-18045954 TTTCTCCCCATTTCACAGCATGG + Intronic
1173352256 20:42255980-42256002 GTTTACCCCAGTCTACTGAATGG + Intronic
1174429648 20:50458587-50458609 GTTAGCCCCATTTCACAGACGGG + Intergenic
1174819248 20:53713056-53713078 GCTCACCCCAGCCCCCAGAAAGG - Intergenic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1175063000 20:56260570-56260592 ATTCATCCCATTTTACAGAAGGG - Intergenic
1175886222 20:62292357-62292379 CTTCACCCCATGACCCAGAAAGG + Intronic
1176252975 20:64134373-64134395 GCTCTCCCCACTCCCCAGAAAGG - Intergenic
1176678545 21:9804064-9804086 GTTCATTCCATGCAACAGAAAGG - Intergenic
1179606930 21:42522721-42522743 CTTCACCCAATTCTACAGGACGG + Intronic
1180732533 22:17992872-17992894 TTTCACCCCATTTTACAGCAGGG - Intronic
1181517272 22:23422188-23422210 TTTCACCCCATTTTACAGCAGGG - Intergenic
1182975859 22:34623585-34623607 GCTCACCCCATTGCACAGCCTGG - Intergenic
1183454118 22:37912239-37912261 AGTCACCCCATCCCACTGAAGGG + Intronic
1184152829 22:42648594-42648616 GTTTGCCCCATTTCACAGATGGG - Intronic
1185043685 22:48518291-48518313 ATTCTCCCCATTTCACAGAGGGG - Intronic
1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG + Exonic
950106754 3:10393467-10393489 CCTCACCCCATTTCACAGATAGG + Intronic
950169609 3:10829178-10829200 GTTAACCCCATTTCACATATGGG - Intronic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
950659186 3:14456121-14456143 ATTCACCCCATTTTACAGATAGG - Intronic
951574375 3:24098892-24098914 GTTCTCCCCATTTCACAGATAGG - Intergenic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
953398087 3:42588957-42588979 TTTCATCCCATTTCACAGAGAGG - Intronic
953547547 3:43874816-43874838 GTTCACCACATTGCCCAGACTGG + Intergenic
955689554 3:61577940-61577962 GTTAAACCCATTTCACAGATGGG - Intronic
956040901 3:65143886-65143908 GTTATCCCCATTTCACAGATGGG + Intergenic
960953374 3:123013932-123013954 GTCTTCCCCATTCCACAGGAAGG + Intronic
962407853 3:135115644-135115666 GTTTACCTGATTCCACAGTAGGG - Intronic
963235864 3:142955251-142955273 GTTCACCCATTTCCAAACAAAGG - Intronic
964433603 3:156630095-156630117 GCTGACCCCAGTCCACAGCATGG + Intergenic
968133487 3:196206776-196206798 GTTCACGCCATTCCCCAGCCTGG + Intronic
968958874 4:3732673-3732695 GTTCCTCCCATTTCACAGATCGG - Intergenic
969624744 4:8296732-8296754 GTTCCCCACAGTCCACAGAGGGG - Intronic
975922370 4:79407549-79407571 CTTTATCCCATTCCAAAGAATGG + Exonic
979001793 4:115230471-115230493 TTAAACCCCATTGCACAGAAAGG + Intergenic
986741637 5:10710402-10710424 GTTCACCCCACTGCACTGAGAGG + Intronic
987979664 5:25066143-25066165 CTTCAGCCCATTACACATAATGG + Intergenic
989582704 5:43047926-43047948 CTTCACCAGATTCCACAGAGTGG + Intergenic
992033606 5:72749164-72749186 GTTCATCACATTGCTCAGAACGG - Intergenic
992744250 5:79803764-79803786 GTTCACCCCATTGCCCAGGCTGG - Intergenic
995415830 5:111911925-111911947 CTTCACCCCATTTTACAGATGGG + Intronic
997353391 5:133246923-133246945 TTTATCCCCATTTCACAGAAGGG + Intronic
1000013227 5:157253347-157253369 GTTCACCCCAATCCATCCAATGG - Exonic
1000043252 5:157500909-157500931 CTTGACCCCATTCCACAGACAGG + Intronic
1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG + Intergenic
1001550059 5:172596197-172596219 TTTCTCCCCATTCTACAGATGGG + Intergenic
1002089356 5:176795266-176795288 TTTATCCCCATTCCACAGAGCGG - Intergenic
1002332437 5:178453716-178453738 CTTCTCCCCATTCCACAGACAGG + Intronic
1004344695 6:14837883-14837905 GATAACCCCATTACACACAAAGG - Intergenic
1005290605 6:24375203-24375225 TTTCACCTCATTCCACAGGGAGG - Intergenic
1007698247 6:43747350-43747372 GTGGACCCCTTTCCACAGGACGG - Intergenic
1008076203 6:47148705-47148727 GCTAACCTCATTCCACAGATGGG + Intergenic
1010562724 6:77370330-77370352 GTTCTCTCCATTCCAGAAAATGG - Intergenic
1011652790 6:89522411-89522433 TTTCAGCTCATTCTACAGAAAGG - Intronic
1015695010 6:135970363-135970385 GTTCATCCCATTCCACACTCTGG - Intronic
1016814285 6:148289349-148289371 GCTCACGCCTTTCCACAGGAAGG - Intronic
1021227362 7:18043759-18043781 GTTAACCCCATTTTACAGATTGG - Intergenic
1022258087 7:28679352-28679374 GGTCTCCCCATTTCACAGAGAGG - Intronic
1022461756 7:30615331-30615353 CTTCATCCCATTTCAAAGAATGG - Intronic
1023823119 7:43991068-43991090 GGTCACTCCCTTCCACACAAGGG - Intergenic
1025245088 7:57310910-57310932 GTTAGCCCCATTTCACAGAGGGG - Intergenic
1027056892 7:75055791-75055813 GTTCCACCCATCCAACAGAACGG - Intronic
1028733301 7:94178250-94178272 GTTCTCCCTTTTCCACAGGATGG + Intergenic
1029354308 7:100039803-100039825 TTTCACCCCATTTCCCAGATGGG - Exonic
1029751383 7:102544506-102544528 GGTCACTCCCTTCCACACAAGGG - Intronic
1029769335 7:102643600-102643622 GGTCACTCCCTTCCACACAAGGG - Intronic
1030072088 7:105706655-105706677 GATCACCCCAGTCCCCAGAGGGG - Intronic
1030897952 7:115084980-115085002 GATGACCCCATTTGACAGAAAGG + Intergenic
1032427608 7:131834040-131834062 CTTCTCCCCATTTCTCAGAAAGG - Intergenic
1033725274 7:144109692-144109714 GATGACCCCATTCCCCAGCAGGG - Exonic
1033726947 7:144129222-144129244 GATGACCCCATTCCCCAGCAGGG - Exonic
1034754265 7:153600420-153600442 CTTCCCCCCATTCCTCAGAGTGG + Intergenic
1035062102 7:156076923-156076945 TATCAGCCCATTCAACAGAAAGG - Intergenic
1035314499 7:157989745-157989767 GTCCACCCCACTTCACAGATGGG + Intronic
1035616228 8:1003780-1003802 GGTCCCCCCATACCCCAGAATGG + Intergenic
1035888474 8:3319023-3319045 GATCACTCCCTTACACAGAATGG + Intronic
1038021355 8:23554171-23554193 GTTATCCCCATTCCACAAATTGG - Intronic
1038402751 8:27297958-27297980 GATCACCCCAGTCCATGGAAAGG + Intronic
1042864191 8:73343291-73343313 ATTAACCCCACTCCACAGATGGG + Intergenic
1042947315 8:74168191-74168213 ATCAACCCCATTCCACAGAATGG - Intergenic
1044087487 8:87958322-87958344 GTACACACCACTCCAGAGAAAGG - Intergenic
1045890783 8:107154600-107154622 GTTCAATACATTCCAAAGAAGGG + Intergenic
1047206532 8:122806840-122806862 GTTTGCCCCATTTCACAGATGGG + Intronic
1047505318 8:125475168-125475190 GTTCCCCCCATTTTACAGATTGG + Intergenic
1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG + Intergenic
1049272744 8:141704641-141704663 CATCACCCCATTCTACAGACGGG + Intergenic
1055365884 9:75544361-75544383 TTTAAGCCCATTCTACAGAAAGG - Intergenic
1055858075 9:80716348-80716370 TTTCACCGCATTGCACAGGATGG - Intergenic
1203663712 Un_KI270754v1:6603-6625 GTTCATTCCATGCAACAGAAAGG - Intergenic
1187378499 X:18778992-18779014 CTTCTCCTCCTTCCACAGAATGG + Exonic
1187410704 X:19048397-19048419 GTTATCCCCATTTCACAGATAGG + Intronic
1195293342 X:103450159-103450181 CTTCTCCCCATTCTACAGAGGGG - Intergenic
1196674403 X:118404386-118404408 GTTCACCATATTCCTCAGCAAGG - Exonic
1199810609 X:151345062-151345084 GTTGCCAGCATTCCACAGAAAGG + Intergenic
1199812306 X:151362045-151362067 GACCACCCCATTCCCCAGAGAGG + Intergenic
1199946078 X:152669295-152669317 CTTCCCCCCATTGCACAGATGGG + Intergenic
1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG + Intergenic
1201327513 Y:12779661-12779683 CATCCCCCTATTCCACAGAAAGG + Intronic