ID: 1083478757

View in Genome Browser
Species Human (GRCh38)
Location 11:62930189-62930211
Sequence CAGATTAAGGTGCAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083478757_1083478763 12 Left 1083478757 11:62930189-62930211 CCAGGCTCCTGCACCTTAATCTG No data
Right 1083478763 11:62930224-62930246 CTAGTCCCACTGCCCACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083478757 Original CRISPR CAGATTAAGGTGCAGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr