ID: 1083480907

View in Genome Browser
Species Human (GRCh38)
Location 11:62946100-62946122
Sequence AGGTGCTAGGAAAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083480900_1083480907 29 Left 1083480900 11:62946048-62946070 CCGTTGTAATGCAGAGGAATAAC 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083480907 Original CRISPR AGGTGCTAGGAAAAGTTTGA AGG Intronic
902848703 1:19134816-19134838 AGGTGCAGGGAAGAGTGTGAAGG - Intronic
904993241 1:34610839-34610861 AGATGAAAGGAAAAGTTTGAAGG + Intergenic
905129748 1:35745091-35745113 AGCTGCCAGGGAAAGTATGATGG - Intronic
906818263 1:48901785-48901807 GGGCACAAGGAAAAGTTTGAGGG + Intronic
907621428 1:55984894-55984916 AGGTGCTACTAAAAGTCAGAAGG - Intergenic
908140509 1:61179578-61179600 AGGTGCTAGCAGAGCTTTGAGGG + Intronic
909627322 1:77732347-77732369 GGGTGGTAGGAAAAGAGTGAAGG - Intronic
910546425 1:88423644-88423666 AGGTTGTAGTAAAATTTTGATGG - Intergenic
912827525 1:112919433-112919455 AGCTACTAGGAAATTTTTGATGG + Intronic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916294622 1:163203800-163203822 AGGAAGCAGGAAAAGTTTGAAGG - Intronic
918251966 1:182710909-182710931 AGGTGCTGGGGAAAGGTTGCAGG - Intergenic
921054141 1:211531453-211531475 AGGTGCTTGGAACAGTTCTAGGG + Intergenic
921573816 1:216810071-216810093 AGCTCCTAGGAACAGTTTGCAGG - Intronic
923959619 1:239062758-239062780 TAGAGCTAGGAAAAATTTGATGG - Intergenic
1063856458 10:10259446-10259468 AGGTGGTGGGAAAAGTTGCATGG + Intergenic
1067239232 10:44476318-44476340 AGGTGCAAGAAGGAGTTTGAAGG - Intergenic
1068026056 10:51645712-51645734 AGGTGCTCAGAAAATTTTGAAGG - Intronic
1069942648 10:71965570-71965592 AGGTGCAAGGAAAATAATGAAGG - Intronic
1070055218 10:72927867-72927889 AGGTGCCAGGAAAGGCTTCATGG - Intronic
1073204946 10:101763879-101763901 AGGCGTTAGGAAATGTCTGAAGG - Intergenic
1073976566 10:109108550-109108572 AGGTCCTAGGCAGAGTTTGATGG - Intergenic
1074664952 10:115711504-115711526 AGATGCAAGGCAAAGTTAGAGGG - Intronic
1075728132 10:124621001-124621023 AGGTGGCAGGCAAGGTTTGAGGG + Exonic
1075872220 10:125779274-125779296 AGGTGCTAGGAATAGAATTAGGG + Intergenic
1077921083 11:6642116-6642138 AGGAGAGAGGAAAAGGTTGACGG - Intronic
1080240623 11:30123167-30123189 AGGTTATAGGAAAAGTTATATGG - Intergenic
1080261463 11:30353855-30353877 AGGTGTTGGGAAAAGTATGCAGG - Intergenic
1081393943 11:42562794-42562816 AGGTGCTAGTGAAGGTTTGTAGG - Intergenic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1085952112 11:81344561-81344583 AGGCACTAGGCTAAGTTTGAAGG - Intergenic
1086331158 11:85755753-85755775 AGGTGCCAAGAAAAGATAGAAGG + Intronic
1088449946 11:109970786-109970808 TGGTGTTAGGAAACTTTTGAGGG - Intergenic
1088515733 11:110631536-110631558 AGGTGCTGGGTGTAGTTTGATGG - Intronic
1088544614 11:110947004-110947026 ATGTGCCAGGCAAAGTGTGAGGG - Intergenic
1089932444 11:122327507-122327529 TGGTGGGAGGAAAAGTTTAAAGG + Intergenic
1091562175 12:1623154-1623176 AGGAGATAGGAAACCTTTGAAGG + Intronic
1094003012 12:25716502-25716524 TGGTGATGGGAAAAGTCTGAGGG + Intergenic
1095642244 12:44499292-44499314 AGATGTTAGTAAAAGTTTAATGG - Intergenic
1097752853 12:63377443-63377465 ATGTGCTATCAAAAGTTTGCAGG + Intergenic
1099712193 12:86242105-86242127 AGGTTCTAGGAAAATATTTAAGG + Intronic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1105632032 13:22179097-22179119 AGGTGTGAGGAAACTTTTGAGGG - Intergenic
1108105399 13:47003247-47003269 GGGTGCTAGGAAGAGTGGGAAGG - Intergenic
1108546302 13:51498669-51498691 AGGAGGTAGGAAAAGCTTGCAGG + Intergenic
1111769038 13:92573148-92573170 ACTTGCTAGTGAAAGTTTGAGGG - Intronic
1112724832 13:102291451-102291473 TGGTGCTAGGAGAAGCTTAAAGG + Intronic
1113241381 13:108341717-108341739 AGGTGCTAGTAAGAATTTGGAGG - Intergenic
1114367583 14:22046506-22046528 AGGTGAAAGGAAAAGATTAAGGG - Intergenic
1115114292 14:29861138-29861160 AGGTGCTAGTCATAGTTTGTTGG - Intronic
1119566962 14:75636959-75636981 AGTTGGTAGGAAGAGTGTGAGGG + Intronic
1123466651 15:20521441-20521463 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123651463 15:22479600-22479622 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123741881 15:23288461-23288483 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123745115 15:23314097-23314119 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124267858 15:28253506-28253528 AGGTGAGAGGAGAAGTTGGAGGG - Intronic
1124277386 15:28337417-28337439 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124305316 15:28574189-28574211 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1128465743 15:67909608-67909630 AGGTGCTCAGATAGGTTTGATGG + Intergenic
1128716411 15:69911654-69911676 AGGAGAAAGGGAAAGTTTGAAGG + Intergenic
1131224822 15:90615792-90615814 AAATGCTGGGAAAAGTTTGAAGG - Intronic
1132120453 15:99170974-99170996 ATGGGGTAGGAATAGTTTGAGGG + Intronic
1133576492 16:7096494-7096516 AGGCTCTAGGAAAAGTTTTGAGG + Intronic
1138363536 16:56452917-56452939 ATGTGCTACCCAAAGTTTGAGGG + Intronic
1141502350 16:84452832-84452854 TGGTGCTGGGAAAAGGTTCACGG + Intronic
1143824815 17:9596636-9596658 AGTTGCAAGGAAAATTTTAAAGG - Intronic
1145004844 17:19332045-19332067 TGGTGCCAGGAAAGGGTTGAGGG - Exonic
1147338842 17:39742171-39742193 AGGTGCTAGGTAAACTCTGAGGG + Intronic
1148087090 17:45000848-45000870 AGGTGCCAGGCAGAGTGTGATGG - Intergenic
1151338170 17:73452588-73452610 AGGTGTTAGGAAAGGGATGATGG + Intronic
1152668519 17:81586623-81586645 AGATGCTTGCAAAAGTTTTAAGG + Intronic
1152695439 17:81741626-81741648 GGGTCCTAGGGAAAGTTTGGTGG - Intergenic
1153060867 18:993931-993953 CTGAGCTAGGAAAAATTTGAAGG + Intergenic
1153656193 18:7284510-7284532 ATGTGCCAGGAAGAGTTCGAAGG + Intergenic
1154968321 18:21381761-21381783 AGATTCAAGGAAAAGTTTGCTGG + Intronic
1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG + Intronic
1157733238 18:50022850-50022872 AGGTTCTAGGACAGGTTTAAGGG + Intronic
1158296674 18:56004045-56004067 AGCTGTTTGGAAAAGCTTGATGG - Intergenic
1160321383 18:77899662-77899684 AGGTGCTGGGCACATTTTGATGG + Intergenic
1161688456 19:5716308-5716330 TGGTGCCTGCAAAAGTTTGAGGG - Intronic
1163323926 19:16591135-16591157 AGGTCCTAGGAAAAGTAGGAGGG + Intronic
926797887 2:16633815-16633837 AGGTGGTAGGAAATACTTGAAGG - Intronic
927928634 2:27029882-27029904 AGGTGCTTAGAAAAGGTTGCTGG + Intergenic
929211536 2:39362965-39362987 AGGTGCTGGGAAAAACTGGATGG + Intronic
930666164 2:54100915-54100937 AGGTGCTAGGAGACTCTTGAAGG + Intronic
932322467 2:70832287-70832309 AGCTGCTAGGACTAGTTAGATGG + Intronic
933029739 2:77313284-77313306 AGGTCCCAGGAAAAGTTAGGGGG - Intronic
933315809 2:80713646-80713668 AAGTGATAAGAAAAGTTGGAGGG + Intergenic
935548818 2:104430303-104430325 AGGTGAAAGGAAATGTTGGAGGG - Intergenic
935637937 2:105264335-105264357 AGGTGCTAGGAAAAGCAAGAAGG + Intergenic
935900803 2:107790655-107790677 AGGTGAGAGAAAAAGTGTGAAGG + Intergenic
936631634 2:114209430-114209452 AGAGGCTAGGAAAAGTGGGAAGG + Intergenic
937327856 2:121002789-121002811 AGGAGGAAGGAAAAATTTGAGGG + Intergenic
937399409 2:121568884-121568906 AGGTGGCAGGAATAGTTTGGAGG + Intronic
939594038 2:144102983-144103005 AGGTGATAGTGAAAGTTTGGTGG - Intronic
939786076 2:146514885-146514907 AGGTGCTAGGAACAGGTGAATGG + Intergenic
941695323 2:168544793-168544815 TGGTGCTGGGAACAGTTGGATGG + Intronic
943098583 2:183458692-183458714 AGGTGTTAGGAAAAGCTGGGTGG + Intergenic
943662962 2:190578582-190578604 AGATGCTAGGAGAAGACTGAGGG + Intergenic
946915001 2:224509733-224509755 AGGGGATAGGAAATGTTTGATGG - Intronic
947500094 2:230665253-230665275 AGATGCTAGTGAAAGTCTGAAGG - Intergenic
947666703 2:231910565-231910587 AGGTGCTGGCAGAAGTTTGCTGG - Intergenic
947934786 2:233994842-233994864 AGGTGCAATGAACTGTTTGAAGG - Intronic
1169149028 20:3274893-3274915 GGGGGCAAGGAATAGTTTGAAGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1173810571 20:45952725-45952747 AGGTTCTAGGAGAAGATGGAGGG + Intronic
1175002427 20:55643569-55643591 ATGTGCTAAGAACAGATTGATGG - Intergenic
1175109782 20:56639533-56639555 AGGTGTTGGGAAATGTCTGAGGG + Intergenic
1177558785 21:22723954-22723976 AGCTTCTAGGAAATGATTGAAGG - Intergenic
1177822698 21:26049073-26049095 AGTTGGTAGGAAATATTTGATGG - Intronic
1177871110 21:26573358-26573380 AGGGGTTAGGAAAAGTTTCTTGG - Intergenic
1178512500 21:33217331-33217353 ACATGGTGGGAAAAGTTTGATGG + Intergenic
1179556177 21:42178171-42178193 AGATGCTAGCATAAGTTTAAGGG - Intergenic
1181620064 22:24084978-24085000 AGGTGAGAGGAAAAGTATGAGGG - Intronic
1182190421 22:28454298-28454320 ATATGCTAGGAAATGTTTTAAGG - Intronic
1182454780 22:30443344-30443366 AGGAGCTAAGAAAAGTACGAGGG - Intergenic
1182736283 22:32533854-32533876 AGCTGCTCGGAAATGTTTGGCGG - Exonic
949143035 3:658621-658643 AAGAACTAGGAAAATTTTGATGG + Intergenic
949849836 3:8411644-8411666 AGGTGCTGTGAAAAGAATGATGG - Intergenic
949947070 3:9198713-9198735 AGGTGCAAGGAAGAGGTTGCAGG + Intronic
951633057 3:24742176-24742198 AGGTGTTAGCAAAAGTATCAGGG + Intergenic
952320617 3:32274421-32274443 AGGCGCTAAGAAAAGTTGTAAGG + Intronic
952779560 3:37082186-37082208 AGGCTCTAGGAAAAGCATGATGG + Intronic
955022437 3:55134133-55134155 AGGAGCTATGAAAGGTTTAAAGG - Intergenic
956953074 3:74304627-74304649 AGGAGTAAGGAAAAGTTTGGTGG + Intronic
957947286 3:87081298-87081320 AGTTGGTAGGCAAATTTTGATGG + Intergenic
960323155 3:116262731-116262753 AGGAGCAAGGAAAAAGTTGAAGG + Intronic
960426245 3:117511216-117511238 AGGGGCTAGGAAAAGGATGTTGG - Intergenic
963342976 3:144059797-144059819 TAGTGCTAGAGAAAGTTTGAGGG + Intergenic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
965940250 3:174170257-174170279 AGGAGGTGGGAAATGTTTGATGG - Intronic
967709179 3:192686044-192686066 AGGAGCTAGAAAGAGTTGGAAGG + Intronic
970102755 4:12544081-12544103 TGCTGTTAGGAACAGTTTGAAGG - Intergenic
970537300 4:17042456-17042478 AGGTGCTGGGAAGAGACTGAGGG - Intergenic
970563642 4:17309149-17309171 AGGTGCTAGGAAATTGTAGAAGG - Intergenic
973616459 4:52683361-52683383 AGGTGTTAGGGTAAGATTGAAGG + Intergenic
976411429 4:84717532-84717554 GGGTGCTAGGAAAATGTTAAAGG + Intronic
976825231 4:89253441-89253463 ACCTGCTACGAAAAGTTGGAAGG + Intronic
976865285 4:89718166-89718188 AGCAGCTAGCCAAAGTTTGAGGG - Intergenic
977708737 4:100100304-100100326 AGAAGCTGGGAAAAGATTGAGGG - Intergenic
979265663 4:118699254-118699276 AGCTAATAGGAAAAGTTTCAAGG - Intronic
980073954 4:128274192-128274214 AGATGATAGAAAAAGTTTGAAGG - Intronic
983015432 4:162607129-162607151 AGGTGGTTGGAAGAGTTTAACGG + Intergenic
983461417 4:168029246-168029268 CTGTGATAGGAAAAGTTTGGAGG + Intergenic
983498921 4:168477802-168477824 AAGTGATTGGAAAAGGTTGATGG + Intronic
983706733 4:170670229-170670251 AGGTGCAAGGTAAAGATTCAAGG - Intergenic
986903371 5:12464434-12464456 AGGTACTAGAAAATGTTTGAAGG + Intergenic
988689407 5:33557455-33557477 ATGTGCTAAGAAAGATTTGAAGG - Intronic
990389565 5:55305117-55305139 AGGAGGTAGGAACAGTTTTATGG - Intronic
990821188 5:59842027-59842049 AGGTGCTAGGAAGTTATTGAAGG + Intronic
993403378 5:87481006-87481028 AGGTCCAGGGAAAAGTGTGAAGG - Intergenic
995931912 5:117455876-117455898 AGGTGCTAGGGAATGTCTGCGGG + Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997254910 5:132421011-132421033 AGGTGCTATGAATATATTGAAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1004192621 6:13477418-13477440 AGGAGTCAGGAAAAGATTGAGGG - Intronic
1005468322 6:26137069-26137091 ACCTGCTAGGATAAGTTTGTTGG + Intronic
1006089011 6:31616731-31616753 GGGTGCTAGGAAAGGCTAGAAGG - Intronic
1008419193 6:51277081-51277103 AGGTGTGAGGACCAGTTTGAAGG + Intergenic
1008793699 6:55273200-55273222 AGGGGCAAGGAAAATTTTCATGG + Intronic
1008795315 6:55295502-55295524 AAGTACTTGGAAAAGTTTAAAGG + Intergenic
1009758669 6:67975874-67975896 ATGTTCTAGGAAAAGTGTTAAGG + Intergenic
1010175791 6:73026503-73026525 AGGTGCTGGGAAGAGATGGAAGG - Intronic
1010678914 6:78776446-78776468 AGGTGCTTGAAAAGGTTTGTGGG + Intergenic
1010950902 6:82035772-82035794 AGGTGCCAGGAAAATTTTCTTGG + Intergenic
1012411225 6:98959751-98959773 AAGAGGTAGGAGAAGTTTGAAGG - Intergenic
1012447741 6:99323890-99323912 GGGTACCAGGAAAGGTTTGATGG - Intronic
1012835222 6:104256062-104256084 AGGTGCTAGGTAAAGTGTAGGGG - Intergenic
1013137199 6:107294011-107294033 AGGGGTTAGGAAAAATGTGAAGG + Intronic
1013431181 6:110056225-110056247 AAGTGATAGGAAAAGAATGAGGG - Intergenic
1014681803 6:124440321-124440343 AGTTGCAAGAAAAAGTTTAATGG + Intronic
1016158281 6:140842541-140842563 ATGTGTTAAGAAAAGTTTTAAGG - Intergenic
1017943208 6:159071635-159071657 AGGTGCCAGGAAAGGTTTCCTGG - Intergenic
1017947603 6:159108344-159108366 AGGTTGTAGGAACATTTTGAGGG - Intergenic
1021361211 7:19714809-19714831 ATGTGGTACGGAAAGTTTGAGGG + Intergenic
1022149066 7:27580449-27580471 AAATGCTAGGAAAAGTTTTCAGG + Intronic
1022636416 7:32140558-32140580 AGCTGTCAGGAAAAGTGTGAAGG - Intronic
1024086265 7:45894260-45894282 AGGTGCTAGGAAAGATGTGGAGG - Intergenic
1028613562 7:92738857-92738879 GTGGGCCAGGAAAAGTTTGAAGG - Intronic
1029005272 7:97202820-97202842 AGGTGCTAGGAAAACTAAAAAGG - Intergenic
1030776670 7:113542198-113542220 GGGTGCTAGAAAAAGTAAGATGG - Intergenic
1031797360 7:126192396-126192418 TGGTGCTAAGTAAAATTTGAAGG + Intergenic
1033291225 7:140084446-140084468 AGGTGTTAGGAAATATTTGTGGG + Intergenic
1033435410 7:141329247-141329269 AGGGGGTGGGAAGAGTTTGAGGG - Intronic
1033794565 7:144832389-144832411 AGTTGCTAAGAAAAGTTTTGTGG - Intronic
1035905371 8:3503845-3503867 AGGGGCTAGGAAGAGTGTGGGGG - Intronic
1037683263 8:21116537-21116559 AGCTGCCAGGAAAAGGTTGGGGG - Intergenic
1038158268 8:25011815-25011837 AGGTGCCAGAAAAAGGTTCAAGG - Intergenic
1039325211 8:36477996-36478018 AGATGATAAGAAAAGATTGAGGG - Intergenic
1041648574 8:60279084-60279106 AAGTGGTAGGAGAAGTTTCATGG + Intronic
1041767986 8:61439919-61439941 AAGAGCTAGCAAAAGATTGATGG - Intronic
1042328064 8:67548756-67548778 GGGTGGTAGGCAATGTTTGAGGG + Intronic
1044589338 8:93898579-93898601 AGGGGCCCGGGAAAGTTTGAAGG + Intronic
1044958050 8:97502383-97502405 AGATTCTAGGTAAATTTTGAAGG + Intergenic
1048142035 8:131804112-131804134 AGGGACTAGGAAAAGATGGAGGG + Intergenic
1048378268 8:133842213-133842235 AGGTGCTATGAAAAGCTTTAAGG - Intergenic
1048811928 8:138296281-138296303 AGATGGGAGGATAAGTTTGAAGG - Intronic
1049536550 8:143185311-143185333 AGGTGATAGGAATTATTTGAAGG - Intergenic
1051795486 9:20864395-20864417 TGGAGGAAGGAAAAGTTTGAAGG - Intronic
1052651744 9:31312073-31312095 ATATGCTAAGAAAAGTCTGAAGG - Intergenic
1053555698 9:39134782-39134804 AGTTGATAGGAAAACTCTGAAGG - Intronic
1053819816 9:41955040-41955062 AGTTGATAGGAAAACTCTGAAGG - Intronic
1054110082 9:61098699-61098721 AGTTGATAGGAAAACTCTGAAGG - Intergenic
1054610775 9:67232426-67232448 AGTTGATAGGAAAACTCTGAAGG + Intergenic
1054831079 9:69625479-69625501 ATGTGCTAGGAACAGTTCTAGGG - Intronic
1054925831 9:70587906-70587928 AGGTGGTAGGCAAAGTTTCCGGG + Intronic
1057153097 9:92812276-92812298 AGGTGGGAGGAAAAGCTTCAAGG - Intergenic
1058123050 9:101159981-101160003 ATGTACTAAGAAAAATTTGATGG + Intronic
1059815888 9:117914303-117914325 AATTGTTTGGAAAAGTTTGAGGG - Intergenic
1061783133 9:133007546-133007568 AAGTGCTAGGTACAGTTGGATGG - Intergenic
1186385543 X:9106985-9107007 TCGTGCTTGGAAAAGTTAGAAGG - Intronic
1187459829 X:19477242-19477264 AGGTGCAGAGAAAAGTTTTATGG + Intronic
1189070795 X:37861845-37861867 AGGTTCTAGAAAAAGTGAGATGG + Intronic
1189155998 X:38757298-38757320 AGGTGCATGGAAATGTTTTATGG + Intergenic
1189447698 X:41096029-41096051 AGGTGGCAGGAAAAGTTGAAAGG - Intronic
1189888211 X:45571524-45571546 AGGTGTTAAAAAAAGTTTTATGG + Intergenic
1191137520 X:57082238-57082260 AGTTGATAGGAGAAGTTTAAGGG + Intergenic
1192305868 X:69958863-69958885 AGGGATTATGAAAAGTTTGATGG - Intronic
1195560962 X:106283136-106283158 AGGTGCTAGGTAAAGTCTCTAGG - Intergenic
1195590775 X:106623044-106623066 AGGTGAGAAGAAAAGGTTGAAGG - Intronic
1197810063 X:130433361-130433383 AGGTGCTAGTAAATATTTGTGGG - Intergenic
1202251667 Y:22879592-22879614 GGGTGCTAGGCAAAGTTCTATGG + Intergenic
1202404655 Y:24513341-24513363 GGGTGCTAGGCAAAGTTCTATGG + Intergenic
1202466124 Y:25156741-25156763 GGGTGCTAGGCAAAGTTCTATGG - Intergenic