ID: 1083484392

View in Genome Browser
Species Human (GRCh38)
Location 11:62974336-62974358
Sequence GCATCTGAGGCCACTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083484383_1083484392 28 Left 1083484383 11:62974285-62974307 CCTGGGCAACAGAGAAAGACACT 0: 7
1: 614
2: 14505
3: 63286
4: 147542
Right 1083484392 11:62974336-62974358 GCATCTGAGGCCACTCTGGTGGG 0: 1
1: 0
2: 2
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083484392 Original CRISPR GCATCTGAGGCCACTCTGGT GGG Intronic
900165105 1:1241389-1241411 GCCCCTGACGCCACTCTGGGGGG + Intergenic
900814980 1:4836822-4836844 GCAGCTGAGGCCACTGTGGTGGG + Intergenic
902817181 1:18922968-18922990 GCATCTGGGGCTTCTCTGGGGGG + Intronic
905363866 1:37438286-37438308 GCCTCTGATGCCACCCTGGATGG + Intergenic
906722606 1:48020015-48020037 GCAGCTGAGGCCTGTCTGGCAGG - Intergenic
907425919 1:54379251-54379273 GCATCTGAGGGCACCCAGGGTGG - Intronic
909595892 1:77405777-77405799 CTATCTCAGGCCAGTCTGGTAGG - Intronic
913195660 1:116454285-116454307 GCCTCTGAGCTCACTCTGCTTGG + Intergenic
919051926 1:192522300-192522322 GCATCTCAGGCAATTATGGTAGG + Intergenic
921164854 1:212499632-212499654 GAATTTGAGGCCACTGTGGCTGG + Intergenic
922497613 1:226071354-226071376 GCAAGTGAGGCCTATCTGGTTGG + Exonic
1065916518 10:30358215-30358237 GCACCTGAGGCCCTTCTGGGTGG - Intronic
1067039899 10:42943720-42943742 GCTTCTGACACCACTCTGGCAGG - Intergenic
1070594274 10:77821365-77821387 GAGTCAGAAGCCACTCTGGTGGG - Exonic
1073025787 10:100486445-100486467 GCATTTGTGGTCACTCTGCTGGG - Intergenic
1073774797 10:106773378-106773400 GGGTCTGTGGCCACTCAGGTGGG - Intronic
1074519047 10:114200331-114200353 GCATTTGAGGCCAGACTGGTTGG + Intronic
1075828748 10:125384814-125384836 GCAAGTGAGTCCACACTGGTGGG + Intergenic
1076814137 10:132906347-132906369 GCTTCTGAGGCCACCCAGCTGGG - Intronic
1077179802 11:1207225-1207247 GCATCTGAGGCCTCCAGGGTGGG - Intergenic
1077442031 11:2573365-2573387 GCATCTGACGCCGCTCTCCTTGG - Intronic
1078465478 11:11546958-11546980 TCATCTGATGCCTCTCTGGGAGG + Intronic
1078725171 11:13923716-13923738 GCTAATGAGGCCACTCGGGTTGG - Intergenic
1079131102 11:17747413-17747435 GCATCTGAGGTCCCTGTGCTTGG - Intronic
1079844452 11:25447473-25447495 TCCTCTGAGGCCACTCTCCTTGG + Intergenic
1080423909 11:32138804-32138826 GCATCAGAGGCCACTGTTCTGGG - Intergenic
1081662690 11:44897573-44897595 GCACCTGAGGCCACTCCAGCGGG - Intronic
1083184135 11:61007787-61007809 GCAGCTAATGCCACTCTGGCCGG + Exonic
1083484392 11:62974336-62974358 GCATCTGAGGCCACTCTGGTGGG + Intronic
1085369145 11:75982181-75982203 TCCTCTGAGACCTCTCTGGTAGG + Intronic
1085539544 11:77253987-77254009 GGATGTTAGGCCACTCTGTTGGG + Intronic
1087608570 11:100406819-100406841 TCATCTGAGGGCTCTCTCGTTGG - Intergenic
1090255294 11:125279577-125279599 GCATCTGAGGGGCATCTGGTGGG + Intronic
1092659112 12:10720491-10720513 ACGTTTGAGGCCACTCTGATTGG + Intronic
1093567848 12:20629742-20629764 ACATCTGAAGCCAGTGTGGTTGG - Intronic
1104097300 12:125569385-125569407 GCATCCGAGGCCACTGTGACGGG - Intronic
1104621774 12:130319222-130319244 TCATCTGGGGCGACTCTGGTGGG - Intergenic
1105829540 13:24151686-24151708 GAAGCTGAGCCCTCTCTGGTAGG - Intronic
1106595110 13:31128996-31129018 GCATCTGAGGAAACAGTGGTGGG - Intergenic
1107039808 13:35936804-35936826 GCATCTGAGGCCAATAGGGAGGG + Intronic
1107947768 13:45435012-45435034 GCACCTGGGGCCAGTCTGGCAGG + Intergenic
1109832680 13:67812769-67812791 CCATCTGAGACCACTCAGCTTGG + Intergenic
1109939651 13:69344883-69344905 GCATCTGGGTCCAGTGTGGTAGG + Intergenic
1110105886 13:71675349-71675371 GCAAGTGAGGCCTATCTGGTTGG + Intronic
1117630620 14:57687086-57687108 CCATCTGAGGCCTCTCTCCTAGG - Intronic
1117826623 14:59710745-59710767 GAATGTGAGGCCACTCAGATGGG - Intronic
1118061297 14:62140443-62140465 GCATCTGAATCCTCTTTGGTAGG + Intergenic
1118073167 14:62268519-62268541 TCTTCTGAGGCCTCTCTTGTTGG + Intergenic
1118773104 14:68955491-68955513 GGATCAGAGGTCACTCCGGTGGG + Intronic
1118952444 14:70446826-70446848 GTACCTGAGGCCACTGGGGTGGG + Intergenic
1119313216 14:73668631-73668653 TCTTCTGAGGCCGCTCTGCTTGG + Intronic
1121089432 14:91170938-91170960 GCAGCTGGGGCCTCTCTGGCAGG - Intronic
1121247401 14:92471990-92472012 GCATCTGAGGCCTCCCTGCCTGG + Intronic
1121536645 14:94695554-94695576 GCATCTGAACTCACTCTGCTTGG + Intergenic
1121716157 14:96077551-96077573 TCTTCTGAGGCCTCTCTCGTTGG - Intronic
1121722657 14:96121529-96121551 TCCTCTGAGGCCTCTCTCGTTGG - Intergenic
1123479312 15:20616264-20616286 GCATCTGGGGCCTCTCTGGCTGG - Intergenic
1123638701 15:22384121-22384143 GCATCTGGGGCCTCTCTGGCTGG + Intergenic
1124161295 15:27272117-27272139 GCCTCTGAGGACAGTCTGGATGG - Intronic
1125465826 15:39951475-39951497 GCAAGTGAGGCCTATCTGGTTGG - Intronic
1125635515 15:41185162-41185184 GCAGCTGAGGCCAGGCTGGAAGG - Intronic
1125883130 15:43210247-43210269 GTTTCTGAGGCCACGGTGGTGGG + Intronic
1128178586 15:65580042-65580064 CCCTCTGATGCCACTGTGGTGGG + Intronic
1130536646 15:84790206-84790228 GGATCTGAGACCACCCTGATTGG - Intronic
1132326873 15:100977724-100977746 TCCTCTGACGCCACTCTGGTGGG - Intronic
1135271833 16:21076322-21076344 GCTTCTGAGGCCTCTCTCCTTGG - Intronic
1135586379 16:23674860-23674882 TCTTCTGAGGCCTCTCTGCTTGG + Exonic
1135775791 16:25257018-25257040 GCATCAGAGCCCATTCTGGAAGG - Exonic
1137869362 16:51934531-51934553 TCCTCTGAGGCCTCTCTGCTTGG - Intergenic
1139515276 16:67449084-67449106 GCATTTGAGGCCACTGTCCTGGG + Intronic
1141216248 16:82026981-82027003 GTATATGAGACCACTGTGGTAGG - Intergenic
1141519158 16:84566253-84566275 GCATCTTAGGCAACTCCGGATGG + Exonic
1141836601 16:86544541-86544563 GCATCTGTGGCCATTCTGACTGG - Intronic
1144962729 17:19055088-19055110 GAAGCTGAGGCCACCCTGGCTGG - Intergenic
1144972432 17:19119433-19119455 GAAGCTGAGGCCACCCTGGCTGG + Intergenic
1146137573 17:30336741-30336763 GCACCTGAGGCCACTCTGCATGG - Intergenic
1146423105 17:32707924-32707946 GCATCTGGTGCCACTCTACTGGG + Intronic
1147184132 17:38704770-38704792 TCCTCCGAGGCCACTCTGGAGGG - Intergenic
1150520902 17:65865982-65866004 GCAGCTGTGGTCACTCAGGTCGG + Intronic
1150640530 17:66946686-66946708 GCATGTGAGGAAGCTCTGGTGGG + Intergenic
1157676925 18:49575699-49575721 GCATTGGAGGCCTCTGTGGTGGG - Intronic
1160009975 18:75099805-75099827 CCATATGAGGCCAATTTGGTTGG + Intergenic
1163777200 19:19225483-19225505 CCAGAGGAGGCCACTCTGGTGGG + Intronic
924964744 2:65370-65392 GCTTGTGAGGCCACTGTGGGAGG + Intergenic
925673748 2:6338970-6338992 GCATCTGTGGCTGCTCTGCTTGG + Intergenic
926235972 2:11044264-11044286 GCAACTGATGCCTCTTTGGTGGG + Intergenic
929839651 2:45444776-45444798 GCATCAGAAGCCACTCAAGTTGG + Intronic
930538240 2:52670965-52670987 AGTTCTGAGGCCCCTCTGGTAGG + Intergenic
931431405 2:62211720-62211742 GCTTCTGAGGCCACACTAGAAGG - Intronic
932865747 2:75340000-75340022 GCATCTTAGGCCACCCTTGAAGG + Intergenic
933806916 2:86005218-86005240 GCCTTAGAGGCCACTGTGGTAGG + Intergenic
935531007 2:104232711-104232733 GCATTGGATGCCACTCAGGTGGG + Intergenic
939684961 2:145188062-145188084 GCTTCTGAGGCCTCTCTCCTTGG + Intergenic
940927857 2:159387091-159387113 GCATCTGTGGGCTCTATGGTTGG + Intronic
942319091 2:174720193-174720215 GCAAGTGAGGCCTATCTGGTTGG + Intergenic
942442801 2:176053473-176053495 GCACTTGAGGCTACTCTGATGGG + Intergenic
942712424 2:178851576-178851598 TCATCTCAGGCCACTCTGCTTGG - Intronic
944912465 2:204323959-204323981 ACATGTGAGGCCACTCTGGTGGG + Intergenic
945493152 2:210479179-210479201 CCATCTGAGGCCTGTCTTGTTGG + Intronic
948083585 2:235227470-235227492 GAATCTCAGGCCAATCTGATTGG + Intergenic
948231677 2:236353678-236353700 GCATCTGAGAGCTCTGTGGTGGG + Intronic
948860396 2:240750093-240750115 CCATCTGAGCCTGCTCTGGTTGG - Intronic
1170684751 20:18559298-18559320 GCCTCTGAGGCCACCCCAGTAGG + Intronic
1171848884 20:30294185-30294207 GGCTCTGAGGTCACTTTGGTAGG + Intergenic
1172903518 20:38351644-38351666 TCTTCTGAGGCCACTCTCTTTGG + Intronic
1173284472 20:41657718-41657740 GCCTCTGAGTCCACTCAGCTGGG - Intergenic
1175892534 20:62321909-62321931 GCAGCTGGGACCACTCTGGGAGG + Intronic
1177207204 21:18023547-18023569 GCATCTGGGTCCACTCTTGTTGG + Intronic
1177359468 21:20049552-20049574 CCATCTGAGACCACTCAGCTTGG - Intergenic
1177519467 21:22200216-22200238 CCATATGAGGCCACACTGGGAGG - Intergenic
1177736789 21:25101132-25101154 GGATGTGAGGCCAATCTGGCTGG + Intergenic
1178290483 21:31363808-31363830 GTTTCTGAGGAAACTCTGGTTGG + Intronic
1178796731 21:35751970-35751992 GCCTCTGAGGCCACTCCTGCAGG - Intronic
1179101249 21:38357173-38357195 GCTTCTGAGGCCTTCCTGGTGGG + Intergenic
1179599344 21:42465693-42465715 GCCTCAGAGGACACTCTTGTTGG - Intergenic
1181039995 22:20187589-20187611 CTGTCTGAGGCCACTCTGGGTGG + Intergenic
1181621945 22:24097061-24097083 GCATGGCAGGCCACTCAGGTGGG + Intronic
1184549627 22:45197542-45197564 GCATCTGTGGCCACTCAAGAGGG + Intronic
1185086071 22:48741708-48741730 GCTTCTGAGGCCCCTCTCCTCGG - Intronic
949942125 3:9163244-9163266 GCATCAGCGCCCACTCTCGTGGG + Intronic
953960025 3:47259463-47259485 CAAGCTGAGGCCACTCTGGGAGG - Intronic
954274348 3:49532681-49532703 GCCTCTGAGGGCACTCTCCTGGG - Exonic
954454232 3:50588440-50588462 GCTCCTGAGGCCCCTCTGGGGGG - Intergenic
954639561 3:52089894-52089916 GCATCTGGTTCCACACTGGTGGG - Intronic
954772420 3:52983729-52983751 GTATTTGAGGCCACAGTGGTTGG + Intronic
956607123 3:71084022-71084044 TCATCTGATGCCATTCTGGGAGG + Intronic
956930297 3:74035752-74035774 TCTTCTGAGGCCTCTCTGTTTGG + Intergenic
958128065 3:89382914-89382936 GCATCTGAGGCCTCACTGACTGG - Intronic
958860439 3:99438751-99438773 TCTTCTGAGGCCTCTCTGCTTGG - Intergenic
960331882 3:116369910-116369932 TCTTCTGAGGCCTCTCTTGTTGG - Intronic
961243863 3:125434969-125434991 GAATCTGGGCCCACTATGGTTGG + Intergenic
969472742 4:7399261-7399283 GCATTTGAGGCCCCTGTGGATGG + Intronic
970717852 4:18948132-18948154 GCATCTGACGCCAGTCAGGATGG - Intergenic
970969893 4:21970049-21970071 GCATCTGAGACTTCGCTGGTTGG - Intergenic
972744371 4:41919216-41919238 GTCTCTGAGCCCACTCTGGCTGG + Intergenic
974625861 4:64428575-64428597 CCATCTGAGACCACTCAGGCTGG - Intergenic
978781915 4:112565273-112565295 GCAAGTGAGGCCTATCTGGTTGG + Intronic
980986296 4:139698247-139698269 GCAAGTGAGGCCTATCTGGTTGG - Intronic
982788945 4:159568002-159568024 CCATCTCAGGCCACTCAGGATGG - Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
988679866 5:33474461-33474483 GCTTCTCAGGCCACTGAGGTGGG + Intergenic
989631155 5:43483902-43483924 CGGTCTGAGGCCACTCTGGCCGG - Intergenic
989803700 5:45578162-45578184 GCTTCTCAGGACACTGTGGTGGG - Intronic
993003883 5:82410600-82410622 GCTTCTGAGGCCTCTCTCCTTGG - Intergenic
995780581 5:115770868-115770890 GCAAGTGAGGCCTATCTGGTTGG + Intergenic
998674548 5:144392336-144392358 GGATCTGAGGGCACAGTGGTAGG + Intronic
1001542987 5:172552113-172552135 TCTTCTGAGGCCTCTCTGCTTGG + Intergenic
1002771834 6:296815-296837 GGATATGAGGACCCTCTGGTTGG + Intronic
1005488261 6:26321979-26322001 GCAAGTGAGGCCTATCTGGTTGG - Intergenic
1005810635 6:29512837-29512859 TCTTCTGAGGCCTCTCTTGTTGG - Intergenic
1006975581 6:38097842-38097864 GCACCTGAGGCCAGTCAGATTGG + Intronic
1008497709 6:52150020-52150042 TCCTCTGAGGTCACTGTGGTGGG - Intergenic
1011568888 6:88712515-88712537 GAATTTGAGGCCAGCCTGGTGGG - Intronic
1014406793 6:121062822-121062844 GTATCTGAGTCTACTCTGTTAGG - Intergenic
1014660006 6:124158162-124158184 TCTTCTGAGGCCTCTCTGCTTGG + Intronic
1019030036 6:169002010-169002032 TCATCTGGAGCCTCTCTGGTGGG - Intergenic
1019142423 6:169957045-169957067 GCATCTGAGGGGGTTCTGGTGGG + Intergenic
1019414209 7:919949-919971 GCAGGTGAGGCCACCCGGGTGGG - Exonic
1019496899 7:1345029-1345051 CCATCTGAGCCCCCTCTTGTGGG - Intergenic
1019709279 7:2510978-2511000 GCCTCTGAGGTCATTCTGGGCGG - Intergenic
1022499362 7:30872934-30872956 GCCTGTGTGGCCACTCTGGGAGG - Intronic
1029276098 7:99405255-99405277 GCATCTGAGTCCACTATGCTTGG - Intronic
1031232506 7:119126708-119126730 GCATATGAGGGCACTCAGGATGG + Intergenic
1032099962 7:128967135-128967157 GCATTGGAAGCCAATCTGGTGGG - Intronic
1033272367 7:139944158-139944180 GCATCAGAAGCCACTTTGGCAGG + Intronic
1035699063 8:1624374-1624396 CCACCTGAGGCCACACTGCTCGG + Intronic
1037619743 8:20553212-20553234 GCATCTGTTGCCACTTTAGTTGG - Intergenic
1038634415 8:29273848-29273870 ACCTCTGAGGCCAATGTGGTGGG + Intergenic
1038676428 8:29626762-29626784 TCTTCTGAGGCCTCTCTCGTTGG - Intergenic
1042848327 8:73190593-73190615 GCACCTGGGGCCACACTGGGAGG - Intergenic
1044871705 8:96626201-96626223 TCTTCTGAGGCCTCTCTCGTTGG + Intergenic
1045871757 8:106935088-106935110 GCAACTATGGCCACTATGGTTGG + Intergenic
1048259167 8:132931112-132931134 GCTTCTGAGGCCCCTCTCCTGGG + Intronic
1048768182 8:137867115-137867137 CCATCTGAGACCACTGTGGCTGG - Intergenic
1055086495 9:72319596-72319618 TCTTCTGAGGCCTCTCTGCTGGG + Intergenic
1055814776 9:80191876-80191898 TCTTCTGAGGCCTCTCTTGTTGG - Intergenic
1057243826 9:93437152-93437174 CCGTCTCAGGCCACTCTGGCTGG - Intergenic
1058198040 9:102002742-102002764 GATTCTGAGTCAACTCTGGTGGG + Intergenic
1058699915 9:107591408-107591430 GCACCAGAGGCCAGTCTGGAAGG + Intergenic
1059697516 9:116743169-116743191 GCAACTGAGGCAAGACTGGTGGG + Intronic
1062373859 9:136253376-136253398 GCCACAGAGGCCACTCTGGATGG + Intergenic
1185780931 X:2844249-2844271 ACGTCTGAGGACACACTGGTTGG - Intronic
1186503518 X:10071540-10071562 TCATCTGAGTCCACTCTAGCAGG - Intronic
1186631423 X:11353170-11353192 GGATCTGAGGCTTCTCTGGAGGG - Intronic
1188240467 X:27781436-27781458 GCATCTGAGACTTCTCTGGAAGG - Intergenic
1188314732 X:28659165-28659187 GCAACTGAGGCCTAGCTGGTTGG - Intronic
1190104190 X:47547084-47547106 GCAGCTGAGGCCACTCCTGAAGG - Intergenic
1197179080 X:123514752-123514774 GCAAGTGAGGCCTATCTGGTTGG + Intergenic