ID: 1083484913

View in Genome Browser
Species Human (GRCh38)
Location 11:62977180-62977202
Sequence TGCAGGACCTGGAGAGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 507}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083484913_1083484925 18 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484925 11:62977221-62977243 GGCCCAGGGTCTCTGGCAGGAGG 0: 1
1: 1
2: 4
3: 31
4: 411
1083484913_1083484919 -3 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484919 11:62977200-62977222 GCACCGTGTCTGGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 200
1083484913_1083484917 -7 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484917 11:62977196-62977218 TCCTGCACCGTGTCTGGCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 185
1083484913_1083484923 11 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484923 11:62977214-62977236 AGTGGCTGGCCCAGGGTCTCTGG 0: 1
1: 1
2: 3
3: 41
4: 358
1083484913_1083484924 15 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484924 11:62977218-62977240 GCTGGCCCAGGGTCTCTGGCAGG 0: 1
1: 2
2: 7
3: 39
4: 427
1083484913_1083484921 3 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484921 11:62977206-62977228 TGTCTGGCAGTGGCTGGCCCAGG 0: 1
1: 1
2: 0
3: 42
4: 400
1083484913_1083484922 4 Left 1083484913 11:62977180-62977202 CCACCTGCTCTCCAGGTCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 507
Right 1083484922 11:62977207-62977229 GTCTGGCAGTGGCTGGCCCAGGG 0: 1
1: 0
2: 4
3: 22
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083484913 Original CRISPR TGCAGGACCTGGAGAGCAGG TGG (reversed) Exonic
900074017 1:797518-797540 GGCCAGACCTGGAGAGCAGGGGG + Intergenic
900089940 1:915840-915862 GGTGGGACCTGGAGGGCAGGTGG - Intergenic
900180753 1:1309966-1309988 CTCAGGACCTGGACAGCTGGAGG + Intronic
900390222 1:2430576-2430598 GGCCGGATCCGGAGAGCAGGTGG + Intronic
900873562 1:5324633-5324655 TTTAGGACCCCGAGAGCAGGGGG - Intergenic
901529377 1:9843718-9843740 TGCAGAGCCTGCAGAGCTGGAGG - Intergenic
902833566 1:19033282-19033304 TTCAGGACCTGGAGCTCAGGTGG - Intergenic
903570058 1:24297705-24297727 TGCAGGACCAGGTGCACAGGCGG - Intergenic
903579492 1:24360073-24360095 AGGAAGCCCTGGAGAGCAGGTGG - Intronic
904311132 1:29630236-29630258 GGCAGGTCCTGGGGGGCAGGAGG - Intergenic
904389463 1:30172429-30172451 ACCAGTACCTGGAGAGCAGTGGG - Intergenic
905889675 1:41511222-41511244 AGCAGGGCCGGGTGAGCAGGAGG + Exonic
906148831 1:43576037-43576059 TGCTGGAGCTGGAGATGAGGAGG - Intronic
907014735 1:51001464-51001486 TGCAGGTGCTGGAGTGCAAGTGG + Intergenic
907548066 1:55279525-55279547 TGCTTGAACTGGAGAGGAGGAGG - Intergenic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
907932979 1:59017332-59017354 ATGAGGACCTGGGGAGCAGGGGG + Intergenic
908133500 1:61101581-61101603 CGAAGGCCTTGGAGAGCAGGCGG + Intronic
908139123 1:61164881-61164903 TGCAGGACCTGAAGACCCTGTGG + Intronic
908515074 1:64884127-64884149 CGCAGCACCAGGAGGGCAGGAGG + Intronic
910096767 1:83532054-83532076 TGCAGGGCCTGGAGAGAACTTGG - Intergenic
910909442 1:92218030-92218052 CTGAGGACCTGGTGAGCAGGTGG + Exonic
911019623 1:93373898-93373920 TGTAGAACCTGGATAGCAGCTGG - Intergenic
911278176 1:95890055-95890077 TGCAGTACCTGGAGAGTAATTGG + Intergenic
912285572 1:108365070-108365092 AGCAGGACCAGGAGAGGAAGAGG - Intergenic
912694462 1:111830545-111830567 TGCAGGACCTCAAGAGTGGGTGG + Intronic
914754343 1:150554285-150554307 GGCTGAACCTGGGGAGCAGGTGG - Intronic
915065432 1:153220655-153220677 TGCTGGCCCTGGGGAGCAGCTGG - Intergenic
915792218 1:158685330-158685352 TGCAGGTTGTGGAGAGCAGTGGG - Exonic
917797457 1:178542380-178542402 TGCAGGACCTGGAGGTCTGCAGG - Intronic
919356310 1:196526954-196526976 TGCAGGAGGTGGAGCTCAGGTGG - Intronic
919669673 1:200327448-200327470 TGAAGGAGGTGGAGAGGAGGAGG - Intergenic
919761951 1:201103674-201103696 TCCAGGACCTGCAGAGCACAGGG - Intronic
919896698 1:202013479-202013501 TGGTGGTCCTGGAGAGGAGGAGG + Intronic
920049044 1:203152281-203152303 TGCAGGCTCAGGAGAGCAGAGGG - Intronic
920286628 1:204884264-204884286 TGCTGGGCCTGGGGAGAAGGAGG + Intronic
920309896 1:205042923-205042945 GGCAGGATCGGGAGGGCAGGCGG + Intergenic
921741762 1:218693477-218693499 TAGAGGTCCTGGTGAGCAGGAGG - Intergenic
921779025 1:219139266-219139288 TGGAGGACCAGGAAAGCAAGTGG - Intergenic
922269870 1:224022423-224022445 GGCCAGACCTGGAGAGCAGGGGG + Intergenic
922724865 1:227918113-227918135 AGGAGGACCTGGGGAGGAGGAGG - Intergenic
922987205 1:229874978-229875000 GGCAGGAGCTGGAGAGGAAGTGG + Intergenic
923116796 1:230947881-230947903 TGTGTGACCTGGAGAGCAGGAGG - Intronic
923127028 1:231041091-231041113 GGCAGGACGTCGAGGGCAGGAGG + Intergenic
924500159 1:244629981-244630003 TACATGACCTGGAGGGCAGGAGG - Intronic
924775116 1:247111175-247111197 TGCAGGAGTTCGAGAGCTGGTGG - Exonic
924804116 1:247348862-247348884 TGCAAGACCTGTTGAGAAGGGGG - Intergenic
924812568 1:247416224-247416246 GACAGGACCGGGAGAGCAGTGGG + Intronic
1063047270 10:2405098-2405120 TGCAGCACCTGCCGAGCCGGGGG + Intergenic
1063299525 10:4839469-4839491 GGAAGGCCCTGCAGAGCAGGTGG + Intronic
1063566629 10:7177061-7177083 TGGGGGGACTGGAGAGCAGGTGG - Intronic
1063917989 10:10903869-10903891 TGCATGACCTGGGGATCAGCTGG - Intergenic
1065093135 10:22253576-22253598 GGGAGGACCTGGTGAGCCGGTGG - Intergenic
1066115355 10:32234059-32234081 TTCAGGAGCTGGAGACCAGCCGG + Intergenic
1066756496 10:38717453-38717475 TGCAGGAGCGGGAGATGAGGAGG - Intergenic
1069671842 10:70212681-70212703 GCCAGGGCCTGGAGAGGAGGAGG + Intronic
1069933982 10:71902495-71902517 TGCACCATCTGGAAAGCAGGCGG - Intergenic
1072228600 10:93393457-93393479 TGCAGGCCCTGCAGACCATGGGG - Intronic
1072984535 10:100128301-100128323 TGCAGGACCTAGGGCACAGGTGG + Intergenic
1073057318 10:100710798-100710820 TCCAGGGCCTGGAGTCCAGGTGG - Intergenic
1074116549 10:110460873-110460895 ATCAGGACCTCGAGAACAGGTGG - Intergenic
1075415270 10:122258152-122258174 TGCAGCCCCTGGGGAGGAGGAGG - Intergenic
1075707738 10:124511910-124511932 TGTAGGACATGGAGGACAGGTGG - Intronic
1076479424 10:130775156-130775178 TGGAGGGCCTGGGGAGCAGGTGG - Intergenic
1076903571 10:133351502-133351524 TCCTGAACCTGGAGAGCACGGGG + Intronic
1076994848 11:292871-292893 TGCAGGTCCTGGGGAGCAGGAGG - Exonic
1077321078 11:1942241-1942263 GACAGGACCAGGACAGCAGGCGG - Intergenic
1077325079 11:1960228-1960250 TGCGGCACCTGGGGAGGAGGAGG - Intronic
1077325502 11:1962224-1962246 TGCGGCACCTGGGGAGGAGGAGG - Intronic
1077631777 11:3816155-3816177 GGCAGGCCCTGAGGAGCAGGGGG + Intronic
1083274161 11:61587569-61587591 TGGAGGACCAGGAGCGCGGGCGG - Intergenic
1083309502 11:61777193-61777215 TGCAGGGCCCTGGGAGCAGGGGG - Intronic
1083443299 11:62690850-62690872 TGCAGGGCCTGAAGGCCAGGAGG - Exonic
1083479844 11:62936770-62936792 TGAAGGACCTGGAGAGAAGGTGG - Intronic
1083484913 11:62977180-62977202 TGCAGGACCTGGAGAGCAGGTGG - Exonic
1083968782 11:66059615-66059637 TGCAGGCCCTGGAGCCCAGCTGG + Intronic
1084461432 11:69298698-69298720 AGCAGGGCGTGGAGACCAGGAGG + Intronic
1085163042 11:74366699-74366721 TGGAGGAGCTGGAGAACAGAAGG + Intronic
1085529250 11:77181946-77181968 TTCAGGACCTGGAGCGAGGGCGG + Exonic
1085568865 11:77541588-77541610 TGAAGAACCAGGAGAGCAGGTGG - Intronic
1087485618 11:98756514-98756536 TTTAGAACCTGGAAAGCAGGTGG - Intergenic
1088442751 11:109889628-109889650 TTCTGGACATCGAGAGCAGGTGG - Intergenic
1088827102 11:113505265-113505287 TACAGGACCTGAAGATCAGAGGG + Intergenic
1088851973 11:113712093-113712115 TGCAGGAGTTGGAGGTCAGGAGG + Intergenic
1088989056 11:114935617-114935639 AGGAAGCCCTGGAGAGCAGGGGG + Intergenic
1089385142 11:118062430-118062452 AGCAGGGCCTGGAGAGGAGCTGG - Intergenic
1089640355 11:119843778-119843800 TGCAGGATTTGGGGAGGAGGAGG + Intergenic
1089762506 11:120738650-120738672 AGCAGGGCCTGAAGGGCAGGAGG + Intronic
1090247263 11:125225207-125225229 TGCAGGACCTATAGAGCTGCTGG + Intronic
1090357590 11:126150380-126150402 AGCAGCAGCTGGAGAGCAGGTGG + Intergenic
1091334814 11:134758492-134758514 TGCTGAACCTGGAGAGCAGACGG - Intergenic
1202808061 11_KI270721v1_random:15407-15429 TGCGGCACCTGGGGAGGAGGAGG - Intergenic
1202808482 11_KI270721v1_random:17403-17425 TGCGGCACCTGGGGAGGAGGAGG - Intergenic
1091385045 12:88522-88544 AGCAAGTCCTGGAGAGCAGGGGG + Intronic
1091628297 12:2139477-2139499 TGCAGTACCTGGAGTACAGCTGG + Intronic
1091680182 12:2521491-2521513 TCCAGGCCCTGGAGAGGAAGAGG - Intronic
1091723607 12:2830753-2830775 TTCATGGCCAGGAGAGCAGGAGG - Exonic
1091971215 12:4788511-4788533 TGCAGGAGCTAGAGAAAAGGGGG + Intronic
1092644436 12:10554325-10554347 TGCAGGGTCTGGGGAGCGGGAGG + Intergenic
1092939117 12:13390947-13390969 TGCAGGATCTGGAGAAAATGGGG + Intergenic
1093498173 12:19780558-19780580 TTCAGGCTCTGGAGAGCAAGTGG - Intergenic
1095040036 12:37431349-37431371 AGTGGGACCTGGAGTGCAGGAGG - Intergenic
1096137725 12:49216488-49216510 TACAAGACCTGGAGACCAGAAGG - Intronic
1096177621 12:49533471-49533493 TGCAGGACCCGAAGGGAAGGTGG - Intergenic
1096188729 12:49600770-49600792 TGGAGGTCCTTGAGAGCAGGAGG - Exonic
1096370423 12:51064532-51064554 AGCTGGAGCTGGAGAGCAAGCGG - Exonic
1096557762 12:52413957-52413979 TGGAGGGCTTGAAGAGCAGGTGG - Intergenic
1096595480 12:52692417-52692439 TGGAGGGCGAGGAGAGCAGGTGG - Exonic
1096966901 12:55635745-55635767 TGCAGGACGTGGTGGGGAGGTGG - Intergenic
1098601504 12:72336726-72336748 TGCAAGAGCAAGAGAGCAGGAGG + Intronic
1099491273 12:83291797-83291819 TACAGGATTTGGAGAGGAGGTGG + Intergenic
1100153188 12:91766696-91766718 TGCAGGAGCTGAAGAGCTGAAGG + Intergenic
1100800845 12:98228635-98228657 TGAAGAACCTGGAGAGGAAGGGG - Intergenic
1101847488 12:108374361-108374383 TGCAGAAACTGGGGATCAGGGGG + Intergenic
1101903346 12:108807662-108807684 TGCAGGACCTGGAGTCTACGCGG - Exonic
1102221085 12:111194896-111194918 TACAGGAGCTGGACAGCTGGGGG - Intronic
1102227285 12:111237707-111237729 GGCAGGGGCTGGAGAGCAGATGG - Intronic
1102954897 12:117052969-117052991 TGCAGGCCTGGGAGACCAGGTGG - Intronic
1104084081 12:125458504-125458526 TGCAGGTCCTGGGGAGCTGAGGG + Intronic
1104094353 12:125543238-125543260 TGCAGAACCTGGAGATAGGGAGG - Intronic
1104946102 12:132415517-132415539 TGCAGGGCCAGGAGAGCACCAGG - Intergenic
1106705484 13:32274948-32274970 TGTAGGACATTCAGAGCAGGAGG - Exonic
1108003813 13:45927868-45927890 TGAAGGCCCAGGAGAGCCGGTGG - Intergenic
1108033003 13:46256438-46256460 GGCAGAAACTGGAAAGCAGGTGG + Intronic
1108509044 13:51138111-51138133 GGCAGGCCCTGGCGAGGAGGAGG + Intergenic
1108757124 13:53517097-53517119 AGCAGAAGCTGGAGAGCTGGTGG - Intergenic
1108764668 13:53612220-53612242 TGCGGGATCTGGAGATCACGAGG - Intergenic
1109693697 13:65926790-65926812 GGCAGGAACTAGAGTGCAGGAGG + Intergenic
1111517839 13:89358382-89358404 GTCAGGACCTTGAGGGCAGGTGG - Intergenic
1112188149 13:97147892-97147914 TGCAGGAGCAGGAGAGTAGTGGG + Intergenic
1112737252 13:102434732-102434754 AGCAGGGCCTGGAGGCCAGGAGG - Intergenic
1113532383 13:111037723-111037745 TGCAGCTCCTGGGAAGCAGGTGG + Intergenic
1113533221 13:111044834-111044856 TGCAGGTCCTGGAGAGGCAGGGG + Intergenic
1113676005 13:112208542-112208564 TGCAGAACCTGGGGATAAGGCGG + Intergenic
1113804286 13:113104311-113104333 TTCAGGACGTGGAGGGGAGGGGG - Intergenic
1113923791 13:113929289-113929311 CCCAGGCCCTGCAGAGCAGGTGG + Intergenic
1114313983 14:21493012-21493034 TGCATGGCCTGGAGTGGAGGAGG - Exonic
1114550715 14:23531414-23531436 AGCAGGATGTGGGGAGCAGGGGG - Intronic
1114569693 14:23657950-23657972 AGCAGGGCCTGGAGTGCATGAGG - Intergenic
1115247950 14:31315924-31315946 TGCAGTGCCTGGATAGCAAGTGG - Exonic
1115747495 14:36452279-36452301 TTAAGGACCTTGAGAGGAGGGGG + Intergenic
1116423356 14:44759983-44760005 TGGAGGACCAGGAAAGCTGGTGG - Intergenic
1116820382 14:49621242-49621264 TCCAGGGCCGGGAGCGCAGGCGG - Exonic
1118112735 14:62740436-62740458 GGCAGGGGCTGGACAGCAGGAGG - Intronic
1119086488 14:71743976-71743998 GGCAGGCCCAGGAGAGGAGGGGG - Intergenic
1119231694 14:72984990-72985012 GGCAGGGCCAGGAGAGGAGGAGG - Intronic
1119264097 14:73253990-73254012 TGCTGGACCTGGGTAGCAGCAGG + Intronic
1119320394 14:73726846-73726868 GGGAGGACCTAGAGAGCAGCCGG - Exonic
1120752125 14:88207511-88207533 TGCAGGATTAGGAGAGTAGGAGG + Intronic
1121245466 14:92458511-92458533 TGTGGGACATGAAGAGCAGGAGG + Intronic
1121729091 14:96173906-96173928 TGCAGGCCCAGGGGAGCTGGTGG + Intergenic
1122416982 14:101554758-101554780 TGCAGGACCTTCTGAGCAGGTGG - Intergenic
1122479716 14:102039197-102039219 TGCAGGCGGTGGAGAGCGGGAGG - Exonic
1122909602 14:104820908-104820930 TGCAGGAACTGGCGGGAAGGGGG + Intergenic
1123005976 14:105324050-105324072 TGCAGGAGATGGAGGGCAGGGGG + Intronic
1123007775 14:105332696-105332718 TCCAAGACCTGGAGCCCAGGAGG + Intronic
1123174097 14:106401217-106401239 TGCATGGCCTGAAGAGAAGGCGG + Intergenic
1202944597 14_KI270726v1_random:14579-14601 TGCATGGCCTGAAGAGAAGGCGG - Intergenic
1124371789 15:29108255-29108277 TTCAGGCCCTGCAGAGCACGGGG - Exonic
1124377680 15:29139014-29139036 TGTTGGAGCTGGGGAGCAGGGGG + Intronic
1124412885 15:29451370-29451392 TGCAGGACCAGGCCAGCAGGTGG + Intronic
1125433146 15:39618089-39618111 TGATGGACCTGGAAAGCTGGGGG + Exonic
1125899138 15:43329349-43329371 AGGAGGATTTGGAGAGCAGGAGG - Exonic
1126349420 15:47729281-47729303 AGCAGGACTTGAAGATCAGGAGG - Intronic
1126574221 15:50182140-50182162 GGGAGGGCCGGGAGAGCAGGTGG + Intronic
1126704869 15:51397509-51397531 TGGAGGACCTGGAGGGCCTGGGG - Exonic
1127261950 15:57332821-57332843 TGCATGAGCTGGAAGGCAGGAGG + Intergenic
1127318837 15:57822881-57822903 TGCAGAACCTGCAGATAAGGAGG - Intergenic
1127440270 15:58999882-58999904 GGCAGGAGCAGGAGAGAAGGGGG + Intronic
1127521605 15:59748204-59748226 TGGAGGACATGGAGGGCAGGAGG - Intergenic
1127918554 15:63475239-63475261 TGATGGACGTGGAGGGCAGGGGG - Intergenic
1129118480 15:73379937-73379959 GGGAGGGCCCGGAGAGCAGGTGG - Intergenic
1129155627 15:73715628-73715650 TGCAGACCCTGGGCAGCAGGAGG + Intergenic
1129254375 15:74325825-74325847 TGCAGGGCCTTGGGTGCAGGAGG - Intronic
1130473070 15:84240661-84240683 TGCAGGAGCTGGAGAGGCTGCGG + Exonic
1130480484 15:84354726-84354748 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1130491228 15:84433033-84433055 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130502811 15:84511833-84511855 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130533562 15:84766585-84766607 AGCAGGAGCTGGAGAGTTGGGGG + Intronic
1130595359 15:85245269-85245291 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1131195261 15:90350299-90350321 TTCAGGACCTGGAGAACCGAAGG - Intergenic
1131551357 15:93359850-93359872 TCCAGGCCCTGGAGAGCCTGGGG + Intergenic
1132338343 15:101063060-101063082 TCCAGGACCTGGTGATCAAGTGG - Intronic
1132466377 16:79124-79146 TGCATGACCTGGGGAGCAGATGG - Exonic
1132574186 16:657136-657158 AGCAGGAGCTGAAGAGCAGGCGG - Exonic
1132617880 16:851399-851421 AGCAGGCCCTGGAGAGCCAGGGG + Intergenic
1132871437 16:2117363-2117385 GGCCGGCCCTGGTGAGCAGGTGG - Intronic
1133120296 16:3602386-3602408 TGCAGACCATGGGGAGCAGGTGG + Intronic
1133284343 16:4683671-4683693 TGGGGTCCCTGGAGAGCAGGTGG + Intronic
1134521091 16:14919531-14919553 GGCCGGCCCTGGTGAGCAGGTGG + Intronic
1134550480 16:15136441-15136463 GGCCGGCCCTGGTGAGCAGGTGG - Intronic
1134708767 16:16318182-16318204 GGCCGGCCCTGGTGAGCAGGTGG + Intergenic
1134715981 16:16358216-16358238 GGCCGGCCCTGGTGAGCAGGTGG + Intergenic
1134950838 16:18350463-18350485 GGCCGGCCCTGGTGAGCAGGTGG - Intergenic
1134958775 16:18393943-18393965 GGCCGGCCCTGGTGAGCAGGTGG - Intergenic
1135138657 16:19903424-19903446 AGCAGAAACTGGAGATCAGGTGG + Intergenic
1136664882 16:31801821-31801843 GGGAGGACCTGGACGGCAGGTGG + Intergenic
1136726090 16:32358872-32358894 TGCAGGAGCGGGAGATGAGGAGG + Intergenic
1136844422 16:33564917-33564939 TGCAGGAGCGGGAGATGAGGAGG + Intergenic
1137572277 16:49574698-49574720 TGCACGACCTGGAGTGCAGCTGG - Intronic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1141006676 16:80359104-80359126 TGCAGTACCTGGCACGCAGGAGG + Intergenic
1141463455 16:84191705-84191727 CCCAGGACGTGGGGAGCAGGGGG + Intronic
1141833043 16:86520262-86520284 TGCACGAAGTGGACAGCAGGTGG - Intergenic
1142137982 16:88460276-88460298 GGCAGGGCCCGGAGAGCAGTGGG + Intronic
1142142713 16:88479707-88479729 TGCTGGCCCTGGGTAGCAGGTGG - Intronic
1142265427 16:89062163-89062185 AGCAGGATCAGCAGAGCAGGGGG + Intergenic
1142351557 16:89583067-89583089 AGCAGGGCCTGGTGAGGAGGAGG + Intronic
1203000341 16_KI270728v1_random:158884-158906 TGCAGGAGCGGGAGATGAGGAGG - Intergenic
1203131943 16_KI270728v1_random:1695287-1695309 TGCAGGAGCGGGAGATGAGGAGG - Intergenic
1203154589 16_KI270728v1_random:1865216-1865238 TGCAGGAGCGGGAGATGAGGAGG + Intergenic
1143447616 17:7018521-7018543 GGCAGGAAATGGAGACCAGGGGG + Intergenic
1143579623 17:7817931-7817953 TTCAGGCCCTAGAGAGCAAGGGG - Exonic
1143586445 17:7852985-7853007 GGCAGAACCTGGGGAGCAGTGGG - Exonic
1143719813 17:8801584-8801606 TACAGGACATGGGAAGCAGGCGG - Intergenic
1143880027 17:10022938-10022960 TACAGGAGCTGGAGAGCCAGTGG + Intronic
1144325785 17:14178393-14178415 TGTAAGACCTGGAGACCAGCTGG + Intronic
1145868463 17:28255623-28255645 TGCAGACCGTGGAGAGCAGCTGG + Intergenic
1145886228 17:28384302-28384324 GGGAGCACCTGGAGAGCTGGTGG + Intronic
1146183587 17:30711330-30711352 GCCAGGCCCTGGAGAGCAGGTGG - Intergenic
1147261323 17:39211052-39211074 TGCAGAGCCTGGAGAGAAGCAGG + Exonic
1147388496 17:40095570-40095592 TGCAGGGCCAGGAGGCCAGGTGG + Exonic
1147566360 17:41538747-41538769 TTCTGGACCAGGTGAGCAGGGGG + Intergenic
1147670334 17:42173322-42173344 TGAAGGAACTGGAAAGGAGGTGG + Intronic
1148341115 17:46874047-46874069 TGCAGACCGTGGAGAGCAGCTGG - Intronic
1148487676 17:48001596-48001618 TAAAGGACCTGGTGAGTAGGAGG - Intergenic
1148643860 17:49207822-49207844 TGCTGGACCTGGAGAGAAAGAGG - Intronic
1148715332 17:49711540-49711562 GTCAGGACCTGGAGACCTGGAGG + Exonic
1148747647 17:49927501-49927523 GGGAGGCCCTGGAGGGCAGGGGG - Intergenic
1150149661 17:62798849-62798871 GGCAGGGGCTGGAGAGCAGAGGG + Intronic
1150244968 17:63667833-63667855 TGCAGAACCTGGAGATATGGAGG + Intronic
1151449998 17:74192861-74192883 TGCAGAATCCAGAGAGCAGGTGG - Intergenic
1151570074 17:74921623-74921645 TGCAGGACTTGGCGGCCAGGAGG - Intronic
1151759263 17:76091308-76091330 TGCGGGGCCTGGGGGGCAGGTGG - Intronic
1152016441 17:77753987-77754009 GGCAGGACCTGGAGAGAGGTGGG - Intergenic
1152230186 17:79110442-79110464 GGCAGACCCTGGACAGCAGGTGG + Intronic
1152245640 17:79183317-79183339 TGCCGGAGTTGGACAGCAGGAGG + Intronic
1152584924 17:81184740-81184762 GACAGGCCCTGGACAGCAGGAGG - Intergenic
1152769289 17:82157530-82157552 TGAAGGACCAGGAGAAGAGGAGG + Intronic
1153449366 18:5209737-5209759 TGGAGGCCCAGGAGAGCTGGTGG + Intergenic
1153692048 18:7603700-7603722 TTCTGAACCAGGAGAGCAGGAGG - Intronic
1155325033 18:24656592-24656614 TGCAGGATGCCGAGAGCAGGTGG + Intergenic
1155963944 18:32018919-32018941 CGCGGGCCCTGGAGCGCAGGAGG + Exonic
1156019700 18:32585978-32586000 TGCAGGAACTGGAGGGTGGGAGG - Intergenic
1156580604 18:38370473-38370495 GGCAGGACCTGGAGAGTGGGAGG + Intergenic
1157324052 18:46656610-46656632 TTCAGGAGCTGGAGAACATGGGG + Intronic
1157948750 18:52010953-52010975 TGTAGGTCATGGATAGCAGGTGG - Intergenic
1159914039 18:74173188-74173210 TGCAGGACGTGGTGGCCAGGCGG - Intergenic
1160032951 18:75278446-75278468 TTTAGGACCTGGGGAGAAGGCGG - Intronic
1160591230 18:79945684-79945706 TGCAGGAGCAGGAGTGCAGGGGG + Intronic
1160591608 18:79947887-79947909 AGCAGGACCTGGGGACCGGGTGG + Intronic
1160932238 19:1576312-1576334 TGCAGGACCTGAGGACCTGGGGG + Intronic
1160955404 19:1689109-1689131 TGGACTACCTGGAGGGCAGGAGG + Intergenic
1161110145 19:2464710-2464732 GGCAGGCCCTGGACAGCAGTGGG - Intergenic
1161111815 19:2475091-2475113 TCCAAGACCTGGGAAGCAGGGGG - Intergenic
1161237187 19:3203981-3204003 TGCAGGACACCGAGAGCTGGCGG - Intronic
1161340269 19:3737973-3737995 GTCATGACCCGGAGAGCAGGTGG + Intronic
1161760631 19:6168531-6168553 TGCAGTGCCTGATGAGCAGGAGG + Intronic
1161898703 19:7101630-7101652 AACAGGACCGGGAGGGCAGGAGG - Intergenic
1161953839 19:7482213-7482235 TGCAGGACCAGGAGCAGAGGGGG + Intronic
1162430879 19:10627707-10627729 TGCAGCCCCTGGGGAGCAGAGGG - Exonic
1162740875 19:12772905-12772927 GCCAGGACCTGGGGAGAAGGGGG + Exonic
1162867806 19:13562113-13562135 GGAAGGACCCAGAGAGCAGGTGG - Intronic
1162975205 19:14204409-14204431 GCCAGGCCCTGGAGAGCAGGTGG + Intronic
1163529551 19:17841755-17841777 TGGAGGACCTGGGAAGGAGGGGG + Exonic
1163687344 19:18719325-18719347 TGCAGGCCCTGGGGACCCGGTGG - Intronic
1164674704 19:30093390-30093412 TCCAGGCCCTTGCGAGCAGGTGG + Intergenic
1165074502 19:33273428-33273450 GGCAGGACCTGCAGGGCGGGAGG + Intergenic
1165226670 19:34359759-34359781 GGCAGGCCCTGGAGCACAGGTGG - Intronic
1165300070 19:34963257-34963279 TGCTGGAACCAGAGAGCAGGTGG - Intronic
1166326223 19:42052744-42052766 CACAGGGCCTGGCGAGCAGGAGG - Intronic
1166542713 19:43616025-43616047 GGCAGGAAATGGAGGGCAGGAGG + Intronic
1166611571 19:44203539-44203561 GTCAGGAGCTGGAGACCAGGGGG - Intergenic
1167382835 19:49148716-49148738 GGAAGGACCTGGAGCGGAGGCGG + Exonic
1168080751 19:54008456-54008478 TCCAGGGTCTGGAGAGAAGGCGG + Intronic
1168713497 19:58514501-58514523 GGGAGGTCCTGGAGAGGAGGGGG - Intronic
924973728 2:154598-154620 TGTATGACCTGCAGTGCAGGGGG + Intergenic
925383899 2:3448576-3448598 CGCAGGGCGTGGAGAGCAGCCGG + Intronic
925817995 2:7772035-7772057 TGCCACACCTGGAGAGGAGGAGG + Intergenic
926083181 2:10005020-10005042 TGCAGAACCAGGAAAGCTGGTGG - Intergenic
926579595 2:14620389-14620411 TGAAGGTCCTTGAGGGCAGGAGG + Intergenic
927384789 2:22520713-22520735 TTCATGACCTGGAAAGCTGGAGG - Intergenic
928743493 2:34384011-34384033 TACAGGACCTGGAGTGTAGGAGG + Intergenic
929138352 2:38645845-38645867 TGAAGGACCTTGATAGAAGGTGG - Intergenic
931244375 2:60480153-60480175 TGGAGGAGCTGGAGGCCAGGGGG + Intronic
933472249 2:82740762-82740784 CCCAGCACCTGGAGAGCAGGAGG + Intergenic
933810264 2:86028704-86028726 TCCAGGACCTGGAGAGAGGAAGG + Exonic
934131890 2:88956336-88956358 TGCAGGACAGGGATAGGAGGAGG + Intergenic
934250597 2:90350990-90351012 GGCAGGTGCTGGAGAGCAAGTGG - Intergenic
934258971 2:91452420-91452442 GGCAGGTGCTGGAGAGCATGTGG + Intergenic
934517775 2:94999491-94999513 TCCAGGTTCTTGAGAGCAGGAGG - Intergenic
934555498 2:95285057-95285079 TGGAGGCCCTGCAGAGCAGTGGG + Exonic
934560541 2:95310948-95310970 TGCAGTGCCTGGTGATCAGGAGG + Intronic
934853236 2:97714096-97714118 GGGAGGACCAGGAGAGCTGGAGG + Intronic
935096508 2:99949390-99949412 TCCATAAACTGGAGAGCAGGGGG + Intronic
935227045 2:101061767-101061789 GGCAGGAAGTGGAGAGCAAGAGG - Intronic
935763669 2:106343735-106343757 CTCAGGATGTGGAGAGCAGGAGG - Intergenic
936159140 2:110070866-110070888 TCCAGGTTCTGGAGAGCAGGAGG + Intergenic
936185521 2:110300466-110300488 TCCAGGTTCTGGAGAGCAGGAGG - Intergenic
937266046 2:120615219-120615241 TGCAGGAAGAGGAGGGCAGGGGG - Intergenic
937303345 2:120856651-120856673 TGCAGTCCCTGGAGATTAGGGGG - Intronic
937915579 2:127097265-127097287 TGCTGGGCCTGGAGAGCTGGCGG - Intronic
938821509 2:134964878-134964900 TTCAGGAGCTGGAGAGCAGAAGG + Exonic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942783821 2:179676582-179676604 AGAATGACCTGGAGAGCAGCGGG + Intronic
946094607 2:217262506-217262528 TGCTGGGCATGGAGAGCTGGTGG - Intergenic
946305911 2:218857032-218857054 AGCAGGAGCTGGAGAGGGGGTGG - Intergenic
946371737 2:219285414-219285436 AGCTGGTCCAGGAGAGCAGGAGG - Exonic
947397252 2:229698301-229698323 TGCAGGAAATGGAGACCAGCAGG - Intronic
947670961 2:231935031-231935053 GGCAGGGCCTGGAGGCCAGGCGG + Intergenic
947949743 2:234136827-234136849 TGCAGGGCTTGGAGTGGAGGAGG - Intergenic
948167789 2:235876596-235876618 TACAGGAGCTGGTGACCAGGAGG - Intronic
948670175 2:239563581-239563603 TGCAGGAGACGCAGAGCAGGAGG + Intergenic
948877527 2:240837593-240837615 TGCCAGGGCTGGAGAGCAGGAGG + Intergenic
948889389 2:240899569-240899591 TTGAGGACCTGGAGCCCAGGCGG - Intergenic
948926168 2:241099703-241099725 TGCAGGAACCAGAGTGCAGGAGG - Exonic
948948671 2:241235109-241235131 AGGAGGACCGGGTGAGCAGGAGG - Exonic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1169083952 20:2815601-2815623 TGAAGGTCCTGGACAGCAGGAGG + Exonic
1169588314 20:7112341-7112363 TCCAGGAGCGGGAGAGCAGTAGG + Intergenic
1169779111 20:9290060-9290082 GGCCTGACCTGGAGACCAGGAGG - Intronic
1170190201 20:13638365-13638387 TGGAGCAGCTGGAGAGGAGGGGG - Intronic
1170458924 20:16558523-16558545 TGCAGTTCCTGGTCAGCAGGTGG - Intronic
1170871577 20:20211210-20211232 TGCAGTACCTGGTTAGCCGGGGG + Intronic
1171191573 20:23162933-23162955 TGCGGGACCTGGCCAGCAGAAGG - Intergenic
1171227783 20:23455839-23455861 TGCAGGGCCAGGAGGGCAAGTGG - Intergenic
1172010345 20:31842812-31842834 TGCAGGGCATGGTGAGGAGGGGG - Intergenic
1172030064 20:31975384-31975406 TGCAGGCAATGGAGAGCAAGGGG - Intronic
1172274678 20:33673273-33673295 TTCAGGACCTGGAGTTCATGGGG - Intronic
1172275652 20:33677482-33677504 TGCAGACCCTGCAGAGCAGATGG - Exonic
1172536682 20:35679044-35679066 TTCTGGACTTGGAAAGCAGGAGG + Intronic
1172596220 20:36153031-36153053 TGCTGAACCTGGTGAGCAGGGGG + Intronic
1173011092 20:39182829-39182851 AGCAGGTCCTGGAGAGGATGTGG - Intergenic
1173170207 20:40717456-40717478 TGCAGGACCAGCTGAGGAGGTGG + Intergenic
1173468794 20:43306245-43306267 AGCAGGACCAAGAGAGAAGGGGG + Intergenic
1173872759 20:46352083-46352105 TGGAGGTTCTGGAGACCAGGAGG + Exonic
1174532774 20:51227292-51227314 TGCATCACCTGTAGTGCAGGTGG + Intergenic
1174779049 20:53371583-53371605 AGCAGGAGCTGGGGAGGAGGGGG + Intronic
1175164602 20:57034355-57034377 TACAGGACATGAATAGCAGGAGG - Intergenic
1175699497 20:61126725-61126747 GGCAGGACCTGGAGGGTGGGGGG + Intergenic
1175796794 20:61776286-61776308 TGCAGGGCCTGGAGAGCTCCCGG - Intronic
1175887354 20:62299881-62299903 TGCAGCACGTGGAGAGCATCAGG + Intergenic
1175912320 20:62410814-62410836 TCCAGGCCCTGGTGGGCAGGTGG + Exonic
1175913991 20:62417220-62417242 TGCGGGTGCTGGAGAACAGGTGG - Exonic
1175922542 20:62456909-62456931 TGCAGGAGCTCGAGAGTAAGGGG - Intergenic
1176163037 20:63658226-63658248 TGGAGGAGCCGAAGAGCAGGCGG + Intronic
1176167235 20:63680649-63680671 TCCAGCACCTGGAGGGCAGCAGG - Exonic
1176180051 20:63745563-63745585 GGCAGGTCCTGGAGGGAAGGAGG + Exonic
1176257431 20:64159607-64159629 TGCAGAACCTGAGGACCAGGAGG + Intronic
1177193267 21:17875379-17875401 TGGAGAACCAGGAAAGCAGGTGG + Intergenic
1177290305 21:19103031-19103053 AGCAGGACCAGGAGAGCACTGGG - Intergenic
1177920718 21:27148902-27148924 TGAAGGAACAGGAGAGGAGGGGG + Intergenic
1179785207 21:43725957-43725979 AGCATGGCCTGGAGAGCACGTGG - Intronic
1180059394 21:45376732-45376754 CGCAGCAGCTGGAGAGAAGGGGG + Intergenic
1180185506 21:46137227-46137249 TTAAGGACCAGGTGAGCAGGAGG - Exonic
1180308046 22:11145753-11145775 TGCAGGAGCGGGAGATGAGGAGG - Intergenic
1180546522 22:16507566-16507588 TGCAGGAGCGGGAGATGAGGAGG - Intergenic
1181033733 22:20160184-20160206 TGGAGGAGCTGGAGAGCTAGAGG - Intergenic
1181033746 22:20160235-20160257 TGGAGGAGCTGGAGGGCCGGAGG - Intergenic
1181033763 22:20160303-20160325 TGAAGGAGCTGGAGGGCTGGAGG - Intergenic
1181687937 22:24542337-24542359 TGGAGGACCTGGAGGGCTGTGGG + Intronic
1181991941 22:26843720-26843742 TACAGGGGCTGGAGAGGAGGTGG + Intergenic
1182097175 22:27633851-27633873 TGCAGGACCTTGAGCACAGAAGG - Intergenic
1182212666 22:28689813-28689835 TGCAGGAGCAGGAGATGAGGAGG + Intronic
1182488542 22:30654430-30654452 TGCACAACCTGGAGGGCAGCAGG + Intronic
1182942851 22:34294558-34294580 AGAAGGACTTGGAGTGCAGGAGG - Intergenic
1183868560 22:40723464-40723486 AGGAGGACCTGGACTGCAGGTGG + Intergenic
1183951402 22:41354950-41354972 TGCCGAACCTGTAGAGCGGGGGG - Intronic
1184487956 22:44792514-44792536 TGGAGGAGCAGGAGGGCAGGGGG - Intronic
1184525057 22:45017549-45017571 AACAGGAACTGCAGAGCAGGAGG - Intergenic
1185112967 22:48912487-48912509 TTCAGAACCTGGGTAGCAGGGGG - Intergenic
1185175367 22:49323241-49323263 TGCAGGATCTGGAGACCTGTGGG + Intergenic
1185241526 22:49749963-49749985 GGCAGGGCCTGCAGGGCAGGAGG + Intergenic
949820145 3:8107138-8107160 TGCAGATCCTGGAGAGCCGGTGG - Intergenic
950246427 3:11423710-11423732 TGCAAGTCCTAGAGAGCTGGGGG - Intronic
951606379 3:24439268-24439290 TGCAGCAGCTGGAGGGCAAGGGG + Intronic
951838301 3:27005625-27005647 TGTATGACCTGGAGTGCAGGGGG - Intergenic
951987601 3:28638289-28638311 TGAAGGGGCTGGAAAGCAGGGGG + Intergenic
951994530 3:28712839-28712861 TGGAGGCCCAGGAGAGCTGGGGG + Intergenic
952319057 3:32259048-32259070 TGCAGGCGCCGGAGGGCAGGGGG + Intronic
952484702 3:33798589-33798611 TGCCGGACCCGGAACGCAGGCGG + Exonic
953018456 3:39099324-39099346 GGCAGGCCCTGGAGAGGAGTGGG - Intronic
953223047 3:40990861-40990883 TGCAGGACCAGTATGGCAGGTGG + Intergenic
953300036 3:41764906-41764928 TGCAGGTGCTGGAGAGGATGTGG + Intronic
954194900 3:48990627-48990649 TGCAGGGCCTGGAGCGCGGCGGG - Intronic
954377093 3:50200968-50200990 TGCAGGACCTGTAGTGCTTGGGG + Intergenic
955060312 3:55487560-55487582 AGGAGGAGCTGGAGATCAGGAGG - Exonic
955227746 3:57074938-57074960 GCCAGGACCTGGAGGGCAGGAGG + Exonic
955584574 3:60462631-60462653 TAAAGGGCTTGGAGAGCAGGAGG + Intronic
955636261 3:61032855-61032877 TGGAGGCCCAGGAAAGCAGGAGG + Intronic
955755040 3:62217834-62217856 TTCAGGGCCTGGAGAGGTGGAGG + Intronic
956797332 3:72728763-72728785 TGCAGTGCCTGGAGATCAGAAGG + Intergenic
957580916 3:82072181-82072203 TGCAGGATCTGTTGACCAGGGGG - Intergenic
957770516 3:84686285-84686307 AGCAGGTGCTGGAGAGCATGTGG - Intergenic
958838243 3:99171704-99171726 TTCAGGCTCTGGAGAGCAAGTGG + Intergenic
959498856 3:107081949-107081971 TGAAGGACATGGAAAGCAAGAGG + Intergenic
959682374 3:109109972-109109994 TTCAGGACCTGGAGAGGAGAAGG + Intronic
959726128 3:109543663-109543685 TGCAGGTGCTGGAGAGGATGTGG + Intergenic
960006977 3:112790704-112790726 TGCTGGATCAGGAGCGCAGGGGG + Intronic
960726268 3:120673374-120673396 TGCAGAATCCGGAGACCAGGTGG + Intronic
961029548 3:123589895-123589917 GGCAGGAGGTGGAGATCAGGTGG + Intergenic
961039984 3:123671450-123671472 GGAAGGACCCTGAGAGCAGGAGG + Intronic
961372453 3:126439963-126439985 GGGAGGAGCTGGAGAGCAGAAGG - Intronic
961734968 3:128995585-128995607 GGTAGGACCTGGGGAGCAGGAGG - Intronic
961821349 3:129577250-129577272 AGCAGGCCCTGGGGAGCAGGAGG + Intronic
962272259 3:133986504-133986526 TGCAGGGCAGGGAGGGCAGGAGG + Intronic
963126301 3:141820087-141820109 TGTATGACCTGAAGTGCAGGGGG - Intergenic
963131226 3:141860048-141860070 TGCTGAGCCTGGAGAGGAGGTGG + Intergenic
965534087 3:169806465-169806487 GCCAGGGGCTGGAGAGCAGGGGG + Intronic
967482390 3:189988742-189988764 TGCAGGACAAGAAGAGCAGAAGG - Intronic
968523245 4:1043943-1043965 GGCAGGAACGGCAGAGCAGGGGG + Intergenic
969056757 4:4407248-4407270 GGCAGGACCTGGGGACCAGGAGG + Intronic
969436496 4:7192293-7192315 GGCTGGACCTGGAGAGAGGGAGG + Intergenic
969461418 4:7331132-7331154 TGGAGGAACTGGTGAGGAGGAGG + Intronic
969579131 4:8053834-8053856 GGCAGGACGGGGAGAGAAGGCGG - Intronic
970208436 4:13680541-13680563 TGCAGGACCTGGGGAATGGGGGG + Intergenic
970315592 4:14825770-14825792 TGCAGGACGTGGAGTGAAGTGGG - Intergenic
971354433 4:25882361-25882383 TCCAGGAGCTGGAAGGCAGGTGG + Intronic
972296506 4:37744257-37744279 TGCTGCAACAGGAGAGCAGGTGG + Intergenic
973116306 4:46464363-46464385 AACAGGAGCTGGAGAGGAGGTGG - Intronic
973798741 4:54455126-54455148 TGAAGGAGCCTGAGAGCAGGGGG - Intergenic
974025792 4:56732167-56732189 AGCAGGGCTTGGAGAGCTGGAGG - Intergenic
974749494 4:66117947-66117969 AGCAGGTGCTGGAGAGCATGTGG - Intergenic
975313410 4:72927518-72927540 TGCATGGCCTGAAGTGCAGGGGG + Intergenic
977299331 4:95250033-95250055 TGCAGGTTCTGGAGAGAAGAGGG + Intronic
977820399 4:101464857-101464879 TTTAGAACCTGGAGAGCAGGTGG - Intronic
978439106 4:108714923-108714945 TTGAGGCCCTTGAGAGCAGGAGG - Intergenic
978771132 4:112457319-112457341 TGCATGGCCTGGAGTGGAGGAGG - Intergenic
980591211 4:134891607-134891629 TGAAGGACCTGAAGACCAGTAGG + Intergenic
980852218 4:138396499-138396521 TGCTGGACCAGGAGAACATGAGG + Intergenic
981047822 4:140281639-140281661 AGCAGGTGCTGGGGAGCAGGTGG + Intronic
981634718 4:146863706-146863728 TGCATGCCCAGGAGAGCTGGTGG + Intronic
981790276 4:148528382-148528404 TGGAGAACCTGGAAAGCTGGTGG + Intergenic
985323325 4:188738753-188738775 TGCAGGAGTTGGAGGTCAGGAGG + Intergenic
985538673 5:477954-477976 GGCAGGGCCTGGAGAGCATGAGG + Intronic
985564312 5:607702-607724 AGAAGGATGTGGAGAGCAGGTGG + Intergenic
985800740 5:2004203-2004225 AGCAAGACCAGAAGAGCAGGGGG - Intergenic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
986331596 5:6720293-6720315 TGTAGGACCTTGAGGGGAGGAGG + Intronic
986385353 5:7227946-7227968 TGCAGGACCTGGAGAGTGGAGGG - Intergenic
986734853 5:10661128-10661150 GGCAGCACCTGCAAAGCAGGGGG - Intergenic
989170502 5:38467488-38467510 TGCAGGGCCAGGGGAGGAGGTGG - Intergenic
992755090 5:79896652-79896674 TTCAGGAGCTAGAGAGCAGAAGG - Intergenic
995461162 5:112404780-112404802 TGCAGGGCCTGGTGCACAGGAGG + Intronic
997211554 5:132079899-132079921 TGTGGGACCTGGGGAGGAGGGGG + Intergenic
997777889 5:136627806-136627828 TGCAGAACCAGGAAAACAGGTGG - Intergenic
997999032 5:138609683-138609705 GCCAGGACCTGGAGAGGCGGAGG + Intergenic
998153386 5:139769884-139769906 AGCAGGCCCTGGTGAGCATGGGG - Intergenic
998395822 5:141817120-141817142 TGAAGGACCTGGTCAGCTGGTGG + Intergenic
998513973 5:142736395-142736417 TGCTCAACCTGGAGAGCAGACGG + Intergenic
998514449 5:142739971-142739993 TGCAGGACCAGGAAAGCTGGTGG - Intergenic
998683724 5:144500269-144500291 TGCTGGAGCTGGAGAGGACGTGG + Intergenic
999160308 5:149490657-149490679 TGCAGGTCCAGGAGAGAAAGGGG - Intergenic
1000071560 5:157744554-157744576 TGGAGGACCTGGAGAGGTGGCGG + Intronic
1001336245 5:170799422-170799444 TGCAGGTGCTGGAGAGGATGTGG - Intronic
1002273187 5:178086381-178086403 TGCAGCGCCTGGAGATGAGGAGG + Intergenic
1004542550 6:16564879-16564901 TTCAGGAGATGGGGAGCAGGAGG - Intronic
1004691951 6:17999740-17999762 TGGAGAACCTGGAAAGCTGGTGG + Intergenic
1005302930 6:24488855-24488877 GGCAGGAGTTGGAGAGCAGAAGG - Intronic
1005685009 6:28245841-28245863 TGCAGAAGCTGGTGAACAGGAGG - Exonic
1005697587 6:28365541-28365563 TGCAGAAGCTGGTGAACAGGAGG + Exonic
1006148240 6:31971854-31971876 TGGAGGACCTGGAGGGAGGGTGG - Intronic
1006373335 6:33658655-33658677 TGCAGGAGCTGGGGGTCAGGTGG - Exonic
1006980636 6:38145121-38145143 AGCAGGAGCTGGAGGGCAGAGGG - Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1007768046 6:44172766-44172788 GGCAGAAGCTGGAGAGGAGGCGG + Intronic
1008020798 6:46575331-46575353 TGCTGGACCTGGAGAGAGTGGGG + Intronic
1008535701 6:52504747-52504769 CGCAGAGCCTGCAGAGCAGGGGG + Exonic
1008567352 6:52782643-52782665 AGCAGGATCTGGAGATCATGGGG + Intergenic
1008780229 6:55094521-55094543 AGCAGGTCCTGGAGAGGATGTGG + Intergenic
1010003033 6:70967358-70967380 TGGAGAACCAGGAAAGCAGGTGG - Intergenic
1010403427 6:75474919-75474941 AGCAGGAGCAGGAGAGAAGGGGG - Intronic
1011626393 6:89286926-89286948 TACAGGAGCTGGAGAGAAGCTGG - Intronic
1013623082 6:111909254-111909276 TGCAGGAACTGAAAGGCAGGAGG - Intergenic
1015962557 6:138665458-138665480 AGCAGGCCTTGGAGAGTAGGTGG - Intronic
1016841646 6:148531909-148531931 GGAAGGATCTAGAGAGCAGGGGG + Intronic
1016988294 6:149911026-149911048 CGCAGAACCCGGAGAGCACGCGG - Intergenic
1017011863 6:150068780-150068802 TGCTTGCCCTGCAGAGCAGGAGG - Intronic
1017312927 6:152995235-152995257 TGCAGGAGTTGGAGGTCAGGAGG - Exonic
1018229113 6:161658841-161658863 TGCAGGACCTGGACAACATAAGG - Intronic
1018638343 6:165884397-165884419 TGCAGGTCCTGGACAGCAGCTGG + Intronic
1018888458 6:167962434-167962456 TGCAGGACGAGGAGCGGAGGCGG + Exonic
1018971291 6:168531188-168531210 TGCATGCGGTGGAGAGCAGGGGG + Intronic
1019154424 6:170029656-170029678 TGCAGGACCTCAGGTGCAGGTGG - Intergenic
1020006808 7:4787758-4787780 TGCTGGACCTGCAGCTCAGGTGG + Exonic
1021564549 7:22004105-22004127 GGCAGGGCCTGGAGAGCCAGTGG + Intergenic
1022108509 7:27213654-27213676 TGCAGGGCCAGGAGAACAGCTGG + Intergenic
1022360067 7:29649255-29649277 TGCAGGCCCTGGGGAGCACGTGG + Intergenic
1022473513 7:30695586-30695608 GGCAGGAACTGGCCAGCAGGAGG + Intronic
1023806456 7:43876298-43876320 TGCAGGCCCAGGCGGGCAGGTGG - Exonic
1024314762 7:48005324-48005346 TGCATGAACTGGAGAGCATTTGG - Intronic
1024352110 7:48377003-48377025 GGCAGGACCTGGGGAGAAGCAGG + Intronic
1024586102 7:50843347-50843369 TGTAGGACCTGGAGAAGATGGGG - Intergenic
1025142298 7:56476238-56476260 TTCAGGACTTGGAGAGGATGGGG + Intergenic
1025176228 7:56803812-56803834 TTCAGGGCCTGGAGAGGATGGGG - Intergenic
1025187767 7:56874401-56874423 CAGAGGACCTGGAGAGGAGGTGG + Intergenic
1025230970 7:57203208-57203230 TGGAGGACAGGGAGACCAGGGGG - Intergenic
1025286094 7:57662989-57663011 AGTGGGACCTGGAGTGCAGGAGG - Intergenic
1025611119 7:63076454-63076476 TTCAGGACTTGGAGAGGATGGGG - Intergenic
1025684155 7:63702525-63702547 CAGAGGACCTGGAGAGGAGGTGG - Intergenic
1025695563 7:63772610-63772632 TTCAGGGCCTGGAGAGGATGGGG + Intergenic
1026178606 7:68019168-68019190 TTCAGGACCAGCAGAGAAGGGGG - Intergenic
1026881255 7:73908162-73908184 GGCAGGACCTGGAGGGCAGTGGG - Intergenic
1026988785 7:74571272-74571294 TGCATGACCAGGTGAGAAGGAGG + Intronic
1027189727 7:75989600-75989622 TGCAGGTTCTGGAGGGGAGGTGG - Intronic
1028121435 7:87059758-87059780 CGCTGGAGCTGGGGAGCAGGTGG + Intergenic
1029179029 7:98685967-98685989 TGAAGGACCTTGAGAGGAGGTGG + Intergenic
1030086466 7:105819850-105819872 TGCATGACCTTGAGGGCAGCAGG - Intronic
1030679654 7:112421767-112421789 TTCAGGACCTGGTGAACAGAAGG + Intergenic
1031107710 7:117565961-117565983 TACCAGACCTGGAAAGCAGGAGG - Intronic
1033282637 7:140017080-140017102 TGCAGTACCTGGAGAGCTGGAGG - Intronic
1033597078 7:142865945-142865967 TGGAGGACCTGGGGGGCCGGAGG - Exonic
1034528878 7:151683231-151683253 GGCAGGCGCTGGAGAGGAGGAGG + Intronic
1034558174 7:151863034-151863056 TGTAGGTCCTGGGGTGCAGGGGG + Intronic
1035162398 7:156960841-156960863 TGCAGGAGCTGGGGAGTAGGTGG + Intronic
1035306264 7:157934680-157934702 TGCAGGCTCTGGGAAGCAGGAGG - Intronic
1035530330 8:345942-345964 TGGAGCCCCTGGAGAGCCGGTGG - Intergenic
1035541618 8:443959-443981 GGCCAGACCTGAAGAGCAGGGGG - Intronic
1036621551 8:10427536-10427558 GGCACGTCCTGGTGAGCAGGCGG - Intronic
1037889206 8:22614503-22614525 GGTAAGAGCTGGAGAGCAGGAGG + Exonic
1038455004 8:27667275-27667297 TGCCTGGCCTGGAGGGCAGGTGG + Intronic
1039567465 8:38561419-38561441 TGAAGGAGCAAGAGAGCAGGTGG - Intergenic
1039888468 8:41668926-41668948 GGAAGGGCCTGGAGAGCAGAAGG - Intronic
1040400252 8:47043431-47043453 TGGAGGAACTGGAAAGCATGGGG - Intergenic
1040559806 8:48514439-48514461 TCCAGGACCAGGAGAACTGGTGG + Intergenic
1042966649 8:74360833-74360855 TGCATGATCTGTGGAGCAGGAGG + Intronic
1045379467 8:101608950-101608972 TGCAGAACCTGGAAAGCACAAGG + Intronic
1046795147 8:118363566-118363588 TTGAGGACCAGGAGAGCAGATGG - Intronic
1048355689 8:133652400-133652422 AGCAGGCCCAGGAGAGCAGGGGG - Intergenic
1049745522 8:144261648-144261670 AGCAGGATCTGGAGCGCTGGGGG - Exonic
1049996916 9:1043051-1043073 TGCTGACCCCGGAGAGCAGGCGG - Intergenic
1051924230 9:22304310-22304332 TCCAGGAACTGGAGGGGAGGGGG - Intergenic
1052164646 9:25309889-25309911 AGCAGGTCCTGGAGAGGATGTGG - Intergenic
1052252830 9:26419971-26419993 TACAGGATCTGGAGACCAGCTGG + Intergenic
1053047441 9:34931623-34931645 AGCAGGACCGGGAAAGAAGGGGG - Intergenic
1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG + Intronic
1057472307 9:95368646-95368668 TGCGAGCCCAGGAGAGCAGGCGG + Intergenic
1059089114 9:111336739-111336761 TGTATGACCTGAAGTGCAGGGGG - Intergenic
1060539780 9:124421490-124421512 TCCAGCTGCTGGAGAGCAGGAGG + Intergenic
1060616592 9:125021620-125021642 TGTAGGATATGGAAAGCAGGAGG - Intronic
1060859544 9:126943469-126943491 AGCAGGACCTGGAGAGTGGAAGG + Intronic
1061900907 9:133671507-133671529 TGCAGGGTCTGGACAGCACGGGG - Intronic
1062139313 9:134947221-134947243 TGCAGGACCAGGAGAGAAAGTGG - Intergenic
1062253837 9:135611639-135611661 TGCAGGGCTCGCAGAGCAGGTGG + Intergenic
1062454806 9:136630397-136630419 TCCAGGAGCTGGTGGGCAGGGGG - Intergenic
1185622638 X:1462772-1462794 GGCAGGACATGGAGAGAGGGAGG - Exonic
1186295358 X:8142945-8142967 TGGAGGACCTGGATAGGACGGGG + Intergenic
1186383413 X:9085157-9085179 TGCAGAACCTGCAGATAAGGAGG + Intronic
1188432126 X:30116063-30116085 AGCAGGGCCTAGGGAGCAGGTGG - Intergenic
1188467584 X:30499641-30499663 TGGAGAACCTGGAAAGCTGGTGG + Intergenic
1190552596 X:51600004-51600026 TGCAGGACGTGAAAAGAAGGTGG + Intergenic
1190881218 X:54494184-54494206 AGCAGGAGCTGGAGAGCTGCAGG - Intronic
1192210420 X:69124184-69124206 TGCAGCACCAGGAGAGAGGGAGG - Intergenic
1192596593 X:72414743-72414765 TGCAGTGGCTGGAGAGCAGAAGG + Intronic
1192937284 X:75873219-75873241 AGCAGTACCTGCAGAACAGGTGG - Intergenic
1193111203 X:77732243-77732265 TGCGGGACCTGGCCAGCTGGTGG - Intronic
1198061267 X:133047363-133047385 TGAAGTACTTGGAGAGCAGCAGG + Intronic
1198279153 X:135125078-135125100 TGGGAGACCTGGAGAGGAGGAGG - Intergenic
1198291804 X:135247442-135247464 TGGGAGACCTGGAGAGGAGGAGG + Intergenic
1198297834 X:135304377-135304399 TGGGAGACCTGGAGAGGAGGAGG + Intronic
1201187317 Y:11416801-11416823 TGCAGGAGCGGGAGATGAGGAGG - Intergenic