ID: 1083486889

View in Genome Browser
Species Human (GRCh38)
Location 11:62988683-62988705
Sequence CTGGGCCCGGAATTGTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083486882_1083486889 17 Left 1083486882 11:62988643-62988665 CCGAGCCTGGCTGAGTCTAGAAA No data
Right 1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG No data
1083486881_1083486889 28 Left 1083486881 11:62988632-62988654 CCTGACGAGCTCCGAGCCTGGCT No data
Right 1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG No data
1083486883_1083486889 12 Left 1083486883 11:62988648-62988670 CCTGGCTGAGTCTAGAAAAGACT No data
Right 1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083486889 Original CRISPR CTGGGCCCGGAATTGTGTTT GGG Intergenic
No off target data available for this crispr