ID: 1083488228

View in Genome Browser
Species Human (GRCh38)
Location 11:62996658-62996680
Sequence CTGCAAAGGACTAACTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083488224_1083488228 -9 Left 1083488224 11:62996644-62996666 CCTTCAGATTCTCCCTGCAAAGG 0: 1
1: 0
2: 1
3: 27
4: 254
Right 1083488228 11:62996658-62996680 CTGCAAAGGACTAACTCTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083488228 Original CRISPR CTGCAAAGGACTAACTCTGC TGG Intronic
908006354 1:59732987-59733009 CTTCAAAGGACTTTCTCTCCTGG + Intronic
909432810 1:75609193-75609215 CCTCAAAGGACTAACTGGGCTGG + Intronic
910711633 1:90188094-90188116 CTACAATGGACTAACACTGTGGG + Intergenic
912595821 1:110874794-110874816 CTGGAAAGGACAAAGTCTGTTGG + Intronic
916672900 1:167040218-167040240 CAGCAAAGGATTAACTCAGCAGG + Intergenic
919817547 1:201451044-201451066 CTGGAAAGGGTTAAGTCTGCAGG + Intergenic
921146917 1:212367142-212367164 CTGCAGAGGACTATCGCTGGAGG - Intronic
922854608 1:228763793-228763815 CTGCAAAGCAGTAACTTTGGAGG - Intergenic
923790560 1:237107785-237107807 CTGGAAAGAACTAAGGCTGCAGG - Intronic
924270144 1:242323996-242324018 CTGCAAAGATCTGACTCTACAGG - Intronic
1066714765 10:38274760-38274782 CTGCAAAGATCTGACTCTACAGG + Intergenic
1066783307 10:38975945-38975967 CTGCAAAGATCTGACTCTACAGG - Intergenic
1067284182 10:44895373-44895395 AAGCAAAGGACCATCTCTGCAGG - Intergenic
1068254843 10:54496285-54496307 CTCCAAAGGACTTCCTCTCCAGG - Intronic
1071128790 10:82368282-82368304 CTGCACAAGACTCACTGTGCTGG - Intronic
1072550217 10:96471535-96471557 CAGCAAAGGGCCAACCCTGCGGG + Intronic
1073538056 10:104295697-104295719 CAGCACAGGACCAAGTCTGCTGG + Intronic
1073547537 10:104363934-104363956 TTGCAAAGTGCTAATTCTGCAGG + Intronic
1076161791 10:128249665-128249687 CTGGAAGGGATCAACTCTGCGGG + Intergenic
1077252505 11:1566818-1566840 CTGCAAAGGCCTCAGACTGCCGG + Intronic
1079520054 11:21315707-21315729 TTGAAAGTGACTAACTCTGCAGG - Intronic
1080502485 11:32884003-32884025 TTGTAAAGGATTAACTCAGCAGG - Intergenic
1082027500 11:47583679-47583701 ATGCAAAGCACTAACACAGCAGG - Intronic
1082153832 11:48777388-48777410 CTGCAAAGGAATATTTCTGAGGG - Intergenic
1082602405 11:55174065-55174087 CTGCAAAGGAATATTTCTGAGGG - Intergenic
1083488228 11:62996658-62996680 CTGCAAAGGACTAACTCTGCTGG + Intronic
1086245709 11:84749752-84749774 CTGGGAAGAACTAACTCTGAAGG - Intronic
1097037107 12:56131198-56131220 CAGCCAAGGACTAACTCTCTTGG + Intronic
1097420449 12:59372346-59372368 CTGCAAAGGACTAAACCTACTGG + Intergenic
1111252519 13:85621718-85621740 TTGCCAGGGACTAACTCTGGGGG + Intergenic
1111603346 13:90502845-90502867 CAGCAAAGGGTTAACTCAGCAGG + Intergenic
1112895198 13:104290588-104290610 ATGCAAAGGATTAAATCTGATGG + Intergenic
1114264354 14:21063647-21063669 CTCCAGAAGACTGACTCTGCTGG + Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1115655797 14:35442432-35442454 GTGCAAAGGGTTAACTCAGCAGG + Intergenic
1116507659 14:45704524-45704546 CCTCAAAACACTAACTCTGCGGG + Intergenic
1120267234 14:82266348-82266370 CAGCAAAGGGTTAACTCAGCAGG - Intergenic
1120689704 14:87578833-87578855 CTGCAAAGGAGTAGCTGTGAAGG + Intergenic
1127246678 15:57184098-57184120 GGACAAAGGACTAAGTCTGCAGG - Intronic
1130126036 15:81094771-81094793 CTGCAGAGGACTTACCCTGCTGG + Intronic
1130444993 15:83992354-83992376 CTGCATAGGCCAAACACTGCAGG - Intronic
1131266346 15:90917709-90917731 CTGCTAAGGAGTAGCCCTGCTGG + Intronic
1131701176 15:94937074-94937096 CTGCAAAGGAGTAGCTCAGATGG + Intergenic
1134404208 16:13940875-13940897 CAGGAAAGGATTAACTCAGCAGG - Intronic
1136001221 16:27295240-27295262 ATGCAAAGGAATAAATTTGCTGG - Intergenic
1140720901 16:77770863-77770885 CTGGAAAGGAAGAACTATGCTGG + Intergenic
1143271097 17:5675169-5675191 CTGACAAGGACCAACTCTGTGGG - Intergenic
1146787899 17:35734427-35734449 CTGCTGAGCACTTACTCTGCTGG - Intronic
1146894764 17:36533519-36533541 CTGCAATGGATTAACCCTGGTGG + Intronic
1155642696 18:28038519-28038541 CCCCAAAGGCCTTACTCTGCAGG + Intronic
1157515061 18:48304945-48304967 CTGAACAGGCCTGACTCTGCAGG + Intronic
1157805386 18:50654160-50654182 CTGCCATGGGCTAACCCTGCAGG + Intronic
1161783449 19:6308900-6308922 ATAAAAAGGACAAACTCTGCTGG + Intronic
1163284120 19:16335621-16335643 CTGAAAAGCCCTCACTCTGCAGG + Intergenic
1163583316 19:18151018-18151040 CGGCCAAGGGCTTACTCTGCTGG - Exonic
1165899566 19:39162777-39162799 CTACCAAGGGCTGACTCTGCTGG - Intronic
930579334 2:53190935-53190957 CTGCATAAAACTAACTCAGCTGG - Intergenic
932088752 2:68786126-68786148 CTTCCATGGACTAACTCTTCTGG - Intronic
934780142 2:96964775-96964797 CTGCACAGGAGCAGCTCTGCTGG - Intronic
936152214 2:110028027-110028049 CTGCCAAGGACCAGCCCTGCAGG - Intergenic
936192464 2:110343386-110343408 CTGCCAAGGACCAGCCCTGCAGG + Intergenic
938117742 2:128613314-128613336 CAGCAAAGGGTTAATTCTGCAGG + Intergenic
938759359 2:134410056-134410078 GTGCCAAGGCTTAACTCTGCTGG - Intronic
946752335 2:222904982-222905004 CAGCAAAGGACTTACTCTAGAGG - Intronic
948637906 2:239351915-239351937 CAGCACAGGACTGGCTCTGCAGG + Intronic
1169351839 20:4874190-4874212 CTGCAAAGTACTGACTGTGGTGG - Intronic
1171764110 20:29243577-29243599 CTGCAAAGGAATATTTCTGAGGG - Intergenic
1174544647 20:51316369-51316391 CTGCAAGGGACTATATCAGCTGG + Intergenic
1177054299 21:16280787-16280809 CTGGAAAGGACTCATTTTGCAGG - Intergenic
1179090979 21:38265606-38265628 TTGCCAAGGGCTTACTCTGCAGG + Intronic
1181438875 22:22925469-22925491 CTGCCAGGGACTGACTCTCCTGG - Intergenic
1181915323 22:26275127-26275149 CAGTAAAGGATTAACTCAGCAGG - Intronic
950720550 3:14879527-14879549 TTGGGAAGCACTAACTCTGCAGG - Intronic
952947837 3:38492108-38492130 CAGCAAAGGACAAAATTTGCAGG + Exonic
954210143 3:49092163-49092185 CTGCAAACGCTTAAATCTGCGGG + Intronic
959457072 3:106575839-106575861 CTGCAGAAGACCACCTCTGCAGG + Intergenic
967388283 3:188930753-188930775 CTGCCAAGTACTTACTCTCCAGG - Intergenic
970656216 4:18233509-18233531 TTTCAAAGAACCAACTCTGCTGG + Intergenic
973918107 4:55657044-55657066 CAGTAAAGGATTAACTCAGCAGG - Intergenic
975315177 4:72944012-72944034 CAGGAAAGGATTAACTCAGCAGG + Intergenic
976848110 4:89513081-89513103 CTTCAAAGGACTGACACAGCTGG + Intergenic
981209744 4:142088987-142089009 CTGCAAAGCATTATCTTTGCTGG - Intronic
982722675 4:158875269-158875291 CTGGACAGCTCTAACTCTGCAGG + Intronic
983549054 4:168995757-168995779 CTGGAAACGTCTAACTCTCCAGG - Intronic
984087066 4:175326400-175326422 CTGCAGAGGACTCTCTGTGCTGG - Intergenic
987971308 5:24948009-24948031 ATGCAAAGGACTGGCTGTGCAGG + Intergenic
988371865 5:30380336-30380358 ATGCAAAGAACTAACCATGCAGG + Intergenic
989993843 5:50802995-50803017 CTGCAAATGATGAACTCTGTTGG + Intronic
992766357 5:80004433-80004455 CTGCAAAGGTCTGAGTCTGCGGG - Intronic
994638303 5:102371144-102371166 CTACAAAGGACTGACTATGGTGG - Intergenic
999309438 5:150542490-150542512 CTGGAAAGGACCAGCTCTTCTGG + Intronic
999865844 5:155699621-155699643 CAGAAAAGGGCTTACTCTGCTGG + Intergenic
1000070346 5:157734710-157734732 CTTTAAAGGACTACCTCAGCTGG + Exonic
1001123355 5:168997689-168997711 ATGCAAACTCCTAACTCTGCTGG + Intronic
1002650061 5:180684680-180684702 CTGCAACTGACCAACCCTGCAGG + Intergenic
1003173587 6:3738553-3738575 CAGGGAAGGACTCACTCTGCTGG + Intronic
1007067878 6:39011056-39011078 CTGAATAGGACTACCTATGCGGG - Intronic
1007383997 6:41508405-41508427 CTGCACTGGAGAAACTCTGCAGG - Intergenic
1008805586 6:55423270-55423292 CTGAAAAGGATTATCTCTTCTGG - Intergenic
1013162692 6:107561014-107561036 CTGCAAAGGTCTGTCTCTGGGGG + Intronic
1015317386 6:131831781-131831803 CTGAAAAAGACTACCTCAGCCGG - Intronic
1018078770 6:160240522-160240544 CTACAAAGGACCACCCCTGCAGG - Intronic
1018710007 6:166491688-166491710 CTGCAAAGGACGAATGCTGGAGG - Intronic
1020179122 7:5907602-5907624 CTTCAAAGGGCCAACCCTGCTGG - Intronic
1020275172 7:6619912-6619934 ATACAAAGGACTAACTAGGCTGG - Intronic
1020303813 7:6817267-6817289 CTTCAAAGGGCCAACGCTGCTGG + Intronic
1021067947 7:16199512-16199534 ATTCTAAGTACTAACTCTGCGGG + Intronic
1022516635 7:30978956-30978978 CTGCTAAGTACTACCTCTGGAGG - Intronic
1022593538 7:31689356-31689378 ATGCAGAGGACCAACTATGCAGG + Intronic
1024295257 7:47836713-47836735 CTGCACAGCTCTGACTCTGCTGG - Intronic
1025834341 7:65081085-65081107 CAGCAAAGGCCTGACGCTGCTGG - Intergenic
1026819659 7:73538205-73538227 CTGCAGAGGGCCATCTCTGCTGG + Intronic
1030901933 7:115135423-115135445 CTGAAAAGAACTGACTCTGGTGG - Intergenic
1030987545 7:116260275-116260297 ATGCAAAGGACCCACTGTGCTGG + Intergenic
1047452354 8:124976631-124976653 CTACAAAGGATGAATTCTGCTGG - Exonic
1047649355 8:126902737-126902759 CTGCAAAGAACCAAGTCTCCTGG + Intergenic
1049260984 8:141639159-141639181 CTGCAAAGGACAAGATTTGCTGG - Intergenic
1053468915 9:38331471-38331493 CTGGAAAGGGCTAACACAGCAGG - Intergenic
1054766854 9:69049151-69049173 CTGCCAGGGCCCAACTCTGCCGG + Intronic
1188829043 X:34873724-34873746 CTGCAAAGGACTGATTTGGCAGG + Intergenic
1188960069 X:36480163-36480185 CTCCAAAGTTCTAACTCTGATGG - Intergenic
1190356550 X:49610988-49611010 CAGGAAAGGATTAACTCAGCAGG - Intergenic
1193562451 X:83035353-83035375 CAGCAAAGGACAAATTCTCCAGG + Intergenic