ID: 1083488315

View in Genome Browser
Species Human (GRCh38)
Location 11:62997067-62997089
Sequence GCCCTTGCCATGGTTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083488315_1083488324 16 Left 1083488315 11:62997067-62997089 CCTCCCAAAACCATGGCAAGGGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1083488324 11:62997106-62997128 CTCTTCCCGAGAATTATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1083488315_1083488322 12 Left 1083488315 11:62997067-62997089 CCTCCCAAAACCATGGCAAGGGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1083488322 11:62997102-62997124 CCTCCTCTTCCCGAGAATTATGG 0: 1
1: 0
2: 0
3: 6
4: 109
1083488315_1083488326 21 Left 1083488315 11:62997067-62997089 CCTCCCAAAACCATGGCAAGGGC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1083488326 11:62997111-62997133 CCCGAGAATTATGGCAGGAATGG 0: 1
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083488315 Original CRISPR GCCCTTGCCATGGTTTTGGG AGG (reversed) Intronic
901033946 1:6325002-6325024 GCCCAGGCCGTGCTTTTGGGAGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902386540 1:16079145-16079167 GCCCCAGCCATGGCTCTGGGTGG + Intergenic
904462529 1:30688695-30688717 GCCCTTCGTTTGGTTTTGGGTGG + Intergenic
904489941 1:30852343-30852365 GCCCTGGGCAGGGTTATGGGAGG + Intergenic
907554708 1:55334102-55334124 GTCATTGTCATTGTTTTGGGCGG + Intergenic
915064729 1:153215409-153215431 GCCTCTTCCTTGGTTTTGGGTGG - Intergenic
919580929 1:199371894-199371916 GCCTTTGCTTTGGCTTTGGGAGG - Intergenic
920380134 1:205530377-205530399 CCCCTTTCCTTGGTTCTGGGTGG - Intronic
921052521 1:211521192-211521214 CCTCTTTCCCTGGTTTTGGGAGG - Intergenic
922255019 1:223886107-223886129 GCCATTGTAATGGTATTGGGAGG - Intergenic
1069821008 10:71228800-71228822 GTCCTTGCGATGGCTCTGGGAGG + Intronic
1072716319 10:97755123-97755145 GCCCTTGCCATCCTTGAGGGAGG - Intronic
1072738061 10:97892316-97892338 GCCCTTGCCATTGATTTGCGAGG + Intronic
1075614721 10:123882892-123882914 GCGCAGGCCATGGTGTTGGGAGG - Intronic
1077338360 11:2015406-2015428 GCCCTGGCTGTGGTTTGGGGAGG - Intergenic
1079092788 11:17492813-17492835 TCCCCTGCCATGATTCTGGGAGG + Intergenic
1080746539 11:35112977-35112999 GACATTGCTTTGGTTTTGGGAGG + Intergenic
1081524490 11:43916530-43916552 TCCTTAGCCCTGGTTTTGGGGGG + Intronic
1081868491 11:46372515-46372537 GTACTTGCCAAGGTTTTGTGGGG + Intronic
1083488315 11:62997067-62997089 GCCCTTGCCATGGTTTTGGGAGG - Intronic
1084054350 11:66622488-66622510 GCTCATGCCAGGGCTTTGGGAGG - Intronic
1084151321 11:67289216-67289238 GCGGTTGCCATGGTTGCGGGGGG + Intronic
1086330388 11:85748107-85748129 TCCCTTGCCTTGGATTTGGATGG - Intronic
1090651885 11:128814222-128814244 GCCCTTGCCTTGGTTTATAGAGG + Intergenic
1091120154 11:133050604-133050626 GCCCATGGCATGGTTCTGAGTGG - Intronic
1202821344 11_KI270721v1_random:70588-70610 GCCCTGGCTGTGGTTTGGGGAGG - Intergenic
1096359577 12:50972491-50972513 GCCATTGCCATGTTCTGGGGTGG + Intergenic
1096522047 12:52189877-52189899 GCCCCTGCCATGGGGATGGGAGG - Intronic
1096611138 12:52802607-52802629 GCCCCTGCCGTGCTCTTGGGTGG + Intergenic
1098817438 12:75185365-75185387 CCCCATGCAATGGTATTGGGAGG + Intronic
1100619654 12:96258842-96258864 GCCCTGGCAATGGTTTGGGTGGG - Intronic
1100800811 12:98228360-98228382 GTCCTTGTCATGTTCTTGGGTGG - Intergenic
1105624523 13:22100125-22100147 GCCCATGTTATGGTATTGGGAGG + Intergenic
1105929919 13:25042624-25042646 GCCCTTCCCATGGTGAGGGGTGG - Intergenic
1108783609 13:53867729-53867751 GACCTTTCCTTGGGTTTGGGTGG + Intergenic
1115500779 14:34047615-34047637 GCCCTCCCCATGGTATTGAGAGG - Intronic
1116664673 14:47759597-47759619 GTCTTTCCCATGGTGTTGGGTGG - Intergenic
1119212109 14:72839723-72839745 GCCCCTTTCTTGGTTTTGGGTGG - Intronic
1119749353 14:77066576-77066598 GACCTTGCCATGGTGTGGGAGGG + Intergenic
1121794541 14:96724261-96724283 TCTCTTGCCAAGGTTTTGGGGGG - Intergenic
1121974438 14:98389883-98389905 GGCATTGCCAAGGTTCTGGGAGG + Intergenic
1123625230 15:22222729-22222751 GCCCTCCCAGTGGTTTTGGGAGG - Intergenic
1124164857 15:27317288-27317310 GTCCCTGCCATGGAATTGGGGGG - Intronic
1127830857 15:62749782-62749804 GAGCTAGCCATGGTTTTTGGTGG + Intronic
1127837927 15:62805791-62805813 GAGCTTGGCATGGTTTTGGATGG + Intronic
1128518357 15:68358397-68358419 GCACCTGCCATGGGTTTGGGTGG + Intronic
1129416799 15:75388051-75388073 GCTTTTGCCTTGGTTTTGGAAGG - Intronic
1132153990 15:99482615-99482637 GCCATTGTGATGGTATTGGGAGG - Intergenic
1133222099 16:4323245-4323267 GCCCCTCCCAGGGATTTGGGTGG + Intronic
1135133438 16:19871025-19871047 GCTCATGCCAGAGTTTTGGGAGG + Intronic
1136415881 16:30103372-30103394 GCCCTTGACATGATATTGGCAGG + Intergenic
1139060078 16:63239416-63239438 GCCCTCTGCATGGATTTGGGAGG + Intergenic
1140108848 16:71985866-71985888 GCCTTGTCCATGTTTTTGGGAGG + Intronic
1142500234 17:328130-328152 CCCCTTGGCATGGTGCTGGGTGG - Intronic
1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG + Intronic
1147008866 17:37427606-37427628 GCCCTGGCCATGGGAGTGGGTGG + Intronic
1147551663 17:41447257-41447279 GCTCTTGCCATGGGGGTGGGTGG + Intergenic
1147890066 17:43710897-43710919 GCCATTGTGATGGTATTGGGAGG - Intergenic
1149578244 17:57728911-57728933 GCCTTCTCCATGCTTTTGGGGGG - Intergenic
1150137817 17:62705148-62705170 GCCCCTGCCAGGGCTTGGGGAGG + Intronic
1152726610 17:81949913-81949935 GCCTTGGGCATGGTTGTGGGTGG - Intergenic
1153198467 18:2625913-2625935 GCGCTTGCCATGGTGTTGTTAGG - Intergenic
1153228123 18:2912999-2913021 GCCCTTGCCATGGTAGTAAGTGG - Intronic
1157753716 18:50199759-50199781 TCCCTTGCCCTGGTTTGGGGGGG - Intergenic
1160678169 19:401391-401413 GGCTTTGCCTTGGCTTTGGGAGG - Intergenic
1162743314 19:12785758-12785780 GACCTTGCCAAGGTTCTGTGGGG + Intronic
1163318881 19:16560458-16560480 GCCCTTCTCAGGGTTTTAGGTGG + Intronic
925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG + Intergenic
925662064 2:6213177-6213199 GCCTGTGCCATGGTCTTGGCTGG + Intergenic
927712917 2:25336729-25336751 GGCCCTGCCTTGGTTTGGGGAGG - Intronic
928391525 2:30914501-30914523 CCCCTTGCCAAGGTCTGGGGTGG + Intronic
935306266 2:101739939-101739961 GCCCTTCCTATGCTTTGGGGAGG + Intronic
935886715 2:107628463-107628485 GTGATTGCCATGGGTTTGGGGGG - Intergenic
937495587 2:122415727-122415749 GCCAGTGCAATGGGTTTGGGAGG + Intergenic
937748682 2:125447320-125447342 GACTTTGCCATGTTTGTGGGAGG - Intergenic
939562146 2:143744778-143744800 GGCCTTTCCATGGTTGTAGGTGG - Intronic
942076042 2:172358073-172358095 GCCCTGGTCAGGGTTTGGGGAGG + Intergenic
944209984 2:197197188-197197210 GTCCTTACCATGATTTTGGATGG - Intronic
946361099 2:219219733-219219755 GCCCTTGCCATCTTTTAGGATGG - Exonic
947746021 2:232507773-232507795 GCCCTAGGCCTGGTTTTGGGGGG - Intergenic
1169204242 20:3731361-3731383 GCCCTTGCAAAGGTTTGGAGTGG + Intergenic
1169944560 20:10974818-10974840 GCCCTGTCCATGGTGTGGGGTGG + Intergenic
1170459586 20:16564822-16564844 GGCAGTGCCATGGTTGTGGGAGG - Intronic
1171438695 20:25144096-25144118 GCCCTTTCCAAGGTCTTAGGAGG + Intergenic
1173504155 20:43573940-43573962 GCCACTGCCATGGTGTTGGGGGG + Intronic
1174064702 20:47856068-47856090 GCCCTTCTCATGATTTTGGGGGG + Intergenic
1175865531 20:62174241-62174263 GCCCTCGCCATGCTGGTGGGGGG + Intronic
1176923609 21:14719746-14719768 GACCTTGCAGTGGTTTGGGGTGG + Intergenic
1177114225 21:17066185-17066207 GCCCTTGGAATGTCTTTGGGAGG - Intergenic
1178323648 21:31625437-31625459 GTCCTTGCCAAGGTTCTGGCAGG - Intergenic
1179660786 21:42873561-42873583 GACATTGCCATGGTTTTGTACGG + Exonic
952846555 3:37692779-37692801 CCCCCTGCCATTGTTTTTGGAGG - Intronic
954771041 3:52969155-52969177 GGCCTTTCCTTTGTTTTGGGAGG - Exonic
954848726 3:53582437-53582459 GCCTTTGTCATGGTTATTGGGGG + Intronic
955837306 3:63070478-63070500 CCCCTTGCCAAGGATTTGGCAGG - Intergenic
956959962 3:74387788-74387810 CCCCATGCCATTGTTTTGGGTGG + Intronic
957796149 3:85010442-85010464 GCCCTTGACATGTTTTGAGGTGG - Intronic
962422723 3:135242248-135242270 GCCCTTCCCATCACTTTGGGAGG + Intronic
966758056 3:183390002-183390024 GCCCCTACCAAGGCTTTGGGAGG + Intronic
966982638 3:185152668-185152690 GCACTTGCCATGGCTGTGCGTGG + Exonic
969618663 4:8268129-8268151 GCCCTGGCCAAGGTTGAGGGAGG + Intergenic
971067527 4:23050639-23050661 TACCTTGCTATGGTTTTGGAGGG - Intergenic
971407886 4:26339228-26339250 GACCTTGCCATAGTTTGGTGAGG + Intronic
971408241 4:26342327-26342349 GACCTTGCCATCGTTTGGTGAGG + Intronic
972276790 4:37565289-37565311 CCCCATGCGAAGGTTTTGGGGGG - Intronic
975906356 4:79217363-79217385 ACCTTTGCCATGATTTTAGGTGG + Intergenic
980078260 4:128317174-128317196 GCCATTGTGATGGTATTGGGAGG + Intergenic
987482708 5:18478476-18478498 GCCATTGTGATGGTATTGGGAGG - Intergenic
989196658 5:38723232-38723254 GCCCTTGCCAGAGATATGGGAGG - Intergenic
990985249 5:61635661-61635683 GCCTTTGCCAAGGCTTTGGTTGG + Intergenic
996919940 5:128756335-128756357 GACTTTGCCATGGTTTGTGGAGG - Intronic
997986507 5:138505501-138505523 GCCCCTGACCTGCTTTTGGGTGG + Intergenic
998446450 5:142202333-142202355 ACCTTTGCCATGGTCATGGGAGG - Intergenic
1001194204 5:169656663-169656685 GGCCTTGTCATTGTTTTGGCAGG - Intronic
1001315988 5:170641634-170641656 GCCCTAGCCTTGGTTGGGGGAGG + Intronic
1001456299 5:171862841-171862863 GGCCTTGCCAAGGTTCTGGCAGG - Exonic
1002815796 6:678676-678698 CCCCATGCCCTGGTTCTGGGAGG - Intronic
1003231756 6:4260125-4260147 GACCTTCCCATGGCTTTTGGTGG - Intergenic
1006952301 6:37832942-37832964 GCCCGTCCCAATGTTTTGGGAGG - Intronic
1009198377 6:60714497-60714519 GCCGTTGTCTTGGTTTTGGATGG + Intergenic
1009925754 6:70118819-70118841 GCCCTTGCCTTTGTTTTTAGAGG + Intronic
1010769094 6:79808072-79808094 CCCCTTGCCATGAATGTGGGTGG - Intergenic
1013082773 6:106826922-106826944 GCCCATGCCAGTGCTTTGGGAGG + Intergenic
1015936141 6:138407507-138407529 GCCCTGGCCATGGCTTTGGATGG + Intronic
1022947824 7:35304785-35304807 GCCCCTGCCTGGGCTTTGGGCGG - Intergenic
1023498620 7:40824878-40824900 GCCATTGTGATGGTATTGGGAGG - Intronic
1029256993 7:99276304-99276326 GCCCTAGACATGGATTTGGGAGG - Intergenic
1031910175 7:127508148-127508170 GCCCTTCCTATGGCTTTGTGTGG - Intergenic
1034497142 7:151429879-151429901 GCCCTTGCCATGGGTGGGGAGGG + Intronic
1034832155 7:154318800-154318822 GCTCATGCCATGGCTTGGGGGGG - Intronic
1039567300 8:38560493-38560515 GCCCTGGCTCTAGTTTTGGGGGG - Intergenic
1042138720 8:65657444-65657466 GCTCATGCCAATGTTTTGGGAGG + Intronic
1042327736 8:67546092-67546114 GCTCTTGACATGTTTTGGGGTGG - Intronic
1044137080 8:88599568-88599590 GCCATTGTGATGGTATTGGGAGG - Intergenic
1045557488 8:103228707-103228729 GCCCATGGCATGTCTTTGGGAGG + Exonic
1045920154 8:107520005-107520027 GCTGTTCCCATGGTTTTGGCTGG + Intergenic
1050978265 9:11970287-11970309 GACCTCACCATGTTTTTGGGGGG - Intergenic
1056577618 9:87868418-87868440 ACCCTTGCCCTGGATTCGGGGGG - Intergenic
1056704352 9:88939462-88939484 GCCCTTGCCTTGGGCTTGGATGG + Intergenic
1057024045 9:91722486-91722508 GCCCTTTCTGTGGGTTTGGGAGG - Intronic
1060972247 9:127744930-127744952 GGCCTTGCCAAGGGTGTGGGAGG + Exonic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061423033 9:130482389-130482411 GCCCTTGCCATGCCTGTGGCAGG + Intronic
1061423362 9:130484098-130484120 GCAGTTGCCATGGTGATGGGAGG - Intronic
1061836816 9:133334910-133334932 GCCCTTGCCATTGTGTTTGATGG - Intronic
1185852438 X:3501663-3501685 GCCTCTCCCATGGTTCTGGGTGG + Intergenic
1186039877 X:5464006-5464028 TCCCTTGACCTAGTTTTGGGGGG + Intergenic
1186173997 X:6906116-6906138 TCCCATGCCATGGCTCTGGGGGG + Intergenic
1186429188 X:9489840-9489862 GCCTCTGCCATGTTTGTGGGTGG + Intronic
1187440875 X:19318665-19318687 CCCTCTGCCATGCTTTTGGGTGG + Intergenic
1193798059 X:85900825-85900847 GAACTTGACTTGGTTTTGGGAGG - Intronic
1197412433 X:126135710-126135732 GTTCTTTGCATGGTTTTGGGGGG + Intergenic
1197620879 X:128746560-128746582 GCCTTTGTCATTGTATTGGGGGG + Intergenic
1198315857 X:135465266-135465288 GACATTGCCATGGTTTTGTATGG + Intergenic
1199338516 X:146647768-146647790 ACCCTTGCCCTTGTTCTGGGAGG - Intergenic
1201405103 Y:13642202-13642224 GCCCCTGCCAGGGGTTTGGAAGG - Intergenic