ID: 1083488433

View in Genome Browser
Species Human (GRCh38)
Location 11:62997853-62997875
Sequence GCTATGTGCACAGCCCGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083488433_1083488434 -6 Left 1083488433 11:62997853-62997875 CCAAAACGGGCTGTGCACATAGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1083488434 11:62997870-62997892 CATAGCAGATGCTCAATAAAAGG 0: 2
1: 18
2: 91
3: 377
4: 1159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083488433 Original CRISPR GCTATGTGCACAGCCCGTTT TGG (reversed) Intronic
901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG + Intergenic
903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG + Intronic
905124962 1:35709739-35709761 GCTGTGTGCCCTGCCCGTGTTGG + Intergenic
907277400 1:53324459-53324481 TCTATGTGCACAGCCAGCGTTGG + Intronic
912141603 1:106736774-106736796 GCTATGTGCACAGTCCTCATGGG + Intergenic
912978435 1:114350117-114350139 GCTATGTCCGCAGCCCCTTCAGG - Intergenic
913645033 1:120847615-120847637 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
914081696 1:144415937-144415959 GGTAAGGGCACCGCCCGTTTAGG + Intergenic
914099408 1:144570911-144570933 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
914176601 1:145284470-145284492 GGTAAGGGCACCGCCCGTTTAGG + Intergenic
914299575 1:146366766-146366788 GGTAAGCGCACCGCCCGTTTAGG + Intergenic
914452228 1:147802782-147802804 GCTCAGTGCACAGCCTGCTTGGG - Intergenic
914637063 1:149561791-149561813 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
921559144 1:216635809-216635831 GCTATGTTCACAGCAGGCTTAGG - Intronic
1069716966 10:70527337-70527359 GCCATGAGCACAGCACTTTTTGG + Intronic
1077325048 11:1960066-1960088 GCTATGAGCACAGCCCGGTGCGG - Intronic
1078548946 11:12267319-12267341 GCTAAGGGCAGAGCCTGTTTTGG - Intergenic
1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG + Intronic
1080851610 11:36075041-36075063 ACTGTCTGCACAGCCAGTTTAGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084370104 11:68735646-68735668 ACCATGTGCACAGTCCGTATAGG - Intronic
1202808030 11_KI270721v1_random:15245-15267 GCTATGAGCACAGCCCGGTGCGG - Intergenic
1095402645 12:41832820-41832842 ATTATGTACACAGCCCCTTTGGG - Intergenic
1099240413 12:80131446-80131468 GCTGTGTGCAAAGTCCTTTTTGG - Intergenic
1108605297 13:52031187-52031209 GCAATGTGCTGAGCCAGTTTTGG - Exonic
1112439072 13:99412458-99412480 GCTCTGTGCACAGCAGGTTGGGG + Intergenic
1119879391 14:78088350-78088372 GCTATGAGCAGAGCCCTTCTGGG + Intergenic
1121482423 14:94289418-94289440 GCTATGTGCCAAGCCCATCTGGG + Intronic
1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG + Intergenic
1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG + Intergenic
1124356857 15:29002059-29002081 GCTGTGTGTACTGCCCGTCTTGG + Intronic
1125583371 15:40803241-40803263 GCTATTTGGACAACCAGTTTAGG + Intronic
1129939802 15:79485568-79485590 GCTATGTGAACATCCCAGTTAGG + Intergenic
1143882826 17:10042912-10042934 GCTATGGTGACAGCCAGTTTAGG + Intronic
1158612578 18:58955627-58955649 GCCATGTTCACAGGCCATTTGGG - Intronic
1161367621 19:3889825-3889847 GCCATTTGCACAGCCCATCTCGG - Intronic
1162996807 19:14341141-14341163 GCAACGTGCACAGCACTTTTGGG + Intergenic
1165448174 19:35868325-35868347 GCTATGGGCTCCGCCCGTTGTGG - Intronic
1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG + Exonic
936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG + Intronic
942333208 2:174851171-174851193 GATATGTGCCCAACCAGTTTAGG - Intronic
946119247 2:217494879-217494901 GCACAGTGCTCAGCCCGTTTTGG - Intronic
1170281731 20:14656549-14656571 CCTATATGCACTGCCAGTTTTGG - Intronic
1178440413 21:32593827-32593849 GCTCTGTGCACAGGGCCTTTGGG - Intronic
1181427143 22:22851033-22851055 GCTGTGTGGACAGGCTGTTTTGG + Intronic
1183301055 22:37059399-37059421 ACTCTGAGCTCAGCCCGTTTGGG - Exonic
976734572 4:88296771-88296793 CCTGGGTCCACAGCCCGTTTGGG + Intergenic
981678415 4:147365979-147366001 GCCATGTGCATGGCCTGTTTGGG + Intergenic
985467746 5:13191-13213 GCAATCTGAAAAGCCCGTTTCGG + Intergenic
986231273 5:5866769-5866791 GCCATGTGCAGAGCCCGGTCTGG + Intergenic
991458200 5:66827420-66827442 GATATATGCAAAGACCGTTTGGG + Intronic
991478934 5:67055841-67055863 TCTATGTGCACAGTGTGTTTTGG - Intronic
993504308 5:88692336-88692358 ACTGTGAGCACAGCCCGCTTGGG + Intergenic
997114437 5:131111441-131111463 GCCATGAGCACAGTCAGTTTGGG - Intergenic
999665071 5:153904427-153904449 GCTAGGTGAACAGCCCTTCTGGG + Intergenic
1002153757 5:177258447-177258469 CCTATATGCACAGACAGTTTTGG - Intronic
1008645983 6:53515453-53515475 GCTATGTGCAGAGCCTTTTGGGG - Intronic
1021942159 7:25688521-25688543 GCTCAGTGGACAGCCTGTTTTGG - Intergenic
1028662921 7:93302202-93302224 GCTATGAGCACAGTCACTTTTGG + Intronic
1035224001 7:157423781-157423803 GCTCTGTCCACAGCCAGTGTGGG - Intergenic
1039966889 8:42290291-42290313 GCCAGGTGCACAGCCTGTCTGGG + Intronic
1043354457 8:79395950-79395972 GCAATGTCCACAGCTCTTTTTGG - Intergenic
1045476560 8:102557653-102557675 GCTATGGCCACAGCTGGTTTTGG - Intronic
1053176544 9:35929479-35929501 GCAAAGTTCACAGCCCCTTTGGG + Intergenic
1057963921 9:99484902-99484924 GCTGTGTGCACGGCTCATTTTGG + Intergenic
1190582671 X:51903743-51903765 GCTGTGTCCACAGCCAGCTTGGG + Intergenic
1190929159 X:54933778-54933800 GCTGTGTCCACAGCCAGCTTGGG + Intronic
1195702179 X:107713957-107713979 GCTTTGTGCACAGCCCAGTGTGG - Exonic