ID: 1083488434

View in Genome Browser
Species Human (GRCh38)
Location 11:62997870-62997892
Sequence CATAGCAGATGCTCAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1647
Summary {0: 2, 1: 18, 2: 91, 3: 377, 4: 1159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083488432_1083488434 -5 Left 1083488432 11:62997852-62997874 CCCAAAACGGGCTGTGCACATAG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1083488434 11:62997870-62997892 CATAGCAGATGCTCAATAAAAGG 0: 2
1: 18
2: 91
3: 377
4: 1159
1083488433_1083488434 -6 Left 1083488433 11:62997853-62997875 CCAAAACGGGCTGTGCACATAGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1083488434 11:62997870-62997892 CATAGCAGATGCTCAATAAAAGG 0: 2
1: 18
2: 91
3: 377
4: 1159
1083488428_1083488434 26 Left 1083488428 11:62997821-62997843 CCATGAGGATCAGAGACGACGTA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1083488434 11:62997870-62997892 CATAGCAGATGCTCAATAAAAGG 0: 2
1: 18
2: 91
3: 377
4: 1159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083488434 Original CRISPR CATAGCAGATGCTCAATAAA AGG Intronic
900969773 1:5985085-5985107 CACAGCAGGTGCTCAATCCAAGG + Intronic
901114233 1:6828598-6828620 AAGAACAGGTGCTCAATAAATGG - Intronic
901673322 1:10868287-10868309 CTCAGCAGATGCTCAACAAATGG - Intergenic
901712935 1:11129991-11130013 CATAGCAAAGACTCAATAAATGG + Intronic
901801155 1:11708767-11708789 CACAGCAGGTGCTCCATTAATGG + Intronic
901898188 1:12333234-12333256 CATGGCCAAGGCTCAATAAATGG - Exonic
901932007 1:12601975-12601997 CACAGTAGATACTTAATAAATGG - Intronic
902094370 1:13930525-13930547 CAAAGTAGATGCTCAATGGAAGG - Intergenic
902148518 1:14423584-14423606 CATAGTAAGTGCTCAATACATGG - Intergenic
902180848 1:14687245-14687267 CACAGCAGGTGCTTAATACATGG - Intronic
902419916 1:16270802-16270824 CATAGTAGTTGCTCAAAGAATGG - Intronic
902492745 1:16797054-16797076 CCTAGCAGAAACTCAATAAATGG - Intronic
902598723 1:17526538-17526560 CACAGCAAATGCTCAATGAAAGG + Intergenic
902613968 1:17613737-17613759 CAGAGCAGGTGCTCAGTTAATGG - Intronic
902620694 1:17649087-17649109 CACAGCAGGTGCTCAATACACGG - Intronic
902625120 1:17671873-17671895 CAGAGCAGGTGCTCAGTAAAGGG + Intronic
902758385 1:18564641-18564663 CATAGCAGATGCTCAATAAATGG + Intergenic
902787034 1:18739463-18739485 CATAGTAGATGCTCAATAAATGG - Intronic
902804582 1:18852929-18852951 CATAGTAGGTGCTCAACAAAAGG + Intronic
902821833 1:18948131-18948153 CAAAGTAGGTGCTCAATAAACGG + Intronic
902864230 1:19267803-19267825 TACAGTAGGTGCTCAATAAATGG - Intergenic
902866452 1:19283234-19283256 TACAGTAGGTGCTCAATAAATGG - Intronic
902893940 1:19465798-19465820 CATAGTAAGTGCCCAATAAATGG - Intronic
902897113 1:19486151-19486173 CATAGTAGGTGCTGAATAAATGG - Intergenic
902930030 1:19724567-19724589 TATAGTAGGTGTTCAATAAATGG + Intronic
902932727 1:19742774-19742796 CACAGGAGATGCTGCATAAAAGG + Intronic
902937944 1:19778175-19778197 CATAGTAGGCACTCAATAAATGG - Intronic
903029484 1:20452647-20452669 CAGAGCAGCTGCTCAGTCAATGG - Intergenic
903133234 1:21292662-21292684 CAGAGTAGGTGCTCAACAAACGG + Intronic
903189438 1:21648590-21648612 CATAGCAGGTGCCCAACAAGTGG + Intronic
903235420 1:21947369-21947391 CACAGTAGGTGCTCAATGAATGG - Intergenic
903343877 1:22672278-22672300 CATAGTAGGTGCTCATTAAATGG - Intergenic
903372735 1:22847384-22847406 CACAGCAGCTGCTCAATAAATGG + Intronic
903411917 1:23151692-23151714 CACAGTAGATGCTTAAGAAATGG + Intronic
903503653 1:23817039-23817061 CAGAGTACATTCTCAATAAATGG - Intronic
903610347 1:24606939-24606961 CCCAGGAGATGCTTAATAAATGG + Exonic
903648068 1:24906538-24906560 CATAGTAGCCGCTCACTAAACGG - Intronic
903682481 1:25106555-25106577 CATAATAGATGCTCAGTGAATGG + Intergenic
903722679 1:25417764-25417786 CATGGTACATGCTCAAAAAATGG + Intronic
903805629 1:26003697-26003719 CATAGGAGATAATCAATAAATGG - Intergenic
903815841 1:26063784-26063806 CAGAGCAGACCCTCAATAGAGGG + Intronic
903958948 1:27044568-27044590 CATAGTCAGTGCTCAATAAATGG + Intergenic
903982072 1:27196149-27196171 CATAGTAGGTGATAAATAAATGG - Intergenic
904069346 1:27781012-27781034 CATAGCAGGCGTTCAATAAATGG + Intronic
904088273 1:27926493-27926515 CATAGAGGCTGCTTAATAAATGG + Intergenic
904261900 1:29292318-29292340 CATAACAGGTGCTCAATAAGGGG - Intronic
904412524 1:30333023-30333045 CACAGCAGCTGCTCAATAAGTGG - Intergenic
904420593 1:30388579-30388601 CATAGCAGATGTTCAATGACAGG + Intergenic
904451181 1:30612974-30612996 CATGGCAAATGATCAGTAAATGG - Intergenic
904642541 1:31941152-31941174 AAGAGTAGATGCTTAATAAAAGG - Intronic
904839200 1:33360617-33360639 CCTAGTAGATGCTCAGTAAATGG + Intronic
904839385 1:33362233-33362255 CCTATTAGATGCTCAGTAAATGG + Intronic
904874006 1:33639632-33639654 CATAATAGAGGCTTAATAAATGG + Intronic
904911532 1:33937850-33937872 CATAGTAGGTGCTCACAAAATGG + Intronic
904961753 1:34338850-34338872 TATAGTGGATGCTCAATAAATGG + Intergenic
905033257 1:34901623-34901645 CATAGAAAGTGCTCAATAAATGG + Intronic
905149699 1:35918003-35918025 CATAGGAGGAGTTCAATAAATGG - Intronic
905270573 1:36784899-36784921 CATAGTAAATGATCAATGAACGG - Intergenic
905307359 1:37028890-37028912 AATAGTAAGTGCTCAATAAATGG - Intronic
905344918 1:37304791-37304813 TATAGCAGGTGCTCAATAAATGG + Intergenic
905392923 1:37649802-37649824 CACAGTAGATGCTCAATAAATGG + Intergenic
905452794 1:38067871-38067893 TAGAGCAGATGTTCAATAAATGG - Intergenic
905517689 1:38574074-38574096 CATGGCAGATGCTCACTGGAGGG + Intergenic
905606586 1:39306062-39306084 CATAGCAGGTATTCAATAAATGG + Intronic
905918456 1:41702146-41702168 CCAAGCAGAAGCTCAACAAATGG + Intronic
905928116 1:41766444-41766466 CACAGCAAGTGCTCAATTAATGG - Intronic
905946170 1:41903124-41903146 CATAGCAGGTGTTCAGTAAATGG - Intronic
906243724 1:44258505-44258527 CATGGTAGTTCCTCAATAAATGG - Intronic
906255582 1:44346875-44346897 AATAGCAAGCGCTCAATAAAAGG + Intronic
906676925 1:47699962-47699984 CATAGCATGTGCTCTATAAATGG - Intergenic
906683970 1:47750871-47750893 CATAGCAAGCCCTCAATAAACGG + Intergenic
906730262 1:48074826-48074848 CATAGTAGATGCTCAATAAATGG + Intergenic
906826690 1:48989004-48989026 CAGAGCAGATGATCTCTAAACGG - Intronic
906860998 1:49359431-49359453 TATAGCATATGTTCAATAAATGG + Intronic
906921973 1:50074412-50074434 TATAGAAGGTGCTCAGTAAATGG - Intronic
906975803 1:50571465-50571487 CATAGTAGGTGCTGAATGAAAGG + Intronic
907118224 1:51988374-51988396 TTTAGTAGGTGCTCAATAAATGG - Intronic
907260828 1:53217332-53217354 CATGGCAGATGGTCAGCAAAAGG - Intronic
907326282 1:53640578-53640600 CATAGCAGGTGCTCAGTGGATGG - Intronic
907537482 1:55178206-55178228 CAGAGCAGATACTGAATCAATGG + Intronic
907564613 1:55423204-55423226 AATAGTAGGTGCTCAATCAATGG + Intergenic
907659195 1:56376448-56376470 GAGAGCAGGTGCTTAATAAATGG + Intergenic
907834903 1:58099516-58099538 CATAGCAAATGGTGAATAAATGG - Intronic
907847715 1:58224468-58224490 CTCAGAAGATGCTCAATAACTGG - Intronic
907885466 1:58588763-58588785 CACAATAAATGCTCAATAAATGG + Intergenic
907902416 1:58752967-58752989 CATAGCAAGGGCTCAATAAATGG + Intergenic
907931769 1:59007363-59007385 CACAGTAGGTACTCAATAAATGG - Intergenic
907959574 1:59266080-59266102 CATAGAAGATGCTTAATATTTGG - Intergenic
907966449 1:59334534-59334556 CATAGTAGATGTTCAATATATGG + Intronic
908115760 1:60938503-60938525 CATAGAAGATGATCAGAAAATGG - Intronic
908139529 1:61169820-61169842 CATAGTAGCTGCTCAAGAAATGG + Intronic
908157440 1:61368628-61368650 CAGAGCTGATGCTTAATAAATGG - Intronic
908348759 1:63263267-63263289 CATAACAGGTGCTCAATGAAAGG + Intergenic
908420428 1:63953633-63953655 CCTAGTAGGTGCTCAATAAATGG + Intronic
908421645 1:63964247-63964269 CACAGCAAATGCTTATTAAATGG + Intronic
908442388 1:64168406-64168428 CATGGCAGATATTTAATAAATGG + Intronic
908462102 1:64355939-64355961 CATAGTAGATAGTTAATAAATGG - Intergenic
908635522 1:66159835-66159857 CACAGTAGGTGCACAATAAATGG - Intronic
908767564 1:67568357-67568379 CATACTATGTGCTCAATAAATGG - Intergenic
908789596 1:67768564-67768586 CATAATACATGTTCAATAAATGG - Intronic
908927727 1:69276639-69276661 CATAGCAAATGTTCAATAAATGG + Intergenic
908950372 1:69554110-69554132 CATAGTATGTGCTCATTAAATGG + Intergenic
908990313 1:70079651-70079673 CATAGCACGTGCTTAATATATGG - Intronic
909335865 1:74473121-74473143 CTTAGCATGTGCTCAATTAATGG - Intronic
909352954 1:74675121-74675143 GATAGTAAATGCTCAATAAAAGG - Intergenic
909428595 1:75557979-75558001 CATAGTATATGCTCAATAAATGG - Intronic
909494237 1:76260426-76260448 CATAGCAAGTGTTCAATAACTGG - Intronic
909494382 1:76262119-76262141 CACAGTAAGTGCTCAATAAATGG - Intronic
909497706 1:76297740-76297762 CATAGTAGATGCTCAATTAATGG + Intronic
909563210 1:77027379-77027401 CACAGTAAACGCTCAATAAATGG - Intronic
909594999 1:77396910-77396932 TATAGTAAATGCTTAATAAATGG + Intronic
909595399 1:77400481-77400503 CATAGTAGTTGTTCAGTAAATGG + Intronic
909686494 1:78354781-78354803 CATAGGAGATACTAAGTAAAAGG + Intronic
910123011 1:83811050-83811072 AAAAGCTGATGCTTAATAAAAGG + Intergenic
910321222 1:85946576-85946598 CATAGAAGGTGCTTAAGAAATGG - Intronic
910345401 1:86230814-86230836 CATAATAGATGCTCAATCATTGG - Intergenic
910366402 1:86470055-86470077 CATAGTAAGAGCTCAATAAATGG + Intronic
910483804 1:87687792-87687814 CATAGCAAGTGCTCTATAGATGG - Intergenic
910670131 1:89763929-89763951 CATAGTGAATGTTCAATAAATGG + Intronic
910869701 1:91821849-91821871 CATATTAAATGGTCAATAAATGG + Intronic
911060272 1:93741528-93741550 CATAGCAAGTGCTCAATAACTGG + Intronic
911218709 1:95224007-95224029 TATAGTAGCTACTCAATAAATGG + Intronic
911237488 1:95426783-95426805 CATAGTACATGCCCAATAATGGG + Intergenic
911478856 1:98410999-98411021 CATAGTAAATGTTCAATAAAAGG - Intergenic
911776624 1:101821561-101821583 CTCAGGAGATGCTCAATAAGTGG + Intronic
911793785 1:102051916-102051938 CATAGAAGAAGCCCAATCAATGG - Intergenic
912125909 1:106538081-106538103 CATAGTAGAAACTAAATAAATGG + Intergenic
912220465 1:107668170-107668192 CATGCCAGATGCTCAATGGAGGG - Intronic
912696568 1:111846700-111846722 CATAGCAAGTGCTCTGTAAAAGG - Intronic
912699769 1:111868603-111868625 TATAGTAAATGCTTAATAAATGG - Intronic
912895394 1:113581845-113581867 CATAGTAGGTACTTAATAAATGG - Intronic
912921341 1:113870123-113870145 CATACTAAGTGCTCAATAAATGG + Intronic
912953800 1:114138473-114138495 TATAGCAAATGCTTAACAAATGG - Intronic
912968730 1:114260486-114260508 CATACTAGGTGCTCAATAAGTGG + Intergenic
913003743 1:114607777-114607799 CATAGTATGTACTCAATAAATGG - Intronic
913141294 1:115943762-115943784 CATAGTAAGTCCTCAATAAATGG - Intergenic
913219435 1:116647489-116647511 CATAGTAAGGGCTCAATAAATGG - Intronic
913243368 1:116850139-116850161 CATAACAAGTGGTCAATAAATGG - Intergenic
913255780 1:116952100-116952122 CACAGTAGATGCTCAATAAATGG - Intronic
913304687 1:117415279-117415301 CATATTAAATGCTCAGTAAATGG + Intronic
913528850 1:119718726-119718748 CCCAGCAGGTGCTCAATAAATGG + Intronic
913569010 1:120101904-120101926 CATAGTAAATGCTTGATAAATGG + Intergenic
913693029 1:121297575-121297597 CTTAATGGATGCTCAATAAATGG + Intronic
914144527 1:144982505-144982527 CTTAATGGATGCTCAATAAATGG - Intronic
914261245 1:146000928-146000950 CATTATAGGTGCTCAATAAATGG - Intergenic
914289819 1:146262895-146262917 CATAGTAAATGCTTGATAAATGG + Intergenic
914454481 1:147823160-147823182 CATAGTAAGTACTCAATAAATGG + Intergenic
914550862 1:148713678-148713700 CATAGTAAATGCTTGATAAATGG + Intergenic
914995725 1:152541869-152541891 GATGGCAGATGTTGAATAAAAGG - Intronic
915068721 1:153247620-153247642 CATAGGATGTGCTCAATAAATGG + Intergenic
915119303 1:153618617-153618639 CAGAGCAGGTGCCCAATAAATGG - Intergenic
915204249 1:154257782-154257804 CAAAGCAGATACACAATAGATGG - Intronic
915327705 1:155089356-155089378 CATAGGAGGTGCTCAGTGAATGG - Intergenic
915329942 1:155104889-155104911 CATAGCAGGTGTTCAATAGTAGG + Intergenic
915388964 1:155523562-155523584 CATAGCGAGGGCTCAATAAAAGG + Intronic
915459725 1:156062611-156062633 CATAGTAAGTGCTCAATAAATGG - Intronic
915522691 1:156457096-156457118 CACAGAAGACGCTCAATAAATGG - Intergenic
916192772 1:162195187-162195209 CATAGTAGATATTCAATAAATGG + Intronic
916398346 1:164416824-164416846 CATAGTAGGTGCTTAATAAATGG - Intergenic
916487811 1:165274934-165274956 CATAGTAGGTGCTCAATAATTGG + Intronic
916990794 1:170242668-170242690 CATAATAGATGCTTAATAACTGG + Intergenic
917143297 1:171859565-171859587 CACAGTGGATGTTCAATAAAAGG - Intronic
917332950 1:173901274-173901296 CATAGCAGATGAAAAATTAATGG - Exonic
917747686 1:178026552-178026574 CATAGTAGATGCTCAATAAATGG - Intergenic
917750316 1:178047342-178047364 CATGGCAGGTACTCAGTAAATGG + Intergenic
917761071 1:178158604-178158626 CATAGCAAGTACTCCATAAATGG + Intronic
918099585 1:181361945-181361967 CATAGCAGGAGCTCATTAAATGG + Intergenic
918106595 1:181420635-181420657 TATAGCCAGTGCTCAATAAATGG - Intronic
918127808 1:181599572-181599594 CAGAGCAGAAACTTAATAAATGG - Intronic
918209477 1:182338255-182338277 CTTGGCAGATGCTCCATAAACGG + Intergenic
918384206 1:183988909-183988931 CATAGTAGATTCTCCACAAAGGG - Intronic
919564303 1:199164680-199164702 ACTAGTAGATGGTCAATAAATGG + Intergenic
919771419 1:201162037-201162059 TGTAGTAGATGCTCAATACATGG - Intronic
919841936 1:201615571-201615593 CATAGGAAGTGCTCAAGAAATGG - Intergenic
919856123 1:201707339-201707361 CAGAGTAGGTGCTCTATAAATGG - Intronic
919913651 1:202127225-202127247 CATAGGAAATGCTCATTAAATGG + Intronic
919928006 1:202202631-202202653 CATAGCAAATGCCCAATCTATGG + Intronic
919959966 1:202457195-202457217 CATGGCAGTCTCTCAATAAATGG - Intronic
920098541 1:203502133-203502155 CATAGTAGATGCTCCATAAATGG + Intronic
920196380 1:204230073-204230095 CAGAGGAGATGCTCCAGAAATGG + Intronic
920366863 1:205452543-205452565 CACAGTAGCTGCTCAATAAATGG + Intronic
920480351 1:206315945-206315967 CTTAATGGATGCTCAATAAATGG + Intronic
920507510 1:206526887-206526909 TATGGTAGGTGCTCAATAAATGG - Intronic
920698642 1:208201076-208201098 CATAGGAGATGCTTAATAAATGG - Intronic
921240537 1:213176871-213176893 TATAGTAGGTGCTCAGTAAATGG - Intronic
921265760 1:213419382-213419404 CATAGTAAGTGCTCAATCAATGG - Intergenic
921402744 1:214744177-214744199 CGTAGTAGAAGCTCAATACATGG - Intergenic
921649654 1:217661729-217661751 CAGAGCACATCCTCAATAATAGG - Intronic
922001320 1:221481317-221481339 CATAGGAAGTGCTCAGTAAATGG - Intergenic
922246590 1:223804914-223804936 CATAGTATATACTCAATAAATGG + Intronic
922526275 1:226306662-226306684 CATAGTAAATACTCAATAAATGG + Intronic
922573722 1:226648269-226648291 CACAGTAGGTGCTCAATGAAGGG + Intronic
923448803 1:234097370-234097392 CAAGGTAGGTGCTCAATAAATGG - Intronic
923527701 1:234785479-234785501 CCTAGCAGAAACTCAATAAATGG + Intergenic
923640975 1:235760316-235760338 TATAACAGGTGCTCAAAAAATGG + Intronic
923669329 1:236026648-236026670 CAGAGTAAATGCTCAGTAAATGG - Intronic
924441495 1:244089153-244089175 TATAGCAAAGGCTCAATAAAAGG - Intergenic
924557090 1:245127776-245127798 CATACTAGCTGCTCAATAAATGG + Intergenic
1063622696 10:7663902-7663924 CATTACAGATACTCAATAACTGG + Intronic
1063732547 10:8714853-8714875 GATAGCAAATATTCAATAAACGG + Intergenic
1064012999 10:11750618-11750640 TATAATAGGTGCTCAATAAATGG - Intronic
1064130787 10:12707930-12707952 CATAGGAGATACTCAGTAAATGG + Intronic
1064279189 10:13935676-13935698 CATCGCAGGTGCTGAAAAAAGGG - Intronic
1064305911 10:14166027-14166049 CATAGTAAATGCTCAATAAATGG + Intronic
1064857650 10:19788657-19788679 TATAGTAGATGCTAAATAAATGG + Intronic
1065577035 10:27131497-27131519 CATAGTAGATATTTAATAAATGG - Intronic
1066480680 10:35792861-35792883 CATAGTAGGTGCTCAGTAAGTGG - Intergenic
1066670370 10:37831129-37831151 CATAGTAGTTACTCAATTAAGGG + Exonic
1066791002 10:39063433-39063455 CTTTGCAGATGCTCCAAAAAAGG + Intergenic
1066795205 10:39112555-39112577 CTTGGCAGATTCTCATTAAAGGG - Intergenic
1066796898 10:39132189-39132211 CTTTGCAGATTCTCAAAAAAGGG - Intergenic
1068307781 10:55236201-55236223 CATATTAGATACTCAGTAAATGG + Intronic
1068598736 10:58933451-58933473 CATAGGAGGTGCTCAGTAACTGG - Intergenic
1068673482 10:59746333-59746355 CATAATAGACCCTCAATAAATGG - Intergenic
1069587505 10:69618221-69618243 CATAGTAAATGCTCAGTAAATGG + Intergenic
1069680943 10:70284493-70284515 CATAGTAGATGCTCAACAAATGG + Intergenic
1069739225 10:70676976-70676998 CAGAGGAGATGCTCAATATATGG + Intronic
1069979627 10:72243146-72243168 CATAGTAGACCCTCAATAAGTGG - Intergenic
1070005973 10:72424422-72424444 CATAGTACATACTCAGTAAATGG - Intronic
1070288759 10:75101314-75101336 TATGGTAGATGCCCAATAAATGG + Intronic
1070338085 10:75472572-75472594 CATAGTAGCTGCTCATTCAATGG + Intronic
1070644167 10:78189949-78189971 CATAGTGGGTGCTCAATAAAAGG - Intergenic
1070649912 10:78227976-78227998 CAGAGTAGGTGCTCAATAAATGG + Intergenic
1070770188 10:79077833-79077855 CATAGTAAGTGCTCAAGAAAAGG + Intronic
1070839286 10:79472258-79472280 CGTAGCAAGTGTTCAATAAATGG + Intergenic
1071432419 10:85616873-85616895 CACAGTAGGTGCTCAATAAATGG + Intronic
1071768581 10:88698510-88698532 CATAGTTGATGTTCAATAAATGG + Intergenic
1071846306 10:89524605-89524627 CATAGCAGATGATCACTTATGGG + Intronic
1071958470 10:90784503-90784525 CATAGGTCATCCTCAATAAATGG + Intronic
1072022328 10:91414432-91414454 CATAACAGATGTTCAATAATTGG - Intronic
1072195484 10:93114243-93114265 CATAGTAGGTCCTCAATAAATGG - Intergenic
1072326351 10:94302540-94302562 CATGCAAGGTGCTCAATAAATGG - Intronic
1072426580 10:95335425-95335447 CATACTAGATACTTAATAAATGG + Intronic
1072573118 10:96675759-96675781 CATAGTAAGTGCTCAATAAAAGG + Intronic
1072761003 10:98056773-98056795 CTCAGCACATGCTCAGTAAATGG + Intergenic
1072765812 10:98094287-98094309 CATAGAAAGTGATCAATAAATGG - Intergenic
1072847398 10:98847291-98847313 CATAACAGGTGTTCAATAAATGG - Intronic
1073068356 10:100777841-100777863 CATAGTAGATGTTCAGTAAGTGG + Intronic
1073772878 10:106754583-106754605 CACAGTAAATGCTCAACAAATGG + Intronic
1073789543 10:106926528-106926550 AATAGTAAATGTTCAATAAAAGG - Intronic
1074087259 10:110217892-110217914 CATAGTAAATGCTCAATACTAGG - Intronic
1074119012 10:110479457-110479479 CTCAGTAAATGCTCAATAAAAGG + Intergenic
1074164160 10:110859938-110859960 CACAGCAGTCACTCAATAAATGG + Intergenic
1074296360 10:112192977-112192999 CATAGAAATTGCTCAATAAAGGG - Intronic
1074297269 10:112201902-112201924 CAGAGTAAATGCTCAATAAATGG - Intronic
1074528949 10:114283742-114283764 CATAATAGATGCTCAGTTAAAGG + Intronic
1074701034 10:116092827-116092849 CACAGAAGATACCCAATAAATGG + Intronic
1074727027 10:116321576-116321598 CTTAGTAGAGCCTCAATAAATGG + Intergenic
1074904477 10:117849268-117849290 CATGGTAAATGATCAATAAATGG + Intergenic
1075001840 10:118804562-118804584 CATAGTAGGTGTTCAATAGATGG - Intergenic
1075300135 10:121314867-121314889 CACAGTACGTGCTCAATAAATGG - Intergenic
1075316554 10:121458066-121458088 CATAGTAGGTGCTTAATAAACGG + Intergenic
1075324069 10:121516324-121516346 CAGAGCAGATTCGCAACAAAAGG + Intronic
1075342105 10:121655357-121655379 CACAGCATTTGCTCAATAAATGG + Intergenic
1075479243 10:122765536-122765558 CATAGTAGTTGTTCAGTAAATGG + Intergenic
1075508427 10:123047755-123047777 TATAGCATGTGCTCAGTAAATGG + Intronic
1075540696 10:123311336-123311358 CTTAGTAGATGCTCAATAAATGG - Intergenic
1075821932 10:125322129-125322151 CAGAGCAGACACTCAATAACTGG - Intergenic
1075823693 10:125335620-125335642 CATAGAAGAGCCTCAATGAATGG + Intergenic
1075859143 10:125659799-125659821 TATGGCAGATGCTTTATAAATGG + Intronic
1075924715 10:126241791-126241813 AGCAGCAGATGCTTAATAAATGG + Intronic
1076160338 10:128238824-128238846 CATTTTAAATGCTCAATAAATGG + Intergenic
1077634159 11:3830721-3830743 CATAGCAAGTGCCCAATAAATGG + Intronic
1077865159 11:6216154-6216176 CAGAGCAGAGGCTAAATAAATGG + Intronic
1077939662 11:6827468-6827490 CATAGTAAATGTTCAATAAATGG + Intergenic
1078174847 11:8963006-8963028 CAGAGCAAATGCTCACTAAGTGG - Intronic
1078261824 11:9716615-9716637 CATGGTAGCTGCTCACTAAAAGG + Intronic
1078353707 11:10617239-10617261 CATAGTTGATGTTCAGTAAATGG - Intronic
1078469117 11:11572941-11572963 CAGAGTAGGTGCTCAGTAAATGG - Intronic
1078557993 11:12346289-12346311 CACAGTATAAGCTCAATAAATGG - Intronic
1078757788 11:14227621-14227643 CATATTAAGTGCTCAATAAATGG - Intronic
1078911428 11:15736305-15736327 CATGGTCGGTGCTCAATAAATGG + Intergenic
1079025071 11:16940627-16940649 ACTAGTAGATGCTCAAGAAATGG + Intronic
1079169088 11:18075004-18075026 CATAGTAAATCCTCAATAAATGG + Intronic
1079203131 11:18392324-18392346 CATAGCAGGTGCTCAGTAAATGG + Intergenic
1079248827 11:18772739-18772761 CATAGCAGGTGTTTAGTAAACGG - Intronic
1079324752 11:19482092-19482114 CACAGCAGACTTTCAATAAATGG - Intronic
1079325610 11:19488811-19488833 CATAGTAAGTACTCAATAAATGG - Intronic
1079376966 11:19901648-19901670 CATAGCAGGAGATTAATAAATGG + Intronic
1079526706 11:21398689-21398711 TCTGGCAGATGCTCAGTAAATGG + Intronic
1079725440 11:23875058-23875080 CATAGAATTTGCTCTATAAATGG + Intergenic
1079860806 11:25669048-25669070 CATAGCAGGTACTTAATAAGTGG - Intergenic
1080248353 11:30204673-30204695 CCTAGCAGGTGCTCAAAAAATGG + Intergenic
1080292367 11:30685170-30685192 CATGGCATGTGCTCAATAAATGG - Intergenic
1080321592 11:31016214-31016236 CATAGAAAGTGTTCAATAAATGG + Intronic
1080408530 11:32001412-32001434 CCTAGCAGGTACTCAAAAAATGG + Intronic
1080601802 11:33828502-33828524 CACAGAAAGTGCTCAATAAAAGG + Intergenic
1080607844 11:33878571-33878593 CATAGTAGGTGCTCAGTAAATGG + Intronic
1080608263 11:33882675-33882697 CATAATAAGTGCTCAATAAAAGG - Intronic
1080643246 11:34170311-34170333 CATAGTAAATGCTATATAAATGG + Intronic
1080652720 11:34235448-34235470 CATAGCAAGAGTTCAATAAAAGG + Intronic
1080682099 11:34486792-34486814 CATAGTAAGTGCTTAATAAATGG + Intronic
1080722609 11:34864790-34864812 CATAGTAGATGTTTAATAGATGG + Intronic
1080786940 11:35484083-35484105 TATAGTAAGTGCTCAATAAATGG - Intronic
1080786943 11:35484122-35484144 TATAGTAAGTGCTCAATAAATGG - Intronic
1080828234 11:35866171-35866193 CCTAGTAGGTGCTAAATAAATGG + Intergenic
1080852195 11:36079416-36079438 TACAGTAGATGCTCAATTAATGG - Intronic
1080971517 11:37282811-37282833 CATAACAGATGCTCGATAAATGG - Intergenic
1081109626 11:39118937-39118959 TATAGTAGTTGCTCAATAAATGG + Intergenic
1081206805 11:40285056-40285078 CATATCAAATGCTCAAGAAATGG - Intronic
1081206890 11:40286012-40286034 CATATCAAATGCTCAAGAAATGG + Intronic
1081273391 11:41116075-41116097 CAGAGTACATGCTAAATAAATGG - Intronic
1081605146 11:44522519-44522541 CATAGTAGGTGCTCAACAAACGG - Intergenic
1081730315 11:45367507-45367529 CAGGGCAGGTGATCAATAAATGG + Intergenic
1081885781 11:46494879-46494901 CCTAGCAGATACTTAATAAATGG - Intronic
1081953038 11:47062473-47062495 TATAGCATTTGCTCAATAAGGGG - Intronic
1082688074 11:56264198-56264220 TATAGCAAGTGCTCAATAAATGG - Intergenic
1082708513 11:56523021-56523043 CATAGTATTTACTCAATAAAAGG - Intergenic
1082797055 11:57385809-57385831 CCTAGTAAATGCTTAATAAATGG + Intergenic
1082889605 11:58124832-58124854 CAGAGAAGATGTTCGATAAATGG - Intronic
1082925615 11:58543471-58543493 CAATGCAGATGATCCATAAATGG - Intronic
1082932382 11:58622247-58622269 CATGGTAGATACTTAATAAATGG + Intronic
1083032531 11:59606226-59606248 CACAGCTCATGCTCAATAGATGG + Intronic
1083227145 11:61292483-61292505 TGTAGTAGGTGCTCAATAAATGG + Intronic
1083402842 11:62435864-62435886 CATAGCAAGTGTGCAATAAAAGG - Intronic
1083488434 11:62997870-62997892 CATAGCAGATGCTCAATAAAAGG + Intronic
1083694531 11:64433849-64433871 CATAGTAAGTGCTCATTAAATGG - Intergenic
1083841309 11:65306007-65306029 AACAGCAGAGGCTCAATGAAAGG + Intergenic
1084199633 11:67547145-67547167 CACAGTAAGTGCTCAATAAATGG + Intergenic
1084415955 11:69033155-69033177 CATAGTAGCTGCTCAGCAAATGG - Intergenic
1084523811 11:69683773-69683795 CATAACAGGTGCTCAGTAAATGG + Intergenic
1085101004 11:73799848-73799870 TATAGCAGGTGCTCAGTAAATGG + Intronic
1085198458 11:74686534-74686556 CATGGGAGATGCTCAGTAATTGG + Intergenic
1085199019 11:74690390-74690412 TATAGTAGGTACTCAATAAATGG - Intergenic
1085235869 11:75014964-75014986 CATAGAAGATGTTCAAAACATGG + Intronic
1085323579 11:75589666-75589688 CATAGTAGGTGCTCAATGCAAGG + Intronic
1085341673 11:75735452-75735474 CATAGTAGGTCCTCAGTAAATGG - Intergenic
1085391363 11:76183980-76184002 CACAGCAGGTGCACAATAAATGG + Intergenic
1085425979 11:76404945-76404967 CATAAACAATGCTCAATAAAGGG - Exonic
1085548476 11:77343973-77343995 CTTAGCAGGTGCTCAATAAATGG - Intronic
1085566086 11:77514775-77514797 CACAGCAGGTACTCGATAAATGG - Intergenic
1085611553 11:77954876-77954898 CATAACAAGTGCTTAATAAATGG + Intronic
1085715562 11:78870196-78870218 CATACCAGGAGCTCAGTAAATGG + Intronic
1085839954 11:80000522-80000544 CATAGTAAGTGCTCAGTAAATGG - Intergenic
1085858891 11:80208912-80208934 CATAGAAGATAATCAATAAATGG - Intergenic
1085949491 11:81312467-81312489 CATAGTATGTACTCAATAAAAGG + Intergenic
1086061437 11:82703600-82703622 CATCGGAGACACTCAATAAATGG + Intergenic
1086075655 11:82848650-82848672 CATGGTTGATGCTTAATAAATGG - Intronic
1086083542 11:82931040-82931062 AATAGCAGTGGCTCAATAAATGG - Intronic
1086101352 11:83103161-83103183 CATAGTTGTTGCTCAATAAATGG - Intergenic
1086151012 11:83610706-83610728 TGTAAAAGATGCTCAATAAATGG - Intronic
1086177043 11:83903094-83903116 TACAGAAGATGCTCAATAACAGG + Intronic
1086211922 11:84331200-84331222 AATAGTAGATGATCAATAAATGG - Intronic
1086215915 11:84380881-84380903 CATATCATATGCTACATAAATGG + Intronic
1086226943 11:84523210-84523232 CCTAGTAGTTGCTCAGTAAATGG - Intronic
1086392108 11:86375458-86375480 CAAAGTAAGTGCTCAATAAACGG + Intronic
1086434439 11:86767449-86767471 CATAGCAGGTATTCAATAAATGG + Intergenic
1086478919 11:87212118-87212140 CATAGCAAATGCCCAATAGCTGG + Intronic
1086480402 11:87230437-87230459 CATCATAGATGCTCAATACATGG - Intronic
1086504560 11:87491420-87491442 CATAGTAGATGCTTGATAAATGG + Intergenic
1086541963 11:87923739-87923761 CAGAGCAGGTGCTTAATTAATGG - Intergenic
1086886633 11:92213749-92213771 CATAGTAGATGCTCAATAAATGG - Intergenic
1086955182 11:92928323-92928345 CATAGTAAGTGCTCCATAAATGG + Intergenic
1087007592 11:93484592-93484614 CATACCAGAGGCTCAATAAATGG + Intronic
1087058484 11:93956281-93956303 TAAAGCTGATGCTAAATAAATGG + Intergenic
1087208741 11:95424494-95424516 CCCAGAAGATGCTAAATAAAAGG - Intergenic
1087520560 11:99229546-99229568 CACAGCAGGAGGTCAATAAAAGG + Intronic
1087600212 11:100304901-100304923 CACAGCAGAGCCTCAATAAATGG + Intronic
1087834053 11:102852539-102852561 CATAACTGATGATCAATATATGG - Intergenic
1087996993 11:104821640-104821662 CTTAGCACATACTCAATAAATGG + Intergenic
1088128995 11:106464639-106464661 TATAGTAGCTACTCAATAAATGG - Intergenic
1088233898 11:107701908-107701930 ATTAGCAAATGCTCAATAAATGG - Intergenic
1088408545 11:109507800-109507822 CATAGCAAATGTTCAGTAACTGG - Intergenic
1088461514 11:110088373-110088395 CACAGCAGGTGCTTAGTAAATGG + Intergenic
1088542069 11:110923337-110923359 TATAGTAAATGCTTAATAAATGG + Intergenic
1088582396 11:111328577-111328599 CATAGTATATGCACAGTAAATGG + Intergenic
1088709820 11:112498246-112498268 CATAACAAGAGCTCAATAAATGG - Intergenic
1088748398 11:112823444-112823466 TATGGCAGATGGTTAATAAATGG - Intergenic
1088774274 11:113067166-113067188 TATAGTAGGTGGTCAATAAAGGG + Intronic
1088846983 11:113676671-113676693 GATAGCAAGTGCTCAGTAAAAGG + Intergenic
1088961097 11:114665849-114665871 CATTGTAGGTGGTCAATAAATGG - Intergenic
1088986006 11:114909099-114909121 CATAGTAGGAGCTCAATAAATGG - Intergenic
1089166297 11:116479353-116479375 CATAGCAGGTGCACAATAAATGG + Intergenic
1089189806 11:116645359-116645381 CATGGCAGGTACTCAATTAAGGG + Intergenic
1089224128 11:116901274-116901296 CATAGCAGAGACTCAAGAAAGGG + Intronic
1089283142 11:117388325-117388347 CATAGCAGTTGCTGAACAAATGG + Intronic
1089401023 11:118164795-118164817 CATAATAGATGCTCAATAAATGG + Exonic
1089442664 11:118530256-118530278 CATAGTGGATGCTTAATAACAGG + Intronic
1089584243 11:119500026-119500048 CATAGTATTTGCTCAATTAATGG - Intergenic
1089898051 11:121951809-121951831 CAAAGCAAGTGCTCAATAAATGG - Intergenic
1090130251 11:124134773-124134795 TATAGAATATGCTCAGTAAATGG + Intronic
1091054585 11:132406230-132406252 CAAAGCAGATGCTCAGGGAAAGG + Intergenic
1091104490 11:132905887-132905909 TATAGCCAATGTTCAATAAATGG + Intronic
1091299633 11:134499139-134499161 CATAGCAGACCTTCAATAACAGG - Intergenic
1091341405 11:134818162-134818184 CATAGCAGATGCACCATAAATGG + Intergenic
1091537660 12:1427817-1427839 TATAGGACGTGCTCAATAAATGG + Intronic
1091686427 12:2566113-2566135 AGTTGAAGATGCTCAATAAATGG - Intronic
1091885853 12:4016578-4016600 CATCGTAGGTACTCAATAAATGG - Intergenic
1093463003 12:19423189-19423211 CATAGTAGACACTCAATATATGG + Intronic
1093538604 12:20253219-20253241 CAGAGCAGATGGTCAATGGAAGG + Intergenic
1093747117 12:22754678-22754700 TGTAGCAGGTACTCAATAAATGG - Intergenic
1093895119 12:24565810-24565832 CATAGCAAATGCTTAATAAATGG - Intergenic
1094007480 12:25770806-25770828 AAAAGCAAATGCTCAATAAATGG - Intergenic
1094054329 12:26253518-26253540 CATAGTAAATGCTTACTAAATGG + Intronic
1094724190 12:33095623-33095645 CATAATAGACCCTCAATAAATGG - Intergenic
1095768555 12:45924648-45924670 CATGACAGATGTTCAAAAAAAGG - Intronic
1096468624 12:51863034-51863056 CATAGCAGGTACTCCTTAAACGG + Intergenic
1096513145 12:52142973-52142995 CATAGTAAGTGCTCAATTAATGG + Intergenic
1096583746 12:52605502-52605524 CATAGTAAGTGCTCCATAAATGG - Intergenic
1096695035 12:53343615-53343637 CTTAGTAGTTGCTCCATAAATGG + Intronic
1096738017 12:53671376-53671398 CATGGTAAATGCTCAATAAATGG + Intronic
1096974178 12:55689226-55689248 AGTAGTAGGTGCTCAATAAATGG - Intronic
1097147270 12:56950513-56950535 CACAGCAGGGGCTCAACAAAGGG + Intergenic
1097151134 12:56980836-56980858 CACAGCAGGGGCTCAACAAAGGG + Intergenic
1097300251 12:58010310-58010332 TACAGTAGAGGCTCAATAAATGG - Intergenic
1097344740 12:58478255-58478277 CATGGCAGGAGCTGAATAAATGG - Intergenic
1097759170 12:63441014-63441036 GATAGTACATGCTCAATAAATGG + Intergenic
1098114421 12:67160059-67160081 CATAGTAAATGCTCAATAAATGG + Intergenic
1098199393 12:68038873-68038895 CAGAGCAAATACTCAATAAATGG + Intergenic
1098224021 12:68302170-68302192 CATAGAAGATCCAGAATAAAAGG + Intronic
1098233101 12:68392767-68392789 TATAGTAGGTGCTCAATAAGTGG + Intergenic
1098422520 12:70316014-70316036 TATAGTATGTGCTCAATAAATGG - Intronic
1098782882 12:74709570-74709592 CATAGTAGTTATTCAATAAATGG + Intergenic
1099164412 12:79285290-79285312 CATGGCAAAAGCTTAATAAATGG - Intronic
1099736965 12:86580424-86580446 CATAGTAGGTACTCAATTAATGG + Intronic
1099755100 12:86835964-86835986 CACCGCATATGCTCAATAAATGG - Intronic
1099802674 12:87476334-87476356 CATAGCAGATACAGAAGAAATGG - Intergenic
1099824680 12:87759719-87759741 CATAGAAGATTCTCAGTAAGTGG + Intergenic
1100021005 12:90069617-90069639 TATAGTAAGTGCTCAATAAATGG + Intergenic
1100140544 12:91613362-91613384 CATAGAAAATGCTCCTTAAATGG - Intergenic
1100195794 12:92242914-92242936 CAGAGTAGGTGCTCAGTAAATGG + Intergenic
1100217872 12:92471266-92471288 GATAGTAGGTACTCAATAAATGG - Intergenic
1100417071 12:94389365-94389387 CATAGTAGATACTTAATTAATGG - Intronic
1100434776 12:94561483-94561505 TGTAGCAGGTGCTCAATAAATGG + Intergenic
1100552592 12:95659657-95659679 CATAGTAAATGCTTACTAAATGG - Intronic
1100645406 12:96524476-96524498 CACAGTAGATACTCAATATATGG - Intronic
1100676174 12:96870557-96870579 CATACTGGATGCTCAATAACAGG + Intronic
1100737552 12:97553907-97553929 CATAGTAAATGCTCAACTAATGG + Intergenic
1100744114 12:97626647-97626669 CATAGTAAATGCTTCATAAATGG + Intergenic
1100798992 12:98211868-98211890 CATAGCAAATGCACAATAAATGG - Intergenic
1100802553 12:98248736-98248758 CATAAAAGATGCTCAATAAATGG + Intergenic
1100912980 12:99386970-99386992 TATAATAGGTGCTCAATAAATGG - Intronic
1101096458 12:101346741-101346763 CATAGTAAATGCTATATAAATGG + Intronic
1101120723 12:101576978-101577000 CAGAAAAGGTGCTCAATAAAGGG + Intronic
1101144450 12:101828168-101828190 CATAACAGACCCTCATTAAATGG - Intronic
1101248972 12:102913173-102913195 CCTAGTAGTTGCTCAATAAAAGG - Intronic
1101330440 12:103753500-103753522 CATAATAGATGCCCAATAAATGG - Intronic
1101447456 12:104747423-104747445 CATAGTAAGTGCTCAATATATGG + Intronic
1101603429 12:106230110-106230132 CATAGTAGGTGTTCAATAAAGGG - Intergenic
1101723814 12:107373546-107373568 AGTAGTAGATGCTTAATAAATGG + Intronic
1101729631 12:107416302-107416324 CCTGGCAGGTGCTCAATAAAAGG - Intronic
1101967150 12:109289617-109289639 CACAGTCGATGCTCAATAAAAGG - Intronic
1102008016 12:109601070-109601092 CATCGTAGGTGCTCAGTAAAGGG - Intergenic
1102016663 12:109652545-109652567 CACAGTAAGTGCTCAATAAATGG + Intergenic
1102023068 12:109697199-109697221 CATAGTAGGTGCTCAGTAAGTGG + Intergenic
1102048438 12:109844965-109844987 CATAGAAGATATTCAATAAATGG - Intergenic
1102260528 12:111440529-111440551 CACAGCAGATGCTCACTAAAGGG + Intronic
1102421852 12:112809562-112809584 CATAGCAAATGCTCAAAAACTGG - Intronic
1102467507 12:113138434-113138456 CATAGTAGGTGCTCAAGAAATGG + Intergenic
1102533247 12:113562178-113562200 TATAGCAAGTGCTCAATAAATGG + Intergenic
1102631318 12:114283177-114283199 CAGAGATGATGCTCAAGAAATGG - Intergenic
1102641070 12:114367091-114367113 CAGAGTAAATGCTCAACAAATGG + Intronic
1102715188 12:114964744-114964766 AATAGCAGTGGCTCAATAAATGG + Intergenic
1102760680 12:115382122-115382144 CACAGCAGGTACTCAATAAATGG + Intergenic
1102796543 12:115693749-115693771 CATAGTAGGTGCTTAATAACTGG - Intergenic
1102999100 12:117371702-117371724 CATAGTAAGTGCTCAAGAAATGG - Intronic
1103163042 12:118746220-118746242 CATAGTAGGTGCTCAGTAAATGG - Intergenic
1103322184 12:120098679-120098701 CATAGTAGGCACTCAATAAATGG + Intronic
1103440905 12:120962253-120962275 CATAATAAGTGCTCAATAAACGG + Intergenic
1103442236 12:120971844-120971866 CATAGTAGATATTCAAGAAATGG - Intergenic
1103784343 12:123421006-123421028 CATAGCAAATGCTCACTAAGTGG + Intronic
1104050992 12:125193689-125193711 CACAGCAAGTGCTCAAGAAATGG + Intronic
1104087350 12:125488352-125488374 CATACCATATGCTAAGTAAATGG - Intronic
1104278109 12:127349164-127349186 CAGATCAGATACCCAATAAATGG + Intergenic
1104708613 12:130968626-130968648 CATAACACAGGCTCAACAAAAGG - Intronic
1105410968 13:20170866-20170888 CATAGTTGGTGCTCAAAAAATGG + Intergenic
1105492263 13:20900477-20900499 CATAGTATGTACTCAATAAATGG + Intronic
1106010687 13:25818767-25818789 CACAGTAGGTGCTCAATAAATGG - Intronic
1106050365 13:26184597-26184619 CATGGCCAATACTCAATAAAGGG - Intronic
1106507446 13:30383514-30383536 CATAGTAGATATTTAATAAATGG - Intergenic
1106529336 13:30574415-30574437 CATAGATGATGTTCAATAAATGG + Intronic
1106674275 13:31941359-31941381 CATAACAGGTATTCAATAAATGG + Intergenic
1107035058 13:35893422-35893444 CACAGGAAGTGCTCAATAAATGG - Intronic
1107141512 13:37003381-37003403 CATAGCAAGTACTCAGTAAATGG - Intronic
1107203160 13:37747219-37747241 CCTGGCAGATGCTTACTAAATGG - Intronic
1107360699 13:39614765-39614787 TGTAGCAACTGCTCAATAAATGG + Intergenic
1107446565 13:40474699-40474721 CAAAGCAAATGCCCAACAAATGG - Intergenic
1107509291 13:41066647-41066669 CATAACAAATGGTGAATAAATGG + Intronic
1107732971 13:43366892-43366914 CATGGTAAATACTCAATAAATGG + Intronic
1107805475 13:44149799-44149821 TATAGTAGGTGCTCAATAATCGG - Intronic
1107870947 13:44746094-44746116 CATAGCAAATCCTCAATAAAAGG + Intergenic
1108441144 13:50453966-50453988 CATGGTAGATGCTCAACAAATGG + Intronic
1108681113 13:52781196-52781218 CATAGCAAGTGCTCAGTAAATGG + Intergenic
1109167011 13:59048025-59048047 CATAATAGGTGCTCAGTAAATGG + Intergenic
1109229308 13:59737401-59737423 CATAGTAGATTCTCAATAAATGG - Intronic
1109982661 13:69928980-69929002 CATAAGAGATGATCAATAATTGG - Intronic
1110485422 13:76035721-76035743 AATAGTCAATGCTCAATAAAAGG - Intergenic
1111166912 13:84470637-84470659 CATTGTAGGTGCTCACTAAATGG - Intergenic
1112241453 13:97685765-97685787 CCAAGCAGATGCTTAATCAATGG - Intergenic
1112838726 13:103549035-103549057 CATATCATATGCTAAATAAGGGG + Intergenic
1113644751 13:111986244-111986266 CATAGCAAATACTCAAGAAATGG + Intergenic
1113672875 13:112186940-112186962 CAAAACAGATGCTCAGTAGATGG - Intergenic
1114456073 14:22854378-22854400 TATACCAGAGGCTCAAAAAATGG + Intergenic
1114616348 14:24070531-24070553 CCCAGGAGATGCTCAATAAATGG + Intergenic
1114779874 14:25526860-25526882 CATAGTAAAAGCTCAATTAATGG - Intergenic
1115315515 14:32021051-32021073 TCTAGCACATGCTCAGTAAAGGG - Intergenic
1115813511 14:37135909-37135931 CATAGTAAGTGCTCAATAAATGG + Intronic
1116441458 14:44959359-44959381 CATAGCAAATACTCAAAACATGG + Intronic
1116813030 14:49557427-49557449 CATAGTAAATCCTCAATAAATGG + Intergenic
1116986417 14:51224349-51224371 CATAGGAGATACTTAATCAATGG - Intergenic
1117015599 14:51514059-51514081 CATGGAAGGTGCTCAATAAGTGG + Intronic
1117584542 14:57186762-57186784 CACAGCAAGTGCTCAATAAATGG - Intergenic
1117744221 14:58851616-58851638 CATAGCAGATGCTCTACAAATGG + Intergenic
1117998085 14:61496822-61496844 CGTAGTAGATGCTCAATAAATGG - Intronic
1118060403 14:62131781-62131803 CATAATAGCTGCTCAATAGATGG - Intergenic
1118456529 14:65949856-65949878 CATAGCAGATGCTTAGCATAAGG + Intergenic
1118683906 14:68271835-68271857 CATAGTAATTGCTCAATAAATGG + Intronic
1118699964 14:68423369-68423391 CAAAGTAGACTCTCAATAAATGG - Intronic
1118970418 14:70632088-70632110 CAAAGCTGACGCTCAATAAGAGG + Intergenic
1118989058 14:70781620-70781642 CAAAGTAAATGCTCAGTAAAAGG - Intronic
1119168888 14:72517639-72517661 AATAGTAGGTGCTCAATATATGG - Intronic
1119192820 14:72695279-72695301 CATAATAGATGTTCAATAAATGG + Intronic
1119220493 14:72902569-72902591 CCTAGCAGATGGTTAATAATTGG + Intergenic
1119259409 14:73228571-73228593 CCTGGCAGTTGCCCAATAAATGG + Intergenic
1119879243 14:78087099-78087121 CATAGTAGTTGCTCAATAAATGG + Intergenic
1120006219 14:79360903-79360925 AGTAGTAGTTGCTCAATAAATGG + Intronic
1120092052 14:80343300-80343322 TATAGCAGATACTCAATAATTGG - Intronic
1120321740 14:82970700-82970722 CACAACAGCTGCTAAATAAATGG + Intergenic
1120354796 14:83418085-83418107 CATAGTTGCTGATCAATAAATGG - Intergenic
1120715251 14:87834508-87834530 CATAGTAAATGCTCAAAAAATGG - Intergenic
1120997950 14:90430838-90430860 CATAATAGTTGCTCAATGAACGG - Intergenic
1121046397 14:90791357-90791379 CAGAGTCCATGCTCAATAAATGG + Intronic
1121100489 14:91246696-91246718 CAAAGCAAATGCTCAGGAAATGG - Intronic
1121182546 14:91940401-91940423 CAAAGAAGGTGATCAATAAAAGG + Intronic
1121404460 14:93710978-93711000 TCTAGTAGATGCTCAATAAATGG - Intergenic
1121408140 14:93731790-93731812 CACATTAGGTGCTCAATAAATGG + Intronic
1121490205 14:94352977-94352999 CATAGTAGGTGCTCAAGAAATGG - Intergenic
1121525697 14:94617497-94617519 GAGAGTAGCTGCTCAATAAATGG - Intronic
1121653581 14:95577813-95577835 CAAAATAGATGCTCAATAAATGG - Intergenic
1121829971 14:97042981-97043003 GACAGCAGGAGCTCAATAAACGG + Intergenic
1122249265 14:100426748-100426770 CCTAGCAGGTTCTCAGTAAATGG - Intronic
1122274694 14:100585570-100585592 CATAGCAGGCGTTCCATAAATGG + Intronic
1123964893 15:25445069-25445091 CATGGGAGGTGTTCAATAAATGG + Intergenic
1125058873 15:35394807-35394829 CATAACATATACTCAATAAAGGG + Intronic
1125073113 15:35579807-35579829 CCTTCCTGATGCTCAATAAAAGG - Intergenic
1125114847 15:36078472-36078494 CCAAGCAAATGCTTAATAAATGG + Intergenic
1125191553 15:36999772-36999794 CATAATAGCTGCTCAATAAATGG - Intronic
1125259405 15:37805289-37805311 CATAGTAGATGCTCAACAAAGGG + Intergenic
1125313140 15:38402421-38402443 CCTAGGAGGTGCTAAATAAAAGG + Intergenic
1125352477 15:38782332-38782354 CAAAGCAGATGCTGTTTAAAGGG - Intergenic
1125487234 15:40120392-40120414 TATAGTAAATACTCAATAAATGG + Intergenic
1125584186 15:40808692-40808714 CATAGTAAGTGCTTAATAAATGG + Intronic
1126067609 15:44837939-44837961 CATAGTAGGTGCTCAGTAAATGG - Intergenic
1126092269 15:45062943-45062965 CATAGTAAATGCTCAGTAAATGG + Intronic
1126450624 15:48804611-48804633 CATAGCAAATGTTCAGTAAATGG - Intronic
1127058095 15:55152993-55153015 CATGGTAAGTGCTCAATAAATGG - Intergenic
1127105832 15:55613980-55614002 CACTGTAGATGCTCAACAAATGG + Exonic
1127311642 15:57756947-57756969 CATAGTAGGTGCTCAATAAATGG + Intronic
1127450665 15:59113372-59113394 CGTAGTAGGTGCTCAATAAATGG - Intronic
1127585258 15:60372175-60372197 CATAGTAGGTACTCAGTAAAAGG - Intronic
1127623369 15:60755698-60755720 CATAGAAGCTGTTCAAGAAATGG + Intronic
1127641694 15:60921863-60921885 CATGGTAGGTGCTCAATATATGG + Intronic
1127661843 15:61106895-61106917 CATAGCACGTGTTCCATAAAGGG - Intronic
1127704424 15:61533010-61533032 TGTAGTAGATGCTCAATAAATGG - Intergenic
1127710551 15:61593352-61593374 CATAGTAGGTGCTCAGTAAATGG + Intergenic
1127812240 15:62574205-62574227 CATAGCTGATGCTTAGTAATGGG + Intronic
1127862767 15:63008161-63008183 CATAGTACATGCTCAATAAATGG - Intergenic
1127903925 15:63361968-63361990 CATAGAAAGTGCTCATTAAATGG - Intronic
1128324803 15:66717367-66717389 CATAGCATACACTCAATAAATGG - Intronic
1128399154 15:67259494-67259516 CATAGCAAGAACTCAATAAAAGG - Intronic
1128567736 15:68712205-68712227 CACAGCAGGTGCTCAAAAAATGG - Intronic
1128580042 15:68803291-68803313 CATGGCAGATACTCAATAAGGGG + Intronic
1128784013 15:70381494-70381516 CATGGTAGATGCTCCATAAAGGG - Intergenic
1129121080 15:73397105-73397127 CATAGTAGGCACTCAATAAATGG + Intergenic
1129176031 15:73840245-73840267 CAGAGCAGGTGCTTAACAAATGG - Intergenic
1129200748 15:73997789-73997811 AGAAGTAGATGCTCAATAAATGG + Intronic
1129712843 15:77829513-77829535 TACAGAAGGTGCTCAATAAAGGG - Intergenic
1129807789 15:78478908-78478930 CATAGTAAATGCTCAATAAGGGG + Intronic
1129892967 15:79083883-79083905 CACAGCAGGTGCTCAATAAATGG + Intronic
1130152203 15:81319729-81319751 CTTACTAGGTGCTCAATAAATGG - Intronic
1130449036 15:84032240-84032262 CATGGAAGATGCTCAATATCTGG + Intronic
1130509132 15:84573915-84573937 CATGATAAATGCTCAATAAATGG + Intergenic
1130733521 15:86524027-86524049 CATAGTAGATGTTCAAAAAGTGG - Intronic
1130805972 15:87322717-87322739 TATAGTAGCTGCTAAATAAATGG - Intergenic
1130837895 15:87669578-87669600 CATAGAAAATTCTCAATAATTGG - Intergenic
1130894722 15:88161054-88161076 CATAGCAGGTACTCAATGCATGG + Intronic
1130916401 15:88308527-88308549 CATAGTAAAAACTCAATAAACGG + Intergenic
1131290475 15:91102478-91102500 CAAAGTAGGTGCTCAAGAAATGG + Intronic
1131348052 15:91669515-91669537 CATAGCAGGTGATCAACAAATGG - Intergenic
1131370254 15:91875172-91875194 CACAGCGGATGCTCAGTAAATGG - Intronic
1131539988 15:93267922-93267944 CAGAGCAGGTGTTCCATAAATGG - Intergenic
1131551418 15:93360266-93360288 CATGGTAGATGCCCAATAAATGG - Intergenic
1131792705 15:95982281-95982303 AATAGTAGGTGTTCAATAAATGG + Intergenic
1131801340 15:96072634-96072656 CATAGTAGGTGTGCAATAAATGG + Intergenic
1131900244 15:97080004-97080026 CATAGTGGATGCCCAATAGATGG + Intergenic
1132009658 15:98265261-98265283 GACAGCAGATGCTCAATAAGTGG - Intergenic
1132205435 15:99983273-99983295 CACAGTAGGTGCTCAATAAGTGG + Intronic
1132300310 15:100771240-100771262 CTTGGCAGGTGCTCCATAAATGG + Intergenic
1132407680 15:101553990-101554012 AATAGCAGCTGCTCGAAAAATGG - Intergenic
1132844015 16:1991776-1991798 CATAGTAGATGCTCACTAAACGG + Intronic
1133326971 16:4947758-4947780 CACAGTAGGTGCTCAATAAATGG - Intronic
1133385874 16:5370038-5370060 CATAGTAGGTGCTCAATACATGG - Intergenic
1133521241 16:6559749-6559771 CATAGTAGGTGTTCAATATATGG - Intronic
1133599476 16:7325168-7325190 CATAGCAAACACTCAGTAAATGG - Intronic
1133689588 16:8200322-8200344 GATAGTAGTTGCTCCATAAATGG - Intergenic
1133723427 16:8516136-8516158 AATACTAGGTGCTCAATAAATGG + Intergenic
1133739813 16:8642669-8642691 CATAGTAGGTGCTCAATAAGTGG - Intronic
1133748875 16:8708872-8708894 AACAGCAGGTGCTCAATAAACGG + Intronic
1133905585 16:10019386-10019408 TACAGCAGAGGCACAATAAATGG + Intronic
1133933609 16:10251819-10251841 CAGAGCAGGCCCTCAATAAATGG + Intergenic
1134212915 16:12293044-12293066 CATAGTACATGCTTATTAAATGG - Intronic
1134301250 16:12993561-12993583 CATGGTAGATGCTCAGTAATTGG - Intronic
1134331361 16:13254136-13254158 CATAGTAGACTTTCAATAAATGG - Intergenic
1134386347 16:13776968-13776990 CCAAGTAGATGCTCAGTAAATGG - Intergenic
1134640224 16:15824027-15824049 CATAGTAAGTGCTCAATGAACGG - Intronic
1134640653 16:15827112-15827134 TATAGTAGGTGCTCAGTAAATGG - Intronic
1134781002 16:16895619-16895641 CATAGTAAGGGCTCAATAAATGG - Intergenic
1134811417 16:17170142-17170164 CATAGCAGGTGCGCAGTAACTGG + Intronic
1134844498 16:17428503-17428525 CATGCTAGATGCTCAATAAATGG + Intronic
1134890102 16:17833790-17833812 CATAGTAGGTGGTCAATAAATGG - Intergenic
1135007247 16:18836844-18836866 CACAGCAGGTGCTCAGTAAAAGG - Intronic
1135019745 16:18953459-18953481 TATAGCAGGTGCTTAATAAATGG - Intergenic
1135206331 16:20487460-20487482 CATGGCAAATGCTTAATAAATGG - Exonic
1135212589 16:20536448-20536470 CATGGCAAATGCTTAATAAATGG + Exonic
1135290605 16:21234685-21234707 CATAACAAATACTGAATAAATGG - Intronic
1135465964 16:22685096-22685118 CATAATAGAGGCTCAATAAATGG + Intergenic
1135726986 16:24862265-24862287 CATAGTAAACACTCAATAAATGG + Intronic
1135776169 16:25258542-25258564 CATAGTAGGTGCTCAAGAGAGGG - Intergenic
1135823319 16:25704063-25704085 GATAGTAGATGCTCAATGCATGG + Intronic
1135863929 16:26083010-26083032 CATAGAAAATGCTCAATGAGTGG + Intronic
1135872531 16:26164135-26164157 CAGAACGAATGCTCAATAAATGG + Intergenic
1135880708 16:26253102-26253124 CATTGCAGCTGCTGAATCAAGGG + Intergenic
1135882801 16:26275548-26275570 CATAGTAGATGCTCAGTCATGGG - Intergenic
1135985742 16:27182676-27182698 CATAGTAAATGCTCAGTAAGTGG - Intergenic
1136091831 16:27926250-27926272 CATAGCAGGTCCTTAATAAATGG - Intronic
1136105119 16:28024950-28024972 CATAATAGGTGCTCAATAAATGG + Intronic
1136533350 16:30884374-30884396 CGTAGTAAGTGCTCAATAAATGG - Intronic
1136569317 16:31087410-31087432 CATGGCAGATTCTCAGTAAATGG + Intronic
1137366048 16:47860601-47860623 CATATTAGGTGCTCAGTAAATGG - Intergenic
1137378938 16:47979863-47979885 CATAGTAAGTGCTCAGTAAAGGG + Intergenic
1137409591 16:48216574-48216596 CATAGAATGTGCTCAATAAAAGG + Intronic
1137466747 16:48716671-48716693 CATAGCAGGTACTCAATAGATGG - Intergenic
1137770394 16:51011910-51011932 CATAGTATGTTCTCAATAAATGG + Intergenic
1137858990 16:51827377-51827399 CATCGTAGATGCTAAATACACGG - Intergenic
1137995989 16:53213420-53213442 CATAATAGATGCTCCATGAATGG + Intronic
1138070492 16:53988565-53988587 CATAGTAGGTGCTCAATAAATGG - Intronic
1138101567 16:54256117-54256139 CATAGTAGGTGTTCAATTAATGG + Intronic
1138159794 16:54742358-54742380 CGTAGCAGGTTCTCAAAAAAGGG - Intergenic
1138195468 16:55048635-55048657 CATAGTAAGTGCTCAATATAAGG + Intergenic
1138267094 16:55667456-55667478 TATAACAGGTGCTCAACAAACGG + Intronic
1138268991 16:55681183-55681205 CCCAGGAAATGCTCAATAAATGG - Intronic
1138315647 16:56067787-56067809 CACAGCAAGTGCTCAATAAATGG - Intergenic
1138564395 16:57822327-57822349 CACAGTAGCTGCTCAATACATGG + Intronic
1138807838 16:60112158-60112180 CATGGAAGATGCCCAATAAATGG + Intergenic
1138830543 16:60369303-60369325 AATAGAAAATGCTCAATAAATGG + Intergenic
1138831991 16:60385484-60385506 CATAGCAGCCCCTCAATAAAAGG + Intergenic
1139007272 16:62588000-62588022 ACTAGAAGATGCTCAACAAATGG - Intergenic
1139139016 16:64238640-64238662 CTTAATAGGTGCTCAATAAAAGG - Intergenic
1139157788 16:64465140-64465162 TATAGGAGATTCTCAATGAATGG - Intergenic
1139660574 16:68418006-68418028 CATATCAAGTGCTCAATAAATGG + Intronic
1139963897 16:70734707-70734729 CATAGTAGGTGCTCAATAAATGG - Intronic
1140104181 16:71944229-71944251 CACAGTAGATGCTCAATGAATGG - Intronic
1140212164 16:72978856-72978878 CATAGTAGGCACTCAATAAATGG - Intronic
1140696097 16:77535725-77535747 CAAAGGAGATGCTCCATAAATGG - Intergenic
1140864140 16:79044974-79044996 CATAATAACTGCTCAATAAAGGG + Intronic
1140920986 16:79537837-79537859 TATAGAAGGTGCTCAATCAACGG - Intergenic
1140955870 16:79864689-79864711 CATGGCAGTCACTCAATAAATGG + Intergenic
1140979561 16:80093779-80093801 CATAACAGATGTTTAATACAGGG - Intergenic
1141086407 16:81098614-81098636 CATAGCAAAGGCTCAATAGATGG - Intergenic
1141380716 16:83574157-83574179 CATAGAAGATGCTCTGGAAATGG + Intronic
1141911181 16:87059270-87059292 CATAGCAAGTGCTGAATAAAGGG - Intergenic
1141920610 16:87133139-87133161 CATAGGACATGCTCCATAAACGG - Intronic
1142147663 16:88499297-88499319 CATAGCTTGTGCTCAATAAATGG - Intronic
1143203477 17:5127818-5127840 CAATGCAGATGCTATATAAATGG + Intronic
1143421068 17:6792680-6792702 CATAGCAGGTGCTCACCAATTGG + Intronic
1143585986 17:7850707-7850729 CATAGTAGGTGCTCAATGAATGG - Intronic
1143735642 17:8910419-8910441 CATAGTAGGTGGTCAATAAATGG - Intronic
1143783604 17:9241674-9241696 CACAGCAGGTGCTCAATAAATGG - Exonic
1144243768 17:13341345-13341367 CATAGCAGATGGATAATAAAAGG + Intergenic
1144440455 17:15276637-15276659 CATACCACATGCTCCATAGATGG + Intergenic
1144958020 17:19029359-19029381 CATACTAGGTGCTCAGTAAATGG + Intronic
1144977138 17:19145161-19145183 CATACTAGGTGCTCAGTAAATGG - Intronic
1145066555 17:19765585-19765607 CAGAGCAGGTGCTTAACAAATGG + Intergenic
1145243684 17:21253730-21253752 CACAGCAAGTGCTTAATAAATGG - Intergenic
1145770982 17:27492886-27492908 CATGGTAGGTGCTCATTAAATGG + Intronic
1145936217 17:28716511-28716533 CACAGCAAATGCTTAATTAATGG + Intronic
1145960929 17:28886180-28886202 CCTAGCAGGTCCTCACTAAAAGG - Intronic
1145989287 17:29069205-29069227 CATAGTAAGTGCTCAACAAATGG + Intergenic
1146029481 17:29352659-29352681 CAAAGTACATGCTTAATAAAAGG - Intergenic
1146070859 17:29679866-29679888 CATAGTAGATGTTCAATAAATGG - Intronic
1146127811 17:30242627-30242649 CCTAGTAGAGGCTCAATAAATGG - Intergenic
1146290984 17:31607040-31607062 CGTGGAAAATGCTCAATAAATGG - Intergenic
1146309346 17:31755140-31755162 CACAGTAGGTGCTGAATAAATGG + Intergenic
1146320136 17:31840532-31840554 CAGAGCAGATGCTCAGGGAATGG - Intergenic
1146475561 17:33159906-33159928 CATAGAAAATGCTCAGTGAAAGG + Intronic
1146579295 17:34022520-34022542 CATAGCAGATACTAATTAAGTGG - Intronic
1146590188 17:34122051-34122073 CAGAGCAGGTGCCCAACAAATGG + Intronic
1146628144 17:34449586-34449608 TACAGCAGATGCTCAATGAAGGG + Intergenic
1146634476 17:34493946-34493968 CACAGGAGGAGCTCAATAAATGG + Intergenic
1146690869 17:34875172-34875194 CATTACAGGTGCTCAACAAATGG - Intergenic
1146787814 17:35733902-35733924 CATAGCAGGTGCCCAGAAAAGGG - Intronic
1146810419 17:35898789-35898811 CATACTAGGTGCTCAGTAAATGG + Intergenic
1146840525 17:36150011-36150033 CATAGCAAGTGCTCGATAAATGG + Intergenic
1146845103 17:36177563-36177585 CAATGCAGATGCTACATAAATGG - Intronic
1146857414 17:36265498-36265520 CAATGCAGATGCTACATAAATGG - Intronic
1146863205 17:36322877-36322899 CAATGCAGATGCTACATAAATGG + Intronic
1146873324 17:36389408-36389430 CAATGCAGATGCTACATAAATGG - Intronic
1146880678 17:36440494-36440516 CAATGCAGATGCTACATAAATGG - Intergenic
1146944199 17:36862998-36863020 CATAGTAAGTGCTCAATAAATGG - Intergenic
1146995010 17:37312528-37312550 CACAGTAAATGCTCAATAAATGG + Intronic
1147032491 17:37650897-37650919 CATAGCAGGCATTCAATAAATGG - Intergenic
1147066066 17:37923465-37923487 CAATGCAGATGCTACATAAATGG + Intergenic
1147076206 17:37990034-37990056 CAATGCAGATGCTACATAAATGG - Intronic
1147077597 17:38003025-38003047 CAATGCAGATGCTACATAAATGG + Intronic
1147087731 17:38069579-38069601 CAATGCAGATGCTACATAAATGG - Intergenic
1147103673 17:38193528-38193550 CAATGCAGATGCTACATAAATGG - Intergenic
1147330789 17:39698087-39698109 CATAATAATTGCTCAATAAATGG - Intronic
1147413546 17:40271797-40271819 CATAATAGATACCCAATAAATGG + Intronic
1147491727 17:40874842-40874864 CATAGTAAGTGCTCAATAAATGG + Intergenic
1147594442 17:41707599-41707621 CACAGCAGGTGCTCAGTAATTGG + Intergenic
1147739223 17:42660818-42660840 CACATCTGATGCTCCATAAACGG - Intronic
1148020995 17:44553587-44553609 CTTAGCAGGAGCTCAAAAAATGG + Intergenic
1148044741 17:44736451-44736473 CAGAATAGATGCTCACTAAATGG - Intronic
1148119061 17:45197132-45197154 CATAGCGGGTGCTCAGTGAAGGG + Intergenic
1148204410 17:45770920-45770942 TATAGTAGGTGCCCAATAAACGG + Intergenic
1148226431 17:45900907-45900929 CATAGTAACTGCTCAGTAAATGG + Intronic
1148335870 17:46841147-46841169 CATAGTAGGTGCTCAATAAATGG - Intronic
1148652296 17:49259051-49259073 CATAGTAGGTACACAATAAAAGG - Intergenic
1148982385 17:51589584-51589606 AATAGCAGGTGCTCAATAAATGG - Intergenic
1149273583 17:55011189-55011211 CACAGAAGGTGCTCAATATATGG - Intronic
1149344761 17:55723519-55723541 CACAGTAGGTGCTCTATAAATGG - Intronic
1149487072 17:57050836-57050858 TATAGCAACTGCTCAATACATGG - Intergenic
1149519938 17:57311073-57311095 CACAGTAGATGCTCAATATGTGG + Intronic
1149642049 17:58209297-58209319 CATAGCAGGCACTCAGTAAATGG - Intronic
1149848251 17:60020064-60020086 CAATGCAGATGCTACATAAATGG - Intergenic
1149861918 17:60126460-60126482 CAATGCAGATGCTACATAAATGG + Intergenic
1149964516 17:61148319-61148341 CATAGTAAGTACTCAATAAAAGG - Intronic
1150019263 17:61594190-61594212 CATAGTAAGTGGTCAATAAATGG - Intergenic
1150086602 17:62276631-62276653 CAATGCAGATGCTACATAAATGG - Intronic
1150151788 17:62815526-62815548 CACAGTAGCTGCTCAACAAACGG + Intergenic
1150448271 17:65244497-65244519 CATAGTATATCCTCAATCAATGG - Intergenic
1150923833 17:69512076-69512098 CATTGCAATTGCTCAATGAAAGG + Intronic
1151159726 17:72155145-72155167 CAAAGGAGATGCTAAATAAATGG + Intergenic
1151280361 17:73069397-73069419 CATAGTAAGTGCTCACTAAATGG + Intronic
1151338413 17:73454655-73454677 CATAGCAGCCATTCAATAAACGG + Intronic
1151355713 17:73557208-73557230 CATAGCGCACGCTCAACAAATGG + Intronic
1151424608 17:74022796-74022818 CGTAGTACATACTCAATAAATGG + Intergenic
1151676590 17:75601952-75601974 CATAGTAGGTGCTCACTGAATGG + Intergenic
1151696324 17:75719930-75719952 CATAGCAGGTGCTCAATAAAAGG - Intergenic
1151874901 17:76862248-76862270 TATAGTAGATGCTCAATAAGTGG + Intergenic
1151902389 17:77025122-77025144 CATAGTAAGTGCTCAGTAAAGGG - Intergenic
1151956608 17:77383309-77383331 CCTAGGAGGTGCTCAATTAAAGG - Intronic
1152429778 17:80242370-80242392 CACAGCAGGTGCTCAATAAGTGG - Intronic
1152889174 17:82870461-82870483 CACAGCAGATGCTCGTGAAAAGG + Intronic
1153101255 18:1472145-1472167 CATAGCAGACACTAAATAAATGG - Intergenic
1153939223 18:9962984-9963006 CAAAGCAGATGCTCAAGAAATGG + Intergenic
1155176452 18:23305582-23305604 CACAGTAGTTGCCCAATAAATGG + Intronic
1155338754 18:24792917-24792939 CATAATAAATGCTCAAGAAAAGG + Intergenic
1155412248 18:25559447-25559469 CTTAGTAAATGCTCAATAAATGG + Intergenic
1155790532 18:29963391-29963413 CATAGCTTATGCTCACTAAATGG - Intergenic
1156046008 18:32878171-32878193 CATGGTAGGTGCTCAATAGATGG + Intergenic
1156104292 18:33638816-33638838 CATTATAGATGCTCAATAAATGG + Intronic
1156179938 18:34591429-34591451 CATAACTGATACTCAAAAAATGG - Intronic
1156227085 18:35119949-35119971 CACAGCATGTGCTCAATAAATGG - Intronic
1156231320 18:35156483-35156505 CATAGTCGATACTTAATAAATGG + Intergenic
1156439860 18:37174060-37174082 CATGGCAGATACTTAATAGATGG - Intronic
1156575750 18:38313276-38313298 CACAGGAGATACTCCATAAATGG - Intergenic
1156680421 18:39581884-39581906 CATAATAGCTTCTCAATAAATGG + Intergenic
1156993307 18:43436360-43436382 CATAGATGAAACTCAATAAAGGG - Intergenic
1157411101 18:47464338-47464360 TATAGTGGGTGCTCAATAAAAGG - Intergenic
1157477519 18:48032932-48032954 CATAGCAGATGTTCAATAAAAGG - Intronic
1157579973 18:48768329-48768351 CATAGTAGATGCTCAGGAAATGG + Intronic
1157985156 18:52429141-52429163 CTTAACAGACACTCAATAAATGG - Intronic
1158532352 18:58274859-58274881 TGTAGTAGGTGCTCAATAAATGG + Intronic
1158540851 18:58352998-58353020 CATAGCAGATGCTTGATACTTGG + Intronic
1158657034 18:59346847-59346869 TATAGCAAGTGCTCAGTAAATGG - Intronic
1158669076 18:59458262-59458284 AACAGCAGATGCTCCATAGATGG - Intronic
1159052580 18:63435337-63435359 CATAGCAGACACTCAGTAACTGG + Intergenic
1159086866 18:63802432-63802454 TGTAGTAGGTGCTCAATAAATGG - Intronic
1159157491 18:64602728-64602750 CATAGTAGAAATTCAATAAATGG + Intergenic
1160031062 18:75260456-75260478 AGTAGCAGAAGCTCAGTAAATGG + Intronic
1160741473 19:688111-688133 CACAGCTGATGCTCAGTTAATGG + Intronic
1160919863 19:1514256-1514278 CACAGTAGGTGCTCAATAAATGG - Intergenic
1161205362 19:3038158-3038180 CATAGTAAATGCTCCATAAAGGG + Intronic
1161609298 19:5232015-5232037 CATAGTAGGTGCCTAATAAATGG - Intronic
1161609367 19:5232561-5232583 CATAGTAGGTGCCTAATAAATGG - Intronic
1161609376 19:5232618-5232640 CATAGTAGGTGCTTAATGAATGG - Intronic
1161609417 19:5232930-5232952 CATACTAGGTGTTCAATAAATGG - Intronic
1161609427 19:5232991-5233013 TATAGTAGGTGCTTAATAAATGG - Intronic
1162399562 19:10436727-10436749 CACAGCAGGTGCTCAACAAATGG + Intronic
1162529318 19:11226846-11226868 TACAGCAAGTGCTCAATAAATGG - Intronic
1162547996 19:11342608-11342630 TACAGCAGGTGCTCAATAAATGG + Intronic
1162733299 19:12731728-12731750 TACAGTACATGCTCAATAAAGGG - Intronic
1162843184 19:13371460-13371482 GACAGTAGGTGCTCAATAAATGG + Intronic
1162996416 19:14338733-14338755 CATAGTAGGCACTCAATAAATGG + Intergenic
1163009554 19:14416431-14416453 CATAGCAATGGCTGAATAAATGG + Intronic
1163425413 19:17238232-17238254 CACAGTAGGTGTTCAATAAATGG - Intronic
1163527326 19:17829798-17829820 CACAGTCGATGCTCCATAAATGG - Intronic
1163665452 19:18601712-18601734 CACAACAAGTGCTCAATAAATGG - Intronic
1164820915 19:31250797-31250819 CACAGTAGGTGCTCAGTAAATGG + Intergenic
1165268814 19:34686846-34686868 CACAGAAGATGCTCAAGAAATGG - Intergenic
1165275227 19:34745151-34745173 CATAGTGGATGCTCAAGAAATGG - Exonic
1165347112 19:35255443-35255465 CATAGTAAGAGCTCAATAAACGG + Intronic
1165466066 19:35975601-35975623 CACAGTAGATACTCAATATATGG - Intergenic
1166075556 19:40411915-40411937 CACAGTAGGTGCTCAAGAAATGG - Intronic
1166789914 19:45392520-45392542 CATACTAACTGCTCAATAAATGG - Intronic
1166807364 19:45495388-45495410 CATAGTAGGTGCTCAATAAGTGG - Intronic
1166828849 19:45626314-45626336 GATAGTAAATGGTCAATAAATGG - Intronic
1166891027 19:45993203-45993225 CATAGCAGGTGCTCAATAAATGG + Intergenic
1167023052 19:46893036-46893058 CATGGTAGGTGCTAAATAAAGGG + Intergenic
1167092527 19:47354405-47354427 CATAGCAGGGACTCAAGAAAAGG + Intronic
1167252489 19:48407628-48407650 CATAGCAGACTTTCAATAAAGGG - Intronic
1168013351 19:53552364-53552386 TATAGCAAATGCTAACTAAAAGG - Intronic
1168238358 19:55077293-55077315 CACAGAAGTTGCTCAATAAATGG - Intronic
925263840 2:2550707-2550729 AACAGCAGGTGCTCAATAAGTGG + Intergenic
925404865 2:3599499-3599521 CATAGCAAATGCTCACCAAATGG - Intronic
925780001 2:7373311-7373333 CATGGCAGGTGCTCTACAAATGG + Intergenic
925845597 2:8030596-8030618 TATAGGAGATGCTCAGTACATGG - Intergenic
925912010 2:8580074-8580096 CATAGTTGACACTCAATAAATGG - Intergenic
926197383 2:10772143-10772165 TATAGCAAGTGCTCAATAAATGG - Intronic
926236546 2:11049726-11049748 AATATCAGTTGCTGAATAAATGG + Intergenic
926401081 2:12497606-12497628 CATAGTAAATGCCCAATAAATGG + Intergenic
926417151 2:12661005-12661027 CACAGCAGAGGCTCAATAAATGG + Intergenic
926435200 2:12830126-12830148 CCTAACAGATGCTTAATAAGTGG - Intergenic
926603095 2:14868032-14868054 CAGAGCAGGTGCTCCATAAAAGG - Intergenic
926615523 2:14993097-14993119 CATAGGAGACGCTCAATAAATGG - Intergenic
926704067 2:15824259-15824281 CATAGCAGATGTTCAATAAATGG + Intergenic
926716228 2:15926109-15926131 TATAGCAGGCACTCAATAAATGG + Intergenic
926939737 2:18122492-18122514 CATAGTAGCTGTTCAAAAAATGG - Intronic
926954580 2:18280492-18280514 CATAGCAGGTGTTCAATAATAGG - Intronic
927292384 2:21417406-21417428 GATGGCAGATGCTTAATAAGTGG + Intergenic
927311810 2:21639925-21639947 CATATCAGATGCTCCATGAAAGG - Intergenic
927405363 2:22760454-22760476 CATAATAGGTGCTCAGTAAATGG + Intergenic
927471542 2:23381263-23381285 CAAAGCAGGTTCTCAGTAAATGG + Intergenic
927481841 2:23460211-23460233 AATAATACATGCTCAATAAATGG - Intronic
927654433 2:24933472-24933494 TATAGTAAGTGCTCAATAAATGG + Intergenic
927757496 2:25720751-25720773 CATAGTATTTGCTCATTAAATGG + Intergenic
928138514 2:28707254-28707276 TGTAGTAGGTGCTCAATAAATGG - Intergenic
928263504 2:29789144-29789166 CATAGGAGGTGCTCAATAAATGG - Intronic
928291347 2:30040168-30040190 CATAGCAGCAGTTCAATAAATGG + Intergenic
928340427 2:30438682-30438704 CATACTAGATGCCCAATATATGG - Intergenic
928372600 2:30751902-30751924 CATAGCAGGTGCTCGATCACTGG + Intronic
928517395 2:32056792-32056814 GATAGCAGAGACTCAGTAAATGG + Intergenic
929089589 2:38201711-38201733 CATAGCACAAGCTGATTAAATGG + Intergenic
929112373 2:38415866-38415888 CATAGTAGACACTCAATACATGG - Intergenic
929147606 2:38720296-38720318 CATAGAAAATGCTCAAAAATTGG + Intronic
929216691 2:39421651-39421673 CATAGTATATACTCTATAAATGG + Intronic
929269480 2:39958171-39958193 CACAGAAAATGTTCAATAAATGG - Intergenic
929593981 2:43164374-43164396 CACAGCAGGTGCTCAGTAAATGG + Intergenic
929786896 2:45000011-45000033 CATAGTATATGTTCAATAAATGG + Intergenic
929799597 2:45088416-45088438 TATGGCATAAGCTCAATAAAGGG - Intergenic
929967329 2:46544905-46544927 CACACTAGGTGCTCAATAAAGGG + Intronic
930114872 2:47709899-47709921 CATAGAAGATGCTCAATAAGTGG - Intronic
930200247 2:48545818-48545840 CAGAGCAGCTGCTCATTAAGTGG - Intronic
930258769 2:49121151-49121173 CATAGAAGCTGCTCAATAAGTGG - Intronic
930851381 2:55964911-55964933 AACAGGAGATACTCAATAAAGGG - Intergenic
930881225 2:56272741-56272763 CATATGAGAGTCTCAATAAAAGG + Intronic
930949893 2:57127644-57127666 CAGAGCAAAAGCTCAATATATGG - Intergenic
931122618 2:59236878-59236900 TATAGCAGTTGCTCAATAAATGG - Intergenic
931254640 2:60559061-60559083 CACAGTAGATGTCCAATAAATGG + Intergenic
931556826 2:63515422-63515444 TATTAAAGATGCTCAATAAAAGG + Intronic
931597335 2:63962855-63962877 CATAGGAGGAGGTCAATAAATGG - Intronic
931942161 2:67264346-67264368 CATAGCAGATGCTCAAGAAATGG - Intergenic
932020919 2:68085571-68085593 CAGAGTAGACGCTCAATCAATGG + Intronic
932088087 2:68780207-68780229 CCTAGGGAATGCTCAATAAATGG + Intronic
932608313 2:73178709-73178731 TATAGCAGATGCTCCATTAGCGG + Intergenic
932823501 2:74920873-74920895 CATAGTAAGTGCTTAATAAATGG - Intergenic
933272628 2:80249480-80249502 CAAAGTACATGCTCAATAAGTGG - Intronic
933608439 2:84408771-84408793 CATAGCAAATAGTCAACAAATGG - Intergenic
934603943 2:95680126-95680148 CATATTAAATACTCAATAAATGG - Intergenic
934988022 2:98901228-98901250 CATAGAAAGGGCTCAATAAATGG + Intronic
935697921 2:105786121-105786143 CACAACAGATGATCAATAAAAGG - Intronic
936463644 2:112728658-112728680 CACAGCAGACACTCAATAAATGG - Intronic
936889504 2:117352616-117352638 TGTAGTAAATGCTCAATAAATGG - Intergenic
936951403 2:117981255-117981277 CATAGTAGGTGCTCAATTAATGG + Intronic
936965827 2:118126783-118126805 TGTAATAGATGCTCAATAAATGG + Intergenic
937308362 2:120885962-120885984 TATAACAGGTGCTCAGTAAATGG - Intronic
937314464 2:120922159-120922181 CATAGCAAATGCTTGATACAAGG + Intronic
937438008 2:121895197-121895219 GAGAGAAGATGCTGAATAAATGG + Intergenic
937482755 2:122279550-122279572 CATAGCAGGTACATAATAAATGG + Intergenic
937646669 2:124273398-124273420 GAGAGCAGATACTCAATAAGGGG - Intronic
937983895 2:127630015-127630037 CTTAGTAGGTCCTCAATAAATGG + Intronic
938042670 2:128088909-128088931 CATAGCAGAAGATCAAGATAAGG + Intergenic
938200328 2:129367384-129367406 CATGGCAGACCCTCAGTAAATGG - Intergenic
938575113 2:132596376-132596398 CATAGTAAGTGCTCAATAAATGG + Intronic
938584322 2:132674236-132674258 CCTAGTGGATGCTTAATAAATGG - Intronic
938600147 2:132829365-132829387 CACAGGAGATACTCAATAAGTGG + Intronic
938610431 2:132941948-132941970 CTTACAAGATGCTAAATAAAGGG + Intronic
938626771 2:133118523-133118545 CATAGTAGGTGCACAATAAATGG - Intronic
938834913 2:135091760-135091782 CATGCCAGGTACTCAATAAATGG + Intronic
939106951 2:137960197-137960219 CATAGTAAGTGCTCAATAAATGG + Intergenic
939286597 2:140138949-140138971 CATAGCAAATGTTCTCTAAATGG - Intergenic
939984733 2:148818135-148818157 CACAGTAAGTGCTCAATAAACGG + Intergenic
941132778 2:161674415-161674437 TATAGCAGATGTTTAATAGATGG + Intronic
941168548 2:162109681-162109703 CAGAGCAAAGGCTCAATATATGG + Intergenic
941170279 2:162127530-162127552 CATAGAACCTGTTCAATAAATGG - Intergenic
941274416 2:163472622-163472644 CATAGTGGGTGCTCAATAGATGG - Intergenic
941346988 2:164381776-164381798 CATAGAAAATGATCAATAAATGG - Intergenic
941531051 2:166671896-166671918 CATGGCAGATATTCAATGAATGG - Intergenic
941533899 2:166699098-166699120 TATAGGAACTGCTCAATAAACGG + Intergenic
941643421 2:168013935-168013957 CATAGTAAATACTCAATAAATGG + Intronic
941785913 2:169498409-169498431 CAGAGTAAATACTCAATAAATGG - Intronic
942050711 2:172138010-172138032 AAAAGCAGATGCTGCATAAATGG - Intergenic
942072540 2:172328883-172328905 CATAGTAAGTGCTCAATAAATGG - Intergenic
942256876 2:174111529-174111551 TATAATAGATGCTCAACAAATGG + Intronic
942492206 2:176500630-176500652 CACAGCAGGCTCTCAATAAAAGG + Intergenic
942584182 2:177456330-177456352 CATAGTAAGTGCTTAATAAATGG - Intronic
942818771 2:180084982-180085004 TAGAGTAGATGCTCAATAAGTGG + Intergenic
943194629 2:184729995-184730017 CATAGTATATGACCAATAAATGG + Intronic
943966834 2:194346340-194346362 CATAGCAACTCCTCAATCAAAGG - Intergenic
944070244 2:195659362-195659384 CAAATCAGGTGCTCAAAAAAAGG - Intronic
944406220 2:199386787-199386809 CATAGTAGATGCTAAATGCATGG + Intronic
944464489 2:199986706-199986728 CACAGTAGGTGCACAATAAATGG + Intronic
944655812 2:201875973-201875995 AATAGCAGATTCTCATTAATTGG + Intronic
945043880 2:205764932-205764954 CATAGTAGGTGCTCAGTAAATGG + Intronic
945293395 2:208147098-208147120 CATTGCAGGTCCTCAATAATTGG + Intergenic
945398121 2:209346641-209346663 CATAGTTGATGCTTAATAATTGG - Intergenic
945632320 2:212295738-212295760 CATAGTAGCTGCACAGTAAATGG + Intronic
946147090 2:217739234-217739256 CATAATAGCTGCTCAATGAATGG + Intronic
946176421 2:217924609-217924631 CATAGTAGGTGCTTAACAAATGG - Intronic
946213822 2:218168079-218168101 TATAGTAGGTGCTCAATCAATGG + Intergenic
946706210 2:222461167-222461189 CACAGCATGTGTTCAATAAATGG - Intronic
946888080 2:224244786-224244808 CATAGTAAGTGCTCACTAAATGG - Intergenic
947678812 2:232010917-232010939 CATAGCAAAGGCTCAAAAATTGG - Intronic
947754966 2:232555548-232555570 ACTAGAAGATGCTGAATAAATGG - Intronic
948006977 2:234617619-234617641 CATAGCAAATGTTCATGAAAAGG + Intergenic
948034281 2:234845356-234845378 CACAACAGATGTTCAATAAATGG + Intergenic
948548282 2:238748407-238748429 CATAGTATGTGCTCAGTAAAAGG - Intergenic
948979002 2:241483223-241483245 CAGAGCAGGTGCTCAGTAGATGG + Intronic
1168853006 20:989495-989517 CATTGTAGGTGCTCAATAAATGG + Intronic
1168958684 20:1853247-1853269 CTTAGTAGGTGCTCAATGAATGG - Intergenic
1168971055 20:1930989-1931011 CACAGTAAGTGCTCAATAAATGG - Intronic
1168983915 20:2031329-2031351 TATAGTAGATGCTCTATAAGTGG - Intergenic
1169286459 20:4311433-4311455 TCTAGCAAGTGCTCAATAAATGG - Intergenic
1169286633 20:4313649-4313671 CTTGTCAGATGCTGAATAAATGG + Intergenic
1169458843 20:5776914-5776936 GGTAGTAAATGCTCAATAAATGG - Intronic
1169493876 20:6094606-6094628 CATAGTACATGCTCAGTGAATGG - Intronic
1169684156 20:8251673-8251695 CATAGCAGATGCCTCCTAAAAGG - Intronic
1169752957 20:9013689-9013711 CATGGTAGATGGTCAGTAAATGG + Intergenic
1170021925 20:11846190-11846212 CAAAACAGATGCACAGTAAATGG + Intergenic
1170137590 20:13091883-13091905 CATAGTAGGTTCTCAATAATTGG - Intronic
1170394878 20:15915472-15915494 CATAGGAAGTTCTCAATAAATGG + Intronic
1170495812 20:16924149-16924171 CTTAGTTGGTGCTCAATAAATGG - Intergenic
1170508873 20:17056831-17056853 CATAGTCGTTGCACAATAAATGG - Intergenic
1170773440 20:19354542-19354564 CATAGCAAATGGTCAATAAATGG + Intronic
1170874675 20:20239516-20239538 CATAGTACATTTTCAATAAATGG - Intronic
1170943460 20:20868335-20868357 TATAGTACATGCTCAATAAATGG + Intergenic
1171059373 20:21941134-21941156 CTTAGAAGGTGCTCAATAAATGG + Intergenic
1171196233 20:23201650-23201672 CAGATCAGGTGCTCAATAAGTGG + Intergenic
1171353863 20:24528580-24528602 CATGGCAGAAGCTCAAGAAGGGG + Intronic
1172181401 20:33006015-33006037 TATAGCAGGTGCTCACCAAACGG + Intergenic
1172194322 20:33081794-33081816 CATAGTAGGTGCTCAGGAAATGG - Intronic
1172393302 20:34581339-34581361 CACAGTAAGTGCTCAATAAATGG + Intronic
1172465133 20:35150768-35150790 CGGGGCAGATGCTCAGTAAATGG - Intergenic
1172592063 20:36124839-36124861 CTTAGGAGGTGCTCAATAAATGG + Intronic
1172765469 20:37348444-37348466 CGCAGCAGGTGCTCAATACAGGG - Intronic
1172810969 20:37647941-37647963 CACAGTAGGTGCTCAATAAGGGG - Intergenic
1172831693 20:37841047-37841069 CATAGTAGTCACTCAATAAATGG - Intronic
1172856854 20:38011307-38011329 TAGAGCAGGAGCTCAATAAATGG + Intronic
1173084852 20:39905933-39905955 CATAGTAGGTGCTCAGTAAATGG + Intergenic
1173132346 20:40406256-40406278 CATAATAGATGCTCAGTAAGTGG - Intergenic
1173210388 20:41027997-41028019 CAGAATAGATGCTCTATAAACGG + Intergenic
1173456280 20:43204425-43204447 TATGGCACATGATCAATAAATGG - Intergenic
1173606520 20:44335934-44335956 CATAGCAGGGGCTCACTAGATGG + Intergenic
1173608475 20:44349212-44349234 CATAGTACATGCTAAATAAATGG + Intronic
1173726092 20:45298874-45298896 CATAGTAGATGATCAATAAATGG - Intronic
1173835182 20:46120220-46120242 CATAGTAGGTGCTCATTAAATGG - Intronic
1173870228 20:46337173-46337195 CATGGTAGATGCTCAACAAATGG - Intergenic
1173959181 20:47057990-47058012 GATAGTAAGTGCTCAATAAATGG + Intronic
1173993675 20:47321782-47321804 GATAGTAACTGCTCAATAAAAGG - Intronic
1174041010 20:47699449-47699471 CACAGTAGGTGCTCAGTAAATGG + Intronic
1174173686 20:48632143-48632165 CACAGAAGGTGCTCAAGAAAGGG + Intronic
1174186160 20:48707771-48707793 CATAGTAGGTACTCAATAAATGG - Intronic
1174253309 20:49235452-49235474 CAAAGTAGATGCTCAAGTAATGG - Intronic
1174385875 20:50188542-50188564 CATAGAAGGTGCTCGATGAATGG - Intergenic
1174465858 20:50716787-50716809 CATGGCACATGCTGAATAAATGG - Intergenic
1174582576 20:51582564-51582586 CATAGTAGGTGCTCAGTAAATGG + Intergenic
1174858916 20:54071783-54071805 CATGGCAGCTGCTTAATAATTGG - Intergenic
1175030321 20:55947107-55947129 TATTGAAGAAGCTCAATAAATGG - Intergenic
1175048402 20:56128941-56128963 GATGGCAGGTGCTCAGTAAATGG - Intergenic
1175193289 20:57225429-57225451 CACAGGAAGTGCTCAATAAATGG - Intronic
1175265274 20:57699324-57699346 CCTAGTAGATGCTCAATAAATGG - Intronic
1175281990 20:57809967-57809989 CATGGTAGATGCTCCATGAAAGG - Intergenic
1175285901 20:57836569-57836591 TACAGTAGCTGCTCAATAAATGG - Intergenic
1175683707 20:61010610-61010632 CATGGAAGAAGCTAAATAAATGG - Intergenic
1177197764 21:17920667-17920689 GATAGCACATGCTCAATAAATGG + Intronic
1177485379 21:21748634-21748656 CATGGCATATGCTGAATACATGG + Intergenic
1178133714 21:29602389-29602411 CAGAGAAGATATTCAATAAATGG - Intronic
1178318060 21:31583547-31583569 CATAGGCGATGTTAAATAAATGG + Intergenic
1178641606 21:34349129-34349151 CTCAGGAGTTGCTCAATAAATGG + Intergenic
1178897079 21:36567890-36567912 CATAGTAGGTACTAAATAAATGG - Intronic
1178947540 21:36960384-36960406 CCTAGCAAGGGCTCAATAAATGG + Intronic
1179451633 21:41472330-41472352 CATGGTAGGTGCTTAATAAATGG + Intronic
1179768280 21:43591839-43591861 CATAGCATATGCTGGACAAAGGG - Intronic
1180730047 22:17974333-17974355 CACAGAAGTTGCTCAATAAACGG + Intronic
1180881196 22:19204611-19204633 GCTAGCTGATGCTTAATAAAAGG + Intronic
1181163311 22:20970198-20970220 CAGAGTAGAAGCTCAATAGATGG - Intronic
1181679482 22:24483448-24483470 CATAGCAGGTGCTCAAGAAATGG + Intergenic
1181908405 22:26218124-26218146 CAAAGCATGTCCTCAATAAATGG - Intronic
1181942046 22:26485566-26485588 CATAGCAGGTACTCAACAAATGG - Intronic
1181943152 22:26494623-26494645 CATGGCAAATGTCCAATAAATGG + Exonic
1181959391 22:26611984-26612006 CAGAGCAGATGCTGGAGAAATGG + Intronic
1182046389 22:27277615-27277637 CCTAGTAGGTGCTCAATAAATGG - Intergenic
1182282298 22:29224640-29224662 CACAGTAGGTGCTCAATAAATGG - Intronic
1182726047 22:32446592-32446614 CACAGCAGGCACTCAATAAATGG + Intronic
1182749679 22:32631648-32631670 CATAGTAGTTTCTCAATAAAAGG - Intronic
1182778413 22:32848514-32848536 CATAGTAGGTGTGCAATAAATGG + Intronic
1182781058 22:32868152-32868174 CATAGTAAGTGCTCAATAAATGG + Intronic
1182846955 22:33439255-33439277 CATGGGAGATGCTCAACTAAAGG + Intronic
1182898387 22:33877213-33877235 CATAGCAGGGCCTCAGTAAATGG - Intronic
1182955104 22:34417008-34417030 CACAGTAAATGCTCAATAAATGG - Intergenic
1183014657 22:34976066-34976088 CATAGAAAAACCTCAATAAATGG + Intergenic
1183016860 22:34995815-34995837 CATGGTAAGTGCTCAATAAATGG + Intergenic
1183094613 22:35544552-35544574 CAGAGCAGGGGCTCAATAAAGGG - Intronic
1183104705 22:35607542-35607564 CCTAGCAAGTGCTCAATACACGG - Intronic
1183235304 22:36612385-36612407 CATAGTAGATGCTTAATAAATGG + Intronic
1183263466 22:36811324-36811346 CATAACAAATGCTCAATAAATGG - Intronic
1183435738 22:37793695-37793717 GATAGTAACTGCTCAATAAATGG + Intergenic
1183516587 22:38270423-38270445 CACAGTAAGTGCTCAATAAACGG + Intronic
1184116913 22:42427460-42427482 CCCAGCAGATGCTCAGGAAATGG - Intronic
1184142497 22:42586033-42586055 CATGACAGATGCCCAGTAAATGG - Intronic
1184143397 22:42593469-42593491 CATAGCAAGTACTCAGTAAATGG + Intronic
1184620638 22:45673562-45673584 CATAGTAGGTGCTCAATAAATGG - Intronic
1184644158 22:45887069-45887091 CATAGCAGTTGCTCAAAAAATGG - Intergenic
1184664960 22:45983497-45983519 CACAGCAGCTGTTCACTAAATGG - Intergenic
1185299878 22:50073771-50073793 CATGCCACATGCTCAATACATGG - Intronic
949101404 3:150293-150315 CATAGTAGATACTCAATAAAGGG - Intergenic
949395998 3:3615411-3615433 CATAGTAGGTGATCAATAAATGG + Intergenic
949672136 3:6411223-6411245 CATAGTAGTTTCTCAATAAATGG + Intergenic
949716504 3:6937866-6937888 CATAGTAAGTGCTCAATAAGTGG - Intronic
949748861 3:7327850-7327872 CAACGCAGATGTTCAATAAATGG - Intronic
949863921 3:8531768-8531790 CATAGTAGATGCTAAATAAATGG + Intronic
949945191 3:9184534-9184556 CAAAGGAAATGCTCAGTAAATGG + Intronic
950116238 3:10451889-10451911 CATAGTAGATGCTTAAGAAATGG - Intronic
950348163 3:12318779-12318801 CATAGTAAGTGCTCAATAATTGG + Intronic
950395797 3:12732942-12732964 CATAGGTGATGCTCAATCAATGG - Intergenic
950669778 3:14519100-14519122 CGTGGCAGATGCTCGATAAATGG + Intronic
951031760 3:17890652-17890674 CATAGCAAACGTGCAATAAATGG - Intronic
951296328 3:20940208-20940230 CATAGGAAATACTCACTAAATGG - Intergenic
951479928 3:23149301-23149323 TATAGTAAGTGCTCAATAAATGG - Intergenic
951509237 3:23483518-23483540 CACAGAAGATGCTCAGTAAATGG + Intronic
952125598 3:30296562-30296584 CATGGTAGATGCTTAATAAATGG + Intergenic
952588820 3:34926343-34926365 CAAAGCAGATGTTCAAGGAATGG - Intergenic
953068219 3:39494303-39494325 CATACTAGGTGCTCAATAAATGG + Intronic
953288348 3:41635610-41635632 CACAGTACATGCTCACTAAATGG - Intronic
953452838 3:43018328-43018350 CATGGCATGTGCTCAATAAGTGG + Intronic
954775781 3:53017048-53017070 CATAGTAGATCCTCAACAAAAGG - Intronic
954916233 3:54150578-54150600 CATGGTAAATCCTCAATAAATGG + Intronic
955047646 3:55375037-55375059 CATAGTAAGTACTCAATAAATGG - Intergenic
955073266 3:55589514-55589536 CATAGTAAATACTCAATAAATGG + Intronic
955100210 3:55841574-55841596 CATAGCAAATGCCTAGTAAAAGG - Intronic
955113983 3:55978587-55978609 CATAGGAGATGCTCAGTAAGTGG - Intronic
955160470 3:56460581-56460603 CATAGTAAATGCTCAATAAATGG + Intronic
955162449 3:56477704-56477726 CATAGTAAATGCTTAATAAACGG + Intergenic
955209561 3:56928208-56928230 TATAGTAGATGCTCAACAAGGGG - Intronic
955268491 3:57471872-57471894 CATGGCACATGCTCAATAAATGG - Intronic
955296396 3:57739164-57739186 CATGGAAGGTGCTCAATAAATGG + Intergenic
955319400 3:57963656-57963678 CAGAGTGTATGCTCAATAAATGG - Intergenic
955689771 3:61579442-61579464 CACAGTAGGTGCTCAAAAAATGG - Intronic
955774675 3:62420611-62420633 CATAGCAACTGCCCAATTAAGGG + Intronic
955976633 3:64486326-64486348 CATAGTAGGTACCCAATAAATGG + Intergenic
956294526 3:67697248-67697270 CAGAGCAGATACTCAATACAGGG - Intergenic
956719692 3:72106873-72106895 CAGAGCAAATGCTCACTAAAAGG - Intergenic
956861055 3:73324104-73324126 TATAGCAAATGCCCAATCAATGG - Intergenic
956899320 3:73697906-73697928 CATGGTAAGTGCTCAATAAATGG + Intergenic
956933180 3:74069631-74069653 CATACCAGGTTCTCACTAAATGG - Intergenic
957877295 3:86164133-86164155 CATCCTAGATGCTCAGTAAATGG + Intergenic
958889332 3:99766144-99766166 ATTAGCAGAAACTCAATAAAGGG - Intronic
959002283 3:100978206-100978228 CATAGCTAATGCTCAACAATAGG + Intronic
959040073 3:101411211-101411233 CATAGTAAATACACAATAAATGG + Intronic
959088774 3:101879876-101879898 TAAAGCAGATGCATAATAAAAGG - Intergenic
959598645 3:108154419-108154441 AATAGTAGCTGCTCAATAAAGGG + Intergenic
959622853 3:108417180-108417202 CATAGAAGTTTCTCAATAAATGG - Intronic
959682517 3:109111924-109111946 CATGGGAGGTGCTCAAGAAATGG - Intronic
959726557 3:109549500-109549522 CATAGTAGGTTCTCAGTAAAGGG - Intergenic
959757829 3:109920207-109920229 CACAGTAAATGCTTAATAAATGG + Intergenic
960048489 3:113219345-113219367 CACAGTAGGTGCTCATTAAATGG - Intronic
960051124 3:113240527-113240549 CATAGAAGGAGCTCAATAAATGG - Intronic
960639275 3:119811059-119811081 CATAAGAGATGTTCAGTAAATGG - Intronic
961016079 3:123469516-123469538 CACAGCAGGTGCTCCATAAATGG - Intergenic
961119274 3:124359720-124359742 CTCAGGAGATGCTCCATAAATGG + Intronic
961249357 3:125486708-125486730 AATATAAGATGCTCAATAAATGG + Intronic
961676806 3:128572597-128572619 CATAACAGGTGCTGAATAAATGG + Exonic
962363419 3:134760573-134760595 CATAGGAATTGCTCAATAAATGG - Intronic
962457104 3:135574638-135574660 CATAGTGGATATTCAATAAATGG - Intergenic
962464317 3:135642503-135642525 CACAGTAGGTACTCAATAAATGG + Intergenic
962482161 3:135807116-135807138 CATAGCAAGTGCTCAATAAATGG - Intergenic
962727774 3:138250265-138250287 CATAATAGGTGCTCAATAAATGG + Intronic
962839771 3:139222818-139222840 CGGAGAAAATGCTCAATAAATGG + Intronic
962895345 3:139709002-139709024 TATATCAGATGCTCAATACAGGG + Intergenic
962918367 3:139929165-139929187 CATCGTAGGTGCTCAATAAGTGG + Intergenic
962927821 3:140011596-140011618 CATAGCATATACTTAATAAGGGG + Intronic
962929689 3:140024861-140024883 CATATTTTATGCTCAATAAATGG + Intronic
962981996 3:140499017-140499039 TATAGTAAATGCTCAATAAGTGG - Intronic
963060588 3:141221740-141221762 CACAGGAGGTGCTCAATAAAGGG + Intergenic
963127600 3:141829695-141829717 CATAGTATGTGCTCACTAAATGG - Intergenic
963568278 3:146959986-146960008 TATAGCAGGTGCGTAATAAATGG - Intergenic
964416479 3:156453523-156453545 GGTAGCAGACACTCAATAAATGG + Intronic
964591645 3:158369104-158369126 CATAGTAGATGCTCAATAAATGG - Intronic
964894809 3:161582845-161582867 CATAGCAATACCTCAATAAAAGG + Intergenic
964922105 3:161909587-161909609 TACAGCAGATTCTCAATAAATGG - Intergenic
965398776 3:168193471-168193493 CAGAGTAAATACTCAATAAATGG - Intergenic
965441229 3:168717607-168717629 CACAGTGAATGCTCAATAAATGG + Intergenic
965506481 3:169521003-169521025 TATAGATGAAGCTCAATAAATGG + Intronic
965510611 3:169564988-169565010 CATAAAAGATGCTCAATACATGG - Intronic
965598009 3:170426670-170426692 CATGGTAAGTGCTCAATAAATGG + Intronic
965795867 3:172438084-172438106 CTTAGTAGGTGCTCATTAAATGG - Intergenic
965828237 3:172752043-172752065 AAAAGCAGATGATTAATAAAAGG - Intronic
966185856 3:177226574-177226596 CACAGTAGATGTTCAATAAATGG + Intergenic
966441258 3:179947349-179947371 CATAGTAGGTGTTCAATTAATGG - Intronic
966659239 3:182396055-182396077 CCTGGGAGATGCTTAATAAATGG + Intergenic
966679716 3:182628872-182628894 CATAGAACATGCTCAATAAATGG - Intergenic
966852593 3:184173574-184173596 TAGAGTAGGTGCTCAATAAATGG + Exonic
967129698 3:186459128-186459150 CATAGCAGATGCTCAGTAAATGG - Intergenic
967135459 3:186509260-186509282 CATAGTAGGTACTCAACAAATGG - Intergenic
967196630 3:187031961-187031983 CATAGCTAGTGCTAAATAAATGG + Intronic
967292306 3:187933080-187933102 CATAGTAGATGCTCCATAGATGG + Intergenic
967417141 3:189231836-189231858 CATAGAAGACCCTCAATATATGG + Intronic
967707052 3:192663396-192663418 CATAGTAGAATCTCAATAAATGG + Intronic
967825484 3:193873996-193874018 CATAGTAGGTGTTCAGTAAATGG - Intergenic
967834516 3:193949803-193949825 CATAGTACATGCTAACTAAATGG - Intergenic
967850927 3:194082184-194082206 CAGAGCAGGTGCTCAAAAGAGGG + Intergenic
969116894 4:4875966-4875988 CATAGTTGGTGCTCAATAAGTGG - Intergenic
969141970 4:5083547-5083569 AATAGTACATGCTCAATAAATGG + Intronic
969179975 4:5432813-5432835 CATAGTAAGTGCTCAATAAATGG - Intronic
969202629 4:5617982-5618004 CATAATAGCTGCTCATTAAAAGG + Intronic
969270159 4:6094240-6094262 CACAGCAGGTGCTCACCAAATGG + Intronic
969305241 4:6322562-6322584 CACAGCAGAGGCTCAGCAAATGG + Exonic
969312817 4:6363996-6364018 CAGAGTAGATGCTCAAATAATGG - Intronic
969452794 4:7284438-7284460 CATAGTAGGTGCTCAAGAAATGG + Intronic
969626976 4:8310633-8310655 CAGAGCAGGTGCTCAGTGAATGG + Intergenic
970172021 4:13299735-13299757 CATTGTAATTGCTCAATAAATGG + Intergenic
970366483 4:15363932-15363954 CAGAGCAGACACTCAAAAAATGG + Intronic
970435893 4:16034948-16034970 CACAGTAGATATTCAATAAATGG + Intronic
970506306 4:16734165-16734187 CATAGCAGGTTCTCCTTAAATGG + Intronic
970657724 4:18250235-18250257 TATAGAGGATGCTTAATAAAGGG + Intergenic
970950562 4:21750600-21750622 CCTAGTAAATGCTGAATAAATGG - Intronic
971039815 4:22739281-22739303 TATATCATATGCTCAATGAAAGG - Intergenic
971081619 4:23219017-23219039 TATAGCAGTTCCTCAACAAATGG + Intergenic
971226171 4:24753403-24753425 CATAGCAGTTGCTCTGTAAATGG + Intergenic
971315095 4:25561063-25561085 CAGAATAGCTGCTCAATAAATGG - Intergenic
971356334 4:25898394-25898416 CATAGCAGGTGCTGAGCAAATGG + Intronic
971656333 4:29350610-29350632 TATGACAGATGCACAATAAATGG + Intergenic
971770337 4:30887428-30887450 CATAGTAGGCACTCAATAAATGG + Intronic
972121564 4:35710419-35710441 CATAGCTGATGCTCAACACCAGG - Intergenic
972346569 4:38197429-38197451 CATGATAGATGTTCAATAAAAGG + Intergenic
972378166 4:38493107-38493129 CAGAGGAGGTGCTCAACAAATGG - Intergenic
973247558 4:48025643-48025665 TATAGCAGATTCTCAAGAACAGG - Intronic
973613005 4:52655341-52655363 CATAGCAGGTCCTCAACAGATGG + Intronic
973651349 4:53000074-53000096 CATAGCAGATGCTCACTAAATGG + Intronic
974020043 4:56685075-56685097 CATAGTAGGCGCTCCATAAATGG + Intergenic
974088460 4:57285775-57285797 CATAGTAAGAGCTCAATAAATGG + Intergenic
974201282 4:58644338-58644360 CACAGCATATGTTCAATAAAGGG - Intergenic
974411848 4:61552199-61552221 TATAGTAGGTGCTCAATAAAAGG - Intronic
974449854 4:62040199-62040221 AATAGTGGGTGCTCAATAAACGG + Intronic
974902114 4:68013796-68013818 CATAGAAGGTACTTAATAAATGG + Intergenic
975049066 4:69837134-69837156 CATAGTAGATGCTCAATAAATGG - Intronic
975187022 4:71415398-71415420 TATAGTAGATAGTCAATAAATGG - Intronic
975491613 4:74995452-74995474 CATAGTAAATACTCAGTAAAGGG - Intronic
975689971 4:76953199-76953221 CATAGCAGGTGCTTAATAAATGG - Intronic
975817851 4:78237826-78237848 CAGAGTAAATGCCCAATAAATGG - Intronic
976305801 4:83558294-83558316 CATAGCTGATGCTCTAAAATGGG + Intronic
976342398 4:83959582-83959604 TATAAAAGATGCTCAATTAACGG + Intergenic
976519032 4:86005258-86005280 CATAGTAAGTGCTCACTAAATGG + Intergenic
977315876 4:95447295-95447317 CATATAAAGTGCTCAATAAATGG - Intronic
977528903 4:98176491-98176513 CATAGCTTATGCTCTACAAATGG - Intergenic
977675576 4:99743360-99743382 CAGAGTAGGTGCTCAATAGATGG - Intergenic
977725141 4:100287969-100287991 TATGGCATGTGCTCAATAAATGG - Intergenic
978368483 4:108007022-108007044 CATAGTAGATGCTCAGTATGTGG + Intronic
979029263 4:115619655-115619677 CTTAGTAGATGCTGAATAAAGGG - Intergenic
980288314 4:130810101-130810123 TATAGCAGATGCTCATAAACTGG - Intergenic
980312442 4:131149982-131150004 CATAGTAGAAATTCAATAAATGG + Intergenic
980711624 4:136576310-136576332 TATAGTAGGTTCTCAATAAATGG + Intergenic
980908878 4:138976017-138976039 CATGGTAGATACTTAATAAATGG - Intergenic
981100815 4:140827321-140827343 CCTAGTAGGTGCTCAGTAAATGG - Intergenic
981236504 4:142422376-142422398 CATAATAGATGCTGAAAAAATGG + Intronic
981673072 4:147310149-147310171 CATAGGAGATGTTCAATCAATGG - Intergenic
982126289 4:152186461-152186483 CATTGCTGCTGCTTAATAAAGGG - Intergenic
982204921 4:152990385-152990407 CATAGGAAGTGCTCAATAAATGG + Intergenic
982303834 4:153907694-153907716 CATAGTAGAGGCTCAAAAAAAGG + Intergenic
982656663 4:158158344-158158366 CACAGTAAATGCTCAAGAAATGG - Intronic
982699327 4:158641889-158641911 CTTAAGAAATGCTCAATAAAAGG + Intronic
983027035 4:162750711-162750733 TATAGTAGGTGCTAAATAAATGG - Intergenic
983257039 4:165411482-165411504 CATACCAGTTGCTAAATAATTGG + Intronic
983436600 4:167723426-167723448 CATACCACATACTAAATAAATGG - Intergenic
983554004 4:169043841-169043863 CATAGCAAGTGCGCAATGAATGG + Intergenic
983733248 4:171024017-171024039 TATAGCACATGCTCAATAAATGG + Intergenic
984305070 4:177978940-177978962 CATGGTAAATGCTCAATGAATGG + Intronic
984509259 4:180658954-180658976 CAGAGAAGGTGCTTAATAAATGG - Intergenic
984725569 4:183016786-183016808 CATAGTAAATGCTCAATTAATGG + Intergenic
984884101 4:184434852-184434874 CATAGTAGGTGCTCTGTAAATGG - Intronic
984929690 4:184835661-184835683 CATAATAAATGCTCAGTAAATGG - Intergenic
986073086 5:4306779-4306801 CATAGCAGACACTCAACACAGGG - Intergenic
986162637 5:5244363-5244385 CATAGTAGGTGCTCAATACATGG - Intronic
986370540 5:7075806-7075828 CATAGTAGATGCTCACTAAATGG + Intergenic
986468745 5:8052861-8052883 CCTAGCAGATGCTTAAGAAATGG - Intergenic
987041291 5:14065256-14065278 AAAAGCAGATGCTTAATAAATGG - Intergenic
987166826 5:15207485-15207507 CATAGTAGATATTCAAGAAATGG + Intergenic
987599900 5:20054214-20054236 CATAGCATATGTTTAATAAATGG + Intronic
988689056 5:33553949-33553971 CATAGTAAGTGCTCAATGAAGGG - Intronic
988844011 5:35111077-35111099 CATAGAAGGTATTCAATAAATGG + Intronic
988893633 5:35648022-35648044 TACAGCACATGTTCAATAAATGG - Intronic
989396354 5:40961311-40961333 CATAGTAAATGCTTAGTAAAAGG + Intronic
989414856 5:41162070-41162092 TCTACCAGATGCTTAATAAATGG - Intronic
990054888 5:51561361-51561383 CGTAGTAGGGGCTCAATAAAAGG - Intergenic
990352460 5:54932382-54932404 CATAGCAGGTCATCAATCAATGG - Intergenic
990521808 5:56588387-56588409 CATAGTAGGTGCTAAATAAATGG - Intronic
990605490 5:57405686-57405708 CAAGGCAGATGTCCAATAAATGG + Intergenic
991005527 5:61824417-61824439 CATAGTAAAAGCTGAATAAATGG - Intergenic
991381351 5:66031345-66031367 CAAAGCAGTTGTTCAATAAATGG - Intronic
991459676 5:66844705-66844727 CATAGTAGATGCTCAAGAAAGGG + Intronic
991694680 5:69259505-69259527 CATAGTAGGCACTCAATAAATGG - Intronic
992082652 5:73249581-73249603 CATAGTAGGCACTCAATAAATGG - Intergenic
992270521 5:75058345-75058367 CATATTAGGTGCTCATTAAATGG + Intergenic
992323189 5:75634528-75634550 CATAGTAGCTTCTCAGTAAATGG + Intronic
992381635 5:76243152-76243174 CATAGCAAGTGCTCAGTAAATGG + Intronic
992596472 5:78352578-78352600 ATTAGAGGATGCTCAATAAATGG - Intergenic
992665612 5:79005932-79005954 CATAGTAGGGGCTCAATAAATGG - Intronic
993329948 5:86587031-86587053 CATAGAAGATTCTTAATGAAAGG - Intergenic
993372063 5:87105065-87105087 CATGGTAGTTGCTTAATAAATGG - Intergenic
993545703 5:89210455-89210477 CATAATATATGCTCAATAAATGG - Intergenic
994102127 5:95904930-95904952 CATAGTATATGCTCAAAAAATGG + Intronic
994267637 5:97737643-97737665 CAGAGTAGATGCTTATTAAATGG + Intergenic
994293536 5:98060782-98060804 CATAAAAGATGATGAATAAATGG + Intergenic
994335558 5:98561430-98561452 CATGGTAGGTGCTAAATAAATGG - Intergenic
994502661 5:100600019-100600041 CATAGAAGGTGCTTAACAAAAGG - Intergenic
994522806 5:100862707-100862729 CATAACAAATGTTCAATAAAAGG - Intronic
995046201 5:107651324-107651346 CACAGTAAGTGCTCAATAAATGG + Intronic
995138961 5:108712127-108712149 CATAGTTGACGCTCAATAAATGG + Intergenic
995316864 5:110784415-110784437 TATAGTAGGTTCTCAATAAAAGG + Intergenic
995463784 5:112429922-112429944 CACAGCTGGTGCTCAATATATGG + Intergenic
996119173 5:119651802-119651824 CATAGGAGCTGCTTAATAAATGG + Intergenic
996368885 5:122732479-122732501 CCTAGAAAATGTTCAATAAATGG + Intergenic
996429848 5:123361792-123361814 CATAGTATGTGCTCAGTAAATGG - Intronic
996656914 5:125950901-125950923 CATGATAGTTGCTCAATAAAGGG - Intergenic
997060589 5:130497079-130497101 CATAGCAAATGTTAACTAAATGG + Intergenic
997690862 5:135826608-135826630 CAAAGTAAATGCTTAATAAATGG - Intergenic
997952273 5:138252073-138252095 CCAAGCAGGTGTTCAATAAATGG + Intergenic
998066643 5:139164586-139164608 CATGGTAGGTGCTCAATGAATGG - Intronic
998143859 5:139714811-139714833 CATAGTACCTACTCAATAAATGG - Intergenic
998181473 5:139948568-139948590 CATTGCAGATGCTCAGTAAATGG - Intronic
998181763 5:139950956-139950978 CATAGAAGATGATCAATATATGG - Intronic
998261699 5:140636626-140636648 CACAGCAGGTACTCAGTAAATGG + Intergenic
998393208 5:141801127-141801149 CATAGTAGGTGCTCAGTCAAAGG + Intergenic
998441209 5:142163912-142163934 CATGATAAATGCTCAATAAATGG - Intergenic
998717452 5:144901516-144901538 CATAGGAAGTGTTCAATAAATGG + Intergenic
998761953 5:145442085-145442107 TATAGTAGGTGCTAAATAAATGG - Intergenic
998892683 5:146763509-146763531 CTTGGCTGGTGCTCAATAAATGG + Intronic
998951241 5:147395056-147395078 CATAGTAGATGTTCAATCAGTGG + Intronic
998973210 5:147615168-147615190 CACAGCAGGCCCTCAATAAATGG + Intronic
998983527 5:147730086-147730108 CATAGAAAATGCTCAATAAATGG + Intronic
999373478 5:151070328-151070350 CACAGCAGGTGCTTAATAAAAGG + Intronic
999385650 5:151152284-151152306 CACAGTAAAGGCTCAATAAATGG + Intronic
999427530 5:151500730-151500752 CATAGCAAATGCTCAGTAAAAGG + Intergenic
999463135 5:151773444-151773466 CAGAGTAAATGCTAAATAAACGG - Intronic
999483846 5:151973301-151973323 CATAGTAAGTGCTCAATAAATGG - Intergenic
999656375 5:153814732-153814754 CATAGCAAGTGCTCAATACATGG - Intergenic
999660649 5:153859489-153859511 CATTGAACATCCTCAATAAATGG + Intergenic
999685912 5:154102976-154102998 CATAGCAGACACTCAATACTTGG + Intronic
999869725 5:155736736-155736758 CATAGTGGATACTCAATAAATGG - Intergenic
999896670 5:156041580-156041602 CATAATAGGTACTCAATAAATGG - Intronic
999917214 5:156275898-156275920 CATGGAAAATGTTCAATAAATGG - Intronic
1000277048 5:159747159-159747181 CATAGTATATGCTTAGTAAATGG - Intergenic
1000301358 5:159959321-159959343 CATAATAGGTGCTGAATAAATGG - Intronic
1000353349 5:160370219-160370241 CAAAGTAGGCGCTCAATAAATGG + Intronic
1000387300 5:160686832-160686854 CATAGCAGTTGCTCAGTAAATGG + Intronic
1000409625 5:160924447-160924469 CATAGTAAATACTCAATAAAAGG + Intergenic
1000461697 5:161529634-161529656 CACAGAAGTTTCTCAATAAATGG + Intronic
1000814726 5:165906691-165906713 CACAGTAGATACTTAATAAATGG + Intergenic
1001055547 5:168446779-168446801 CATAGTAGACCCTCAATACATGG + Intronic
1001220277 5:169894715-169894737 CACAGTAGGTGCTCAGTAAATGG + Intronic
1001225109 5:169937489-169937511 CATAGTAAGTGTTCAATAAAAGG + Intronic
1001264789 5:170266119-170266141 CATAGCAGTTGCTCAATAAATGG + Intronic
1001356227 5:171026188-171026210 CATGGGAGTTTCTCAATAAATGG - Intronic
1001465301 5:171959352-171959374 CATAACAGAAGCTTGATAAATGG - Intronic
1001555351 5:172633158-172633180 CATGGCAAGTGCTTAATAAAGGG - Intergenic
1001619276 5:173069187-173069209 CAAAACAGACACTCAATAAATGG - Intronic
1001645014 5:173273912-173273934 CTTAGTAGATGGTAAATAAATGG - Intergenic
1001646486 5:173285749-173285771 CATAGTAGATGCTCTGTAAATGG + Intergenic
1001726343 5:173905091-173905113 CTTAGTAGATGCTCAATAAAGGG + Intronic
1001948373 5:175798285-175798307 CATAGTAAATGCTCAAAAAATGG + Intronic
1002775807 6:326676-326698 CACAGTAGATGCTCAATAAATGG - Intronic
1002781752 6:372567-372589 CATAGGAGGTGCTCAAAAAACGG - Intergenic
1002789760 6:428407-428429 CACAGAAGGCGCTCAATAAACGG + Intergenic
1002902294 6:1419301-1419323 TATAGTAAATACTCAATAAATGG - Intergenic
1002982662 6:2156430-2156452 CACAGCACATGCTCGACAAATGG + Intronic
1003261098 6:4516876-4516898 CACAGTAAGTGCTCAATAAATGG + Intergenic
1003355155 6:5362224-5362246 TATAACAGGTACTCAATAAATGG - Intronic
1003691895 6:8363069-8363091 CATAGTAAGTGTTCAATAAACGG + Intergenic
1004142678 6:13034352-13034374 CAGAGCAGATGCTCAATAAATGG + Intronic
1004310584 6:14541402-14541424 AACAGCAGGTGCTCAGTAAAAGG - Intergenic
1004504464 6:16237095-16237117 CATAGTAGTTGCTCAATGCATGG - Intergenic
1004510511 6:16280516-16280538 CACACTAGTTGCTCAATAAATGG - Intronic
1004923524 6:20398763-20398785 TATAGCAAATGCCCAATAAGTGG - Intergenic
1005120133 6:22380274-22380296 CAGAGCAGGTGCTCAATAAGTGG - Intergenic
1005232689 6:23722725-23722747 CATGGCAGATGCTGAATAAATGG - Intergenic
1005296854 6:24435361-24435383 CATACTAAATGCACAATAAATGG + Intronic
1005526484 6:26656361-26656383 CTCAGTAGATGCTTAATAAATGG + Intronic
1006167900 6:32076040-32076062 CATAGTAGATGTTCAATACTTGG - Intronic
1006576711 6:35051904-35051926 CACAGTAAATGCTCAATAAAAGG - Intronic
1006615060 6:35320629-35320651 CATCTTAGCTGCTCAATAAACGG + Intronic
1006726568 6:36203362-36203384 AATAGTAAGTGCTCAATAAATGG + Intronic
1006918157 6:37609440-37609462 TATAGAGGATGCCCAATAAATGG - Intergenic
1007005695 6:38360284-38360306 CATACTAAGTGCTCAATAAATGG + Intronic
1007140017 6:39562753-39562775 ACTGGCAAATGCTCAATAAATGG + Intronic
1007208063 6:40168844-40168866 CATAGTAGTTGCTCAATTAGTGG - Intergenic
1007251290 6:40496852-40496874 CATAGTAGGTGCTTATTAAAAGG + Intronic
1007382841 6:41501968-41501990 TATGGCAGGTGCTCAATAACTGG + Intergenic
1007429087 6:41766342-41766364 CATAGTAGGTGCTCAGTAAGTGG - Intergenic
1007611887 6:43155026-43155048 CACAGCAGGTGCTCACCAAATGG + Intronic
1008007034 6:46421825-46421847 CATAATAGGTACTCAATAAATGG + Intronic
1008036710 6:46753077-46753099 CATAGCAAATCTTCACTAAAAGG - Intronic
1008145271 6:47884347-47884369 GAGAGCAGATGCTCGAAAAATGG - Intronic
1008512516 6:52289984-52290006 CATAGTACATGCTCAATGAATGG - Intergenic
1009317799 6:62243849-62243871 CATAGTAGATATTCACTAAATGG + Intronic
1009324205 6:62329816-62329838 CATAGCAGGCTCTCAATAAATGG + Intergenic
1010054098 6:71543733-71543755 TGAAGTAGATGCTCAATAAATGG + Intergenic
1010260387 6:73808688-73808710 CATAGCAAATGCTCAAAAATAGG + Intronic
1010648250 6:78420336-78420358 CATAGCAGATTCTCAAAACTGGG - Intergenic
1010780281 6:79937890-79937912 TATACTAAATGCTCAATAAATGG + Intronic
1010917598 6:81640221-81640243 CAGAGCAGACGCTCACTGAAAGG + Intronic
1011082561 6:83505694-83505716 CATAGTAGGCTCTCAATAAATGG - Intergenic
1011531230 6:88323337-88323359 TATAACACATGCTTAATAAATGG + Intergenic
1011668068 6:89655069-89655091 CAAAGCAAAAGCTCAATACATGG + Intronic
1012396398 6:98802535-98802557 CACAGCAGATGATTAATAAATGG + Intergenic
1012797446 6:103780642-103780664 TGTAGCAAATGCTCAAGAAAAGG - Intergenic
1012803657 6:103868195-103868217 GATAGCATATGCTGAATCAAAGG + Intergenic
1013164053 6:107573992-107574014 CACAGTAGATGCTCAATAAGTGG + Intronic
1013584426 6:111565824-111565846 CATATCAGATGCTCAAACAAGGG - Intronic
1014406604 6:121060068-121060090 CATAGTGGATTCTCAATATAAGG + Intergenic
1014489755 6:122047105-122047127 CATATAAGGTGCTCAGTAAATGG + Intergenic
1014885050 6:126769719-126769741 CTTAGTAGATGCTCAGTTAACGG + Intergenic
1015122095 6:129710859-129710881 TATAGTAGGTGCTCAACAAATGG - Intergenic
1015146360 6:129991997-129992019 CATAGTAGGTGCTCATTAACTGG - Intergenic
1015359768 6:132325801-132325823 CAAATGAGGTGCTCAATAAATGG + Intronic
1015447885 6:133328464-133328486 CGTAGACTATGCTCAATAAATGG + Intronic
1015888154 6:137942051-137942073 CATAGCAGATGCTTAGTAAATGG + Intergenic
1016506731 6:144790143-144790165 AATAGCAGTTGTTGAATAAATGG + Intronic
1016877029 6:148875875-148875897 TACAGTAAATGCTCAATAAATGG - Intronic
1017442234 6:154474987-154475009 CATAGTATATGCTCAGTAAATGG - Intronic
1017738757 6:157386047-157386069 CATAGCAAGGGCTCAATAAATGG + Intronic
1017788930 6:157778587-157778609 CAGAGTAGATGATCAAGAAATGG - Intronic
1017980495 6:159397078-159397100 CATAGTAATAGCTCAATAAACGG + Intergenic
1018174775 6:161168992-161169014 CATAGCAGGCAATCAATAAATGG + Intronic
1018884206 6:167919144-167919166 CAGAGCAGATGCTCACTACAGGG - Intronic
1018910143 6:168097028-168097050 CATAGGAGATGCAAAATACATGG - Intergenic
1019215029 6:170437975-170437997 CATAGTAGATGTTCAGTGAAAGG + Intergenic
1019482850 7:1274395-1274417 CACAGCAGACGCTCACTGAATGG + Intergenic
1020205376 7:6110396-6110418 CATAGAAAATGCTCAATTAGTGG + Intronic
1020584077 7:10043980-10044002 TATAGTAGATGCTTAATACATGG - Intergenic
1020682167 7:11250874-11250896 CATAACATGTGCTCAATCAATGG - Intergenic
1020878531 7:13728804-13728826 TAAAATAGATGCTCAATAAATGG + Intergenic
1021058001 7:16074653-16074675 CATAGTAGTTGCTCAATATATGG - Intergenic
1021566156 7:22018605-22018627 CATAGCAGGTGCTTAATAAATGG - Intergenic
1021762616 7:23915953-23915975 GATAGTAAGTGCTCAATAAATGG + Intergenic
1021896951 7:25246008-25246030 CATAGTAGTCACTCAATAAATGG + Intergenic
1021971370 7:25968625-25968647 CATAGTAGGTGCTCAATGCATGG + Intergenic
1022059658 7:26780246-26780268 ATTAGCAAATGCTCAATAAATGG + Intronic
1022451704 7:30522222-30522244 CATAGTAGATACTCAATAAATGG - Intronic
1022764816 7:33399941-33399963 CATACCAGATGGTTATTAAAAGG - Intronic
1022809930 7:33858956-33858978 CACAGCACATGCTCAATAAGTGG - Intergenic
1022829336 7:34049265-34049287 CATTACACATCCTCAATAAATGG - Intronic
1022838986 7:34144682-34144704 CATAGAAGATGCTCAGTCAAGGG + Intronic
1022861674 7:34373815-34373837 CATAGTAGGTGCTCAATTAATGG - Intergenic
1022952043 7:35348473-35348495 CATAGTAGTTGCTCAAAGAATGG - Intergenic
1023286073 7:38621414-38621436 CATATTAGATTCTCAATAAATGG + Intronic
1024299810 7:47878475-47878497 TGTAGCAGAGGCTCAATAGATGG - Intronic
1024364818 7:48508763-48508785 CATGGAAGGTGCTCAGTAAATGG - Intronic
1024565114 7:50674198-50674220 CATAGCAGGCACTCAATAAAAGG + Intronic
1024566624 7:50686674-50686696 CCTTGCAGGTGCTCAAAAAATGG - Intronic
1024989863 7:55224633-55224655 CATAGTAAGTGCTCCATAAAGGG + Intronic
1025168185 7:56732208-56732230 TATAGTGGATGTTCAATAAATGG - Intergenic
1025536793 7:61958190-61958212 CCTAGTAGATGCTCCAAAAAGGG - Intergenic
1025622992 7:63191277-63191299 CATAGTCCGTGCTCAATAAATGG - Intergenic
1025704205 7:63847716-63847738 TATAGTGGATGTTCAATAAATGG + Intergenic
1025841542 7:65154175-65154197 CATAACAAGTGCTTAATAAATGG - Intergenic
1025881507 7:65541791-65541813 CATAACAAGTGCTTAATAAATGG + Intergenic
1025891932 7:65660824-65660846 CATAACAAGTGCTTAATAAATGG - Intergenic
1025941201 7:66077130-66077152 AACAGTAGGTGCTCAATAAATGG + Intronic
1026390436 7:69896216-69896238 CATAGTAAATGTTCAATGAATGG - Intronic
1026405482 7:70061283-70061305 CATGGAAGGTGCTCAGTAAATGG + Intronic
1026474076 7:70719028-70719050 CATAGTAAGTACTCAATAAATGG - Intronic
1026856089 7:73755971-73755993 CAGAGCTGATGCTCTGTAAAGGG - Intergenic
1027124331 7:75545217-75545239 TATAGTACATGCTCAATAAAAGG - Intronic
1027225607 7:76241812-76241834 TATAGTAGGTGCTCAATGAATGG - Intronic
1027466876 7:78525969-78525991 CAGAGTAGATGCTCAAAATAGGG + Intronic
1027504271 7:78996015-78996037 CATAGGAAATGCTCAGAAAATGG + Intronic
1027701671 7:81477989-81478011 CATAGCAGATACTCAAGGAATGG - Intergenic
1027861335 7:83585966-83585988 CCTAACAAATGATCAATAAATGG + Intronic
1028311425 7:89342803-89342825 CATATTAGGTACTCAATAAATGG - Intergenic
1028409003 7:90507794-90507816 CATAGTAGATGCTCAATAAATGG + Intronic
1028478951 7:91283327-91283349 CAAAGCAAATACTCAACAAAGGG + Intergenic
1028619693 7:92811581-92811603 CATAGGAGCTGTTCAACAAATGG - Intronic
1028659771 7:93256274-93256296 CTTAACAGAAACTCAATAAATGG - Intronic
1029022826 7:97383359-97383381 CCTCGCAGATGCTAAATAAGGGG + Intergenic
1029254044 7:99256982-99257004 CATAGTAAGTGCTCAAGAAAGGG - Intergenic
1029256457 7:99272932-99272954 CACAGGAGGTCCTCAATAAATGG + Intergenic
1029328868 7:99834515-99834537 CATATCAGCTGCTGACTAAATGG - Intronic
1029628094 7:101732998-101733020 CATGGCAGATGCTGATTACAGGG + Intergenic
1029847186 7:103424411-103424433 CTTAGCAGGTGCTCAGTAACTGG + Intronic
1030001030 7:105062655-105062677 CATAACAAGGGCTCAATAAATGG - Intronic
1030076392 7:105740735-105740757 CACAGCAGCTGCTCAGTCAAAGG + Intronic
1030199581 7:106888986-106889008 CATAGCAGAAAATCAATAAATGG + Intronic
1030263679 7:107593767-107593789 CAAAGTAGGTGCTCTATAAATGG - Intronic
1030564255 7:111133124-111133146 CACAGTAGATCTTCAATAAATGG - Intronic
1031021062 7:116628047-116628069 CATAATAAATGCTCATTAAATGG - Intergenic
1031124006 7:117752912-117752934 TATAATAAATGCTCAATAAAAGG + Intronic
1031144003 7:117977630-117977652 CACAGCAGCTGCTCAATAAGTGG - Intergenic
1031439065 7:121770626-121770648 ATTAGCAGAAACTCAATAAATGG - Intergenic
1031665537 7:124478485-124478507 CATTCCAGATGCTCAATACTTGG + Intergenic
1032181869 7:129686641-129686663 CAAAGTAAGTGCTCAATAAACGG + Intronic
1032259145 7:130320855-130320877 CATAGTAGCTGCTCAACAGATGG + Intronic
1032522397 7:132555525-132555547 CATATTAAATGCTCAATAAGTGG - Intronic
1032795267 7:135271221-135271243 CATAGTCGGTGCTCAATAAAGGG + Intergenic
1033058389 7:138081152-138081174 CATGGCAGATGGTCAAAAGAGGG - Intronic
1033314257 7:140284668-140284690 CATAGTAGAAGCTCAATAAATGG - Intergenic
1033451452 7:141465622-141465644 CATGGTAGATCCTCGATAAAGGG - Intronic
1034879559 7:154752932-154752954 CACAGCAGGTGCTCAATAAATGG - Intronic
1034992009 7:155553768-155553790 CATTGCAGTAGCTCAATAACTGG - Intergenic
1035544138 8:466424-466446 CATAGCTGGTGCTCAGAAAATGG + Intronic
1036638904 8:10569832-10569854 CATAGGAGATGCTCAGGAGAGGG + Intergenic
1037781493 8:21872295-21872317 CATAGTAGTTGCTGAATAAATGG + Intergenic
1037808836 8:22074049-22074071 CATGGTAAACGCTCAATAAATGG - Intronic
1037896465 8:22659556-22659578 AATAGTAGATGCTCAATAAGTGG - Intronic
1037928318 8:22862580-22862602 CCTAATAAATGCTCAATAAATGG - Intronic
1038210356 8:25513076-25513098 CATAGTAGTTGTTGAATAAATGG - Intergenic
1038275665 8:26118832-26118854 CATAGTAGGTGCTCAATAAATGG + Intergenic
1038321538 8:26531678-26531700 ATTAGCAGGTGCTTAATAAAGGG + Intronic
1038417502 8:27407833-27407855 CAGAGCAGGTGCTCAAAAAATGG - Intronic
1038549905 8:28458228-28458250 CATAGTAGGAACTCAATAAATGG - Intronic
1039395781 8:37224041-37224063 CAGAGTAGGTGTTCAATAAATGG - Intergenic
1039403933 8:37296752-37296774 CATAGTAGAAGTTCAATAAATGG + Intergenic
1039456920 8:37713406-37713428 TGTAGTAGATGCTCAGTAAATGG - Intergenic
1039524966 8:38206582-38206604 CATATAGTATGCTCAATAAATGG - Intronic
1039555739 8:38473586-38473608 CATTGTAAATGCTCAATAAATGG + Intergenic
1039568700 8:38569232-38569254 TATAGTAGATGCTCAATAAAGGG + Intergenic
1039914914 8:41852593-41852615 AACAGCAGGTGCTCAATAAGTGG - Intronic
1040635634 8:49270288-49270310 CACAGCTGATGCTCTCTAAAAGG - Intergenic
1041117342 8:54552805-54552827 CATCGCATGTGCTCAGTAAAAGG + Intergenic
1041136179 8:54761729-54761751 CATAGTAGGTCCTAAATAAATGG + Intergenic
1041628650 8:60059937-60059959 CAGGGCAGAGGCTCAATAACTGG + Intergenic
1041859966 8:62502045-62502067 CATAGCAGATGGTCATCAAAGGG + Intronic
1042003217 8:64150167-64150189 CATGGCAGATGGGCAAAAAAGGG - Intergenic
1042234766 8:66600506-66600528 TTTAGCAGGTGTTCAATAAATGG - Intronic
1042340510 8:67673982-67674004 TATAGTAAATGTTCAATAAATGG - Intronic
1043022517 8:75021975-75021997 ACTAGTAGATGCTCAATAAAGGG + Intronic
1043137248 8:76543780-76543802 CATGGCAGATGGTGAATTAAGGG - Intergenic
1043663404 8:82776159-82776181 AATAGCAGATGTTCAACAAATGG - Intergenic
1043874360 8:85467451-85467473 CATAGAAGTTGCTCAATAAATGG + Intronic
1043876977 8:85496520-85496542 CATAGTAAGTGCTCAATAAATGG + Intergenic
1044602286 8:94017461-94017483 CATAGTAAGTACTCAATAAATGG - Intergenic
1044772256 8:95648654-95648676 CATAGAAGATGCTCAGTGAGAGG + Intergenic
1044795037 8:95887911-95887933 CCTAGTAGGTGCTCAATAAAAGG + Intergenic
1044853004 8:96447349-96447371 CATGGTAGGTGCTCAATTAATGG - Intergenic
1044874234 8:96648569-96648591 CATAGTATACACTCAATAAATGG - Intronic
1045263289 8:100596331-100596353 CGTAGTAAGTGCTCAATAAATGG + Intronic
1045336421 8:101207342-101207364 CATAGTAGACGTTGAATAAATGG + Intergenic
1045385210 8:101666125-101666147 CATATTACATGCTCAAAAAAGGG + Intronic
1045546483 8:103133474-103133496 CATAGCAACTGCTCAACAGATGG - Intronic
1045552435 8:103184419-103184441 CACAGAAGGTGCTCAATGAATGG - Intronic
1045648180 8:104319589-104319611 CATACCATATGCTCAATAAATGG - Intergenic
1045746149 8:105424758-105424780 AAAAGCAGATGCTTAATATATGG - Intronic
1046530421 8:115438252-115438274 CAGGGCAGATACTCAATGAATGG - Intronic
1046665966 8:117003293-117003315 CTTAGTAGGTACTCAATAAATGG - Intronic
1046809727 8:118519296-118519318 TATAGAAGGTGCTCAGTAAATGG - Intronic
1047063511 8:121254032-121254054 TATAGTAGATACTCAACAAATGG + Intergenic
1047095667 8:121622539-121622561 CACAGTAAATGCTCAATAAATGG + Intronic
1047619006 8:126587311-126587333 GCTAGTGGATGCTCAATAAATGG + Intergenic
1047644754 8:126858315-126858337 CATAGTGCATGCTCAATAAATGG + Intergenic
1047688604 8:127327735-127327757 CATGGCAGGAGCTCAATCAATGG - Intergenic
1047725649 8:127681800-127681822 CATAGCAAATGCTCCAAAAATGG + Intergenic
1047754276 8:127906781-127906803 CATAGTAGGCACTCAATAAAGGG - Intergenic
1047782604 8:128122495-128122517 CACAGTAAGTGCTCAATAAATGG + Intergenic
1047862258 8:128980897-128980919 CATAATATATGCTTAATAAATGG - Intergenic
1048054324 8:130849021-130849043 CATAGTAGGTGCTCAATAAATGG + Intronic
1048194924 8:132324625-132324647 CATAGTATGTGCTCAACAAATGG - Intronic
1048400127 8:134057907-134057929 CATAGTTCATGATCAATAAATGG + Intergenic
1048583182 8:135747740-135747762 CACAGTAAATGCTCAACAAATGG - Intergenic
1048634060 8:136276551-136276573 CATACTAAATGCTCAATATATGG - Intergenic
1049013537 8:139904155-139904177 CATGGTAGAGCCTCAATAAACGG + Intronic
1049245217 8:141558830-141558852 CTTAGCAGGTGCTCCCTAAATGG + Intergenic
1049252123 8:141594894-141594916 CACAGCAGATGAACACTAAAGGG - Intergenic
1049760874 8:144331582-144331604 CATAGTAGGTGCTCAATGAACGG + Exonic
1049832640 8:144712041-144712063 CATAGCAGGTGCTCCATGAATGG + Intergenic
1050490948 9:6187292-6187314 CATAGTAAGTGCTCAATAAGTGG + Intergenic
1050722799 9:8610303-8610325 CATATTAAATACTCAATAAATGG + Intronic
1050746564 9:8883108-8883130 CATAGTAGATGCTCAATTAGTGG - Intronic
1051555521 9:18378289-18378311 CATAGTAAACACTCAATAAATGG + Intergenic
1051739433 9:20237271-20237293 CCTAGAAGGTGCTCACTAAATGG - Intergenic
1052025978 9:23573405-23573427 CATGGCAGTCACTCAATAAATGG - Intergenic
1052376103 9:27719195-27719217 AATATCAGCTGCTCAATTAATGG + Intergenic
1052454554 9:28678689-28678711 CACATCAAATACTCAATAAATGG + Intergenic
1052777497 9:32747305-32747327 CATTGTAAATGCTCAATAAAAGG + Intergenic
1052969242 9:34366683-34366705 CAAAGTAGGTGCTCAATAAATGG - Exonic
1053029412 9:34761447-34761469 GAGAGCAGATGATAAATAAATGG + Intergenic
1053264554 9:36701185-36701207 CTCAGTAGATGCTGAATAAAGGG + Intergenic
1054717575 9:68571751-68571773 CATAGCAAGTGCTCAAGAAATGG - Intergenic
1054843012 9:69762811-69762833 CATAGTAGATTCTTAATAATTGG - Intergenic
1054968374 9:71055952-71055974 TATAGCAGGTGCCCAATACATGG - Intronic
1055025790 9:71719243-71719265 CACAGTAGGTGCTCACTAAATGG + Intronic
1055412126 9:76041990-76042012 AATAGTAGATACTCAATAAGTGG + Intronic
1055491083 9:76805993-76806015 CATAGTAGGTACTCAATGAAGGG + Intronic
1055911829 9:81362045-81362067 CATAGCAAGTTCTCAATAAAAGG - Intergenic
1055961777 9:81827513-81827535 CTCAGCAGGTGTTCAATAAATGG - Intergenic
1056125729 9:83535203-83535225 CATGAGAGATGCTCAAGAAATGG + Intronic
1056306017 9:85291128-85291150 CATAATAGATGCTCAATAAATGG + Intergenic
1056350644 9:85745392-85745414 CATAAGAGGTGCTCAATAAATGG - Intergenic
1056406296 9:86278782-86278804 CTTAGAAGGTGCTCAGTAAATGG - Intronic
1056457490 9:86774841-86774863 CATAGTAGATGCTTAACAAGAGG + Intergenic
1056942978 9:90971160-90971182 CATAGCAGGTACTTAATACACGG - Intergenic
1056993227 9:91430298-91430320 CCCAGCAGGTGCTCCATAAATGG - Intergenic
1057184873 9:93051703-93051725 CACAGCAGATACTCAAGAAGTGG + Intergenic
1057197455 9:93122899-93122921 CACAGCAGGTGATTAATAAATGG + Intronic
1057499823 9:95587876-95587898 CATACTATATGTTCAATAAATGG - Intergenic
1057514371 9:95708962-95708984 CATAGGAGATATTCAATAAAGGG - Intergenic
1057775144 9:98001783-98001805 TATAGCAGATCCTCTAAAAATGG - Intronic
1057793255 9:98137964-98137986 CATGGCAGATGTTCAATAAAAGG + Intronic
1057809892 9:98249807-98249829 CATAGTAAGTGCTCAATACATGG - Intronic
1057824945 9:98365297-98365319 CAGAGAAGATGATCAACAAATGG + Intronic
1057859848 9:98632350-98632372 CAAACTAGGTGCTCAATAAATGG + Intronic
1058192135 9:101931289-101931311 TATAGCAAATACTCAATATATGG - Intergenic
1058415572 9:104785140-104785162 CATGGTAGGTGCTCACTAAATGG + Intronic
1058424641 9:104865764-104865786 CATGGTAGGTGCTCAATATATGG + Intronic
1058473623 9:105307097-105307119 CATGGCAGGTGATCAATAAATGG - Intronic
1058473820 9:105309419-105309441 CAGAGCAGATGTTCTGTAAAGGG + Intronic
1058609411 9:106758578-106758600 AATTGCAGGTGCTCAATAAATGG - Intergenic
1058643979 9:107113453-107113475 CAGAGCAAGTGCTCAATGAATGG - Intergenic
1058697938 9:107575517-107575539 CATAGTAGGTTCTCATTAAATGG - Intergenic
1058737167 9:107904466-107904488 CTTAGCAGATGCTCAATAAAAGG + Intergenic
1058741471 9:107946948-107946970 CATAGCTGTTACTCAATAAATGG - Intergenic
1058801856 9:108552226-108552248 TATAGTAAATGCTCAATAATAGG - Intergenic
1058822714 9:108747391-108747413 CAAAGTAGGTGCTCAATAAATGG + Intergenic
1058860773 9:109116083-109116105 CATGGCAGATGCTCAAAAGTTGG + Intronic
1059402473 9:114078811-114078833 CATAGCAGGTGCTCAGTGAACGG - Intergenic
1059421831 9:114197052-114197074 CATAGCAGGTGTTCAGGAAATGG + Intronic
1059449297 9:114360251-114360273 CACAGCAGGTGCTCAATTCATGG - Intronic
1059464970 9:114462862-114462884 CATAGTAACTGCTCAATAAAAGG + Intronic
1059696626 9:116735939-116735961 CATAGTAGGTGCTCAATAAAAGG - Intronic
1059698258 9:116749193-116749215 AATAGCAGGCTCTCAATAAATGG + Intronic
1059714791 9:116903874-116903896 CATAGCAGATGGGCAAGAAGGGG + Intronic
1059720347 9:116953673-116953695 CTCAGGAGATGCTCAATACAGGG - Intronic
1059739436 9:117135381-117135403 CATACCAAATGCTCAGTAGATGG + Intronic
1059771236 9:117428294-117428316 TATTGCAGGTACTCAATAAATGG - Intergenic
1059801587 9:117754849-117754871 CTTGGCAAGTGCTCAATAAATGG + Intergenic
1059853959 9:118374592-118374614 TATAGTAAGTGCTCAATAAATGG + Intergenic
1059880889 9:118687643-118687665 CCTAGCATGTACTCAATAAACGG - Intergenic
1060066135 9:120502875-120502897 CATAGCTGGTGCTCAGTAAATGG - Intronic
1060136106 9:121155678-121155700 CACAGCAGTGGCTCAATAAAAGG - Intronic
1060207999 9:121693817-121693839 CATAGTAGGTGCTCAATCAAGGG - Intronic
1060354775 9:122895130-122895152 TATAGCAGATGCTAAATAAATGG + Intronic
1060428021 9:123522702-123522724 CATAGTAGGAGCTCATTAAAAGG - Intronic
1060533184 9:124360896-124360918 CATAGCTACTGCTTAATAAATGG + Intronic
1060772662 9:126344139-126344161 CATAGTAGGTACTCAAAAAATGG - Intronic
1060842417 9:126804327-126804349 TGTAGTAGATGCTCAGTAAATGG - Intergenic
1061125911 9:128675599-128675621 TCCAGCTGATGCTCAATAAATGG + Intergenic
1061259467 9:129471882-129471904 CATAGTAAGTGCTCAATAAATGG + Intergenic
1061296450 9:129679406-129679428 CTTGGCAGGTGCACAATAAATGG - Intronic
1061347156 9:130035600-130035622 CATAGTAGGCACTCAATAAATGG + Intronic
1061418953 9:130462997-130463019 CATAGTAGGTGCTCACTAAAGGG + Intronic
1061474515 9:130855249-130855271 CAGAACGGATCCTCAATAAAGGG - Intronic
1061508458 9:131046008-131046030 AACAGCAGGTGCTCAATAAGTGG - Intronic
1061842953 9:133370465-133370487 CCAAACAGATGCTCATTAAATGG - Intronic
1185840459 X:3384493-3384515 CTTATCAGATGCTCACTCAAGGG - Intergenic
1186182636 X:6987861-6987883 CATAACAGATGGTCAACAGATGG - Intergenic
1186481803 X:9901883-9901905 CAGATTACATGCTCAATAAATGG + Intronic
1186908280 X:14134426-14134448 TATAGTAGATGCTTAGTAAATGG - Intergenic
1187208355 X:17204448-17204470 AACAGTAGATTCTCAATAAATGG - Intergenic
1187210384 X:17224763-17224785 TATAATAGATGCTCAGTAAAGGG - Intergenic
1187255548 X:17638743-17638765 CCTAGTAGATGCTCAATCCATGG + Intronic
1187332973 X:18357157-18357179 CTCAGCACATGCTCAATAAATGG - Intergenic
1187484881 X:19694075-19694097 CATAGCAGACCCATAATAAATGG - Intronic
1187554441 X:20338642-20338664 CATAGCAGGTACTGAGTAAATGG + Intergenic
1187571574 X:20508956-20508978 GACAGCAGGTGTTCAATAAAAGG - Intergenic
1187951380 X:24474279-24474301 CAGAGCAGGTGCTCCATAAATGG + Intronic
1187962535 X:24580278-24580300 CATGGAAGGTGCTCAATAAATGG + Intronic
1188295213 X:28439245-28439267 CAGGGCAGATACTCACTAAAAGG - Intergenic
1188445814 X:30252070-30252092 AAGAGCAGATGCTCAATTTATGG - Intergenic
1188508593 X:30909942-30909964 AATAGCAGATGTTTAATAAATGG + Intronic
1188509573 X:30920866-30920888 AATAGAAGAAGCTCATTAAATGG - Intronic
1188581953 X:31724720-31724742 CATATTAGATGCTCATTAAATGG - Intronic
1188936845 X:36186421-36186443 CATAGGTGTTTCTCAATAAAAGG - Intergenic
1189076064 X:37916018-37916040 TAGAGTAGGTGCTCAATAAATGG - Intronic
1189164931 X:38851559-38851581 TATAGTAAGTGCTCAATAAATGG + Intergenic
1189268549 X:39734714-39734736 CATAGTAGGTGCTTAACAAATGG + Intergenic
1189328573 X:40128915-40128937 CATAGTAGGTACTTAATAAATGG - Intronic
1189703339 X:43734376-43734398 CACAACCAATGCTCAATAAATGG - Intronic
1189753595 X:44248145-44248167 GATAGCAAATGCACAATAAGTGG + Intronic
1189777702 X:44484999-44485021 CACAGCAGGTTCTCAATAAGTGG - Intergenic
1190022211 X:46889645-46889667 TATAGCAGGTGCTCAGTAAATGG - Intronic
1190323857 X:49194474-49194496 CATAGTAGGTGCTCGATGAATGG - Intronic
1190394270 X:49964055-49964077 CATTGTTGGTGCTCAATAAATGG - Intronic
1190405999 X:50088304-50088326 CATGGTAGGTACTCAATAAAGGG + Intronic
1190935035 X:54992179-54992201 CATAGTAGATGCTCAGTAAATGG - Intronic
1190989413 X:55530281-55530303 CATAGTAGATGTTCAATTAGTGG - Intergenic
1191716821 X:64199560-64199582 CTAAGCAGATATTCAATAAAGGG + Intronic
1191785800 X:64916259-64916281 CAGAGTAGGTGCTAAATAAATGG + Intronic
1191997576 X:67112951-67112973 CAGAGAAGGTGTTCAATAAATGG + Intergenic
1192125891 X:68500272-68500294 TATAGTAGTTGCTCAGTAAATGG + Intronic
1192145403 X:68679016-68679038 CATAGTCGGTGCTCAATAAATGG + Intronic
1192306903 X:69970377-69970399 CATAACAGGTGCTCAATAATTGG + Intronic
1192409813 X:70924115-70924137 TATAATAAATGCTCAATAAATGG + Intergenic
1192465426 X:71351948-71351970 TATTGTAGGTGCTCAATAAATGG - Intergenic
1192587530 X:72330854-72330876 CATAGTAGGTGCTCAGTAAATGG + Intronic
1192594472 X:72392079-72392101 CATAGTATGTGCTTAATAAAGGG + Intronic
1192790632 X:74379019-74379041 CATAGTAGATGTTTAATAATTGG + Intergenic
1193505312 X:82335236-82335258 CATAGTAGGTGCTTAGTAAATGG + Intergenic
1193763174 X:85491491-85491513 CATAACATTTGTTCAATAAATGG + Intergenic
1194458261 X:94131644-94131666 TATAGTAAATGTTCAATAAATGG + Intergenic
1194568030 X:95518541-95518563 CATAGGAGATTTTCAGTAAATGG + Intergenic
1194582677 X:95696239-95696261 CATAATAAATGCTTAATAAATGG + Intergenic
1194674265 X:96774525-96774547 CATAGCAGATGTTCACGAACAGG + Intronic
1194724321 X:97376589-97376611 CATAAAACATGTTCAATAAATGG - Intronic
1195393178 X:104384375-104384397 CATAGTATGTGCGCAATAAATGG + Intergenic
1195398139 X:104433325-104433347 TATAGTAGGTGCTCAGTAAATGG + Intergenic
1195449530 X:104995330-104995352 CATAGCAGCTGTTTAATAAGTGG + Intronic
1195677839 X:107520919-107520941 CATAGTAAGTCCTCAATAAATGG + Intergenic
1195678705 X:107527295-107527317 CATTGTAGATGCTTAATCAATGG - Intronic
1195728333 X:107939896-107939918 CACAGTAATTGCTCAATAAATGG + Intergenic
1195763927 X:108276482-108276504 CATAGTAGGTGCTAAATAAATGG - Intronic
1195772579 X:108367341-108367363 CAGAGTAGGTGCTCAGTAAATGG + Intronic
1195863907 X:109409117-109409139 CATAGAAGAAACCCAATAAAGGG + Exonic
1195867742 X:109451487-109451509 CATAGTAGGTGCTCAATAAATGG - Intronic
1195950135 X:110262022-110262044 CATAGTAAATTCTTAATAAATGG + Intronic
1195994871 X:110721776-110721798 CATAGTAGGTGCTCAGTAAATGG - Intronic
1196134067 X:112188025-112188047 CCTAGTAGATGCTCAATAAATGG - Intergenic
1196364047 X:114903437-114903459 CATAGGATACACTCAATAAATGG + Intronic
1196499866 X:116367293-116367315 CATAGCAGAAGCTCAGTTAATGG - Intergenic
1196739578 X:119012813-119012835 CATAGTATGTGCTCAATAAATGG + Intronic
1196800330 X:119537467-119537489 CATAGTAAGTGCTCAATAAAAGG + Intergenic
1196843331 X:119878757-119878779 CACAGCAGATGCTACAAAAAAGG - Intergenic
1196975139 X:121151030-121151052 CATAGCAAGCACTCAATAAATGG + Intergenic
1197755372 X:129990185-129990207 CATAGTAGGTGCTCAATAAATGG + Intronic
1197801169 X:130350956-130350978 TGTAGTAGATGCTCAATAAATGG + Intronic
1197893856 X:131290079-131290101 TGTAGTAGGTGCTCAATAAATGG + Intronic
1197951295 X:131900303-131900325 CTTAGTTGGTGCTCAATAAATGG + Intergenic
1198139925 X:133792369-133792391 CATAGTAGATGCTCAATAAATGG + Intronic
1198156263 X:133963812-133963834 CATAGTACACACTCAATAAATGG + Intronic
1198223928 X:134628107-134628129 CATCGTAAGTGCTCAATAAATGG + Intronic
1198647706 X:138827809-138827831 CATAGCAAGTAATCAATAAAGGG - Intronic
1198710580 X:139497438-139497460 CATAGCAGATGAAACATAAAAGG - Intergenic
1198795322 X:140388241-140388263 CTTTGTAGGTGCTCAATAAATGG - Intergenic
1199014649 X:142800630-142800652 AATAGCAGATGCCCAATAAATGG - Intergenic
1199204264 X:145130034-145130056 CACAGTACATGCTCAGTAAATGG + Intergenic
1199503048 X:148530274-148530296 AAGAGCAGATACTCAATATATGG + Intronic
1199522475 X:148751693-148751715 AATAGCAGGTGCTTAAAAAATGG + Intronic
1199635970 X:149811651-149811673 CATAGTAGGTGCTCAACAGAAGG - Intergenic
1199710727 X:150467344-150467366 CACAGCAGGTGCTCAGTAAATGG - Intronic
1199950506 X:152702364-152702386 CAGAGCAGATGCTGAGTGAACGG - Intergenic
1199952771 X:152718624-152718646 CAGAGCAGATGCTGAGTGAATGG - Intergenic
1199955370 X:152737699-152737721 CAGAGCAGATGCTGAGTGAATGG - Intergenic
1199956912 X:152749824-152749846 CAGAGCAGATGCTGAGTGAATGG + Intergenic
1199959176 X:152766097-152766119 CAGAGCAGATGCTGAGTGAACGG + Intergenic
1200019341 X:153188728-153188750 CTCAGCATATGTTCAATAAATGG - Intergenic
1200792653 Y:7313491-7313513 CAAAGCAGATGCTTCAAAAAGGG + Intergenic
1201558604 Y:15291068-15291090 CATAGCATCTTCTCAATAGAAGG + Intergenic
1201695279 Y:16817864-16817886 CAAAGCAGATGCTGATGAAATGG + Intergenic
1202575716 Y:26322455-26322477 CATGGCAGTCTCTCAATAAATGG + Intergenic