ID: 1083491660

View in Genome Browser
Species Human (GRCh38)
Location 11:63018597-63018619
Sequence CATGGACCTGTGTTTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083491657_1083491660 -1 Left 1083491657 11:63018575-63018597 CCTGTTCTCTGCTGGGTCCTGGC No data
Right 1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG No data
1083491654_1083491660 1 Left 1083491654 11:63018573-63018595 CCCCTGTTCTCTGCTGGGTCCTG No data
Right 1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG No data
1083491655_1083491660 0 Left 1083491655 11:63018574-63018596 CCCTGTTCTCTGCTGGGTCCTGG No data
Right 1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG No data
1083491650_1083491660 27 Left 1083491650 11:63018547-63018569 CCTTTAAGCTGACCTGGGTTCAG No data
Right 1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG No data
1083491651_1083491660 15 Left 1083491651 11:63018559-63018581 CCTGGGTTCAGTCTCCCCTGTTC No data
Right 1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083491660 Original CRISPR CATGGACCTGTGTTTTGAGC TGG Intergenic
No off target data available for this crispr