ID: 1083492298

View in Genome Browser
Species Human (GRCh38)
Location 11:63021953-63021975
Sequence CTGCTCTCTGAACCCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083492287_1083492298 29 Left 1083492287 11:63021901-63021923 CCCACTCAACTATAAGGCCACAA No data
Right 1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG No data
1083492296_1083492298 -6 Left 1083492296 11:63021936-63021958 CCTGAAGGATGTATTGGCTGCTC No data
Right 1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG No data
1083492292_1083492298 12 Left 1083492292 11:63021918-63021940 CCACAAAGGCAGGGCCTTCCTGA No data
Right 1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG No data
1083492295_1083492298 -2 Left 1083492295 11:63021932-63021954 CCTTCCTGAAGGATGTATTGGCT No data
Right 1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG No data
1083492288_1083492298 28 Left 1083492288 11:63021902-63021924 CCACTCAACTATAAGGCCACAAA No data
Right 1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG No data
1083492286_1083492298 30 Left 1083492286 11:63021900-63021922 CCCCACTCAACTATAAGGCCACA No data
Right 1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083492298 Original CRISPR CTGCTCTCTGAACCCTTGGC AGG Intergenic
No off target data available for this crispr