ID: 1083495189

View in Genome Browser
Species Human (GRCh38)
Location 11:63045866-63045888
Sequence CCCCATTTATAAATGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083495183_1083495189 28 Left 1083495183 11:63045815-63045837 CCAGAATCTATAAGGAACTTAAG 0: 52
1: 997
2: 4209
3: 8815
4: 19318
Right 1083495189 11:63045866-63045888 CCCCATTTATAAATGGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083495189 Original CRISPR CCCCATTTATAAATGGGCAA AGG Intergenic
No off target data available for this crispr