ID: 1083499333

View in Genome Browser
Species Human (GRCh38)
Location 11:63088938-63088960
Sequence CAGGGACACCAATTTATCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 636}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083499333_1083499338 6 Left 1083499333 11:63088938-63088960 CCTACGATAAATTGGTGTCCCTG 0: 1
1: 0
2: 2
3: 55
4: 636
Right 1083499338 11:63088967-63088989 ATGGGCAGAATGAACCAAACTGG 0: 1
1: 0
2: 1
3: 26
4: 256
1083499333_1083499340 21 Left 1083499333 11:63088938-63088960 CCTACGATAAATTGGTGTCCCTG 0: 1
1: 0
2: 2
3: 55
4: 636
Right 1083499340 11:63088982-63089004 CAAACTGGAAAACACACTTCAGG 0: 7
1: 139
2: 772
3: 2223
4: 6806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083499333 Original CRISPR CAGGGACACCAATTTATCGT AGG (reversed) Intronic
900699484 1:4035484-4035506 CAGGAACACCAATTATTCTTAGG - Intergenic
901335634 1:8446610-8446632 CAGGCACACCAATCAAACGTAGG + Intronic
902964953 1:19994171-19994193 TAGGGACCCCAATCAATCGTAGG + Intergenic
906910660 1:49945082-49945104 CAGGAACACCAATTATTCTTAGG - Intronic
907015341 1:51006739-51006761 CAGGTACACCAATCAAACGTAGG - Intergenic
907565793 1:55432082-55432104 CAGGTACACCAGTCAATCGTAGG - Intergenic
908598121 1:65710171-65710193 CAGGTACACCAATCAATTGTAGG + Intergenic
909276170 1:73689669-73689691 CAGGTACACCAATCAATTGTAGG + Intergenic
909536271 1:76740272-76740294 TAGGTACACCAATTGAACGTAGG + Intergenic
909689991 1:78396864-78396886 CAGGTACACCAATCAAACGTAGG + Intronic
909981337 1:82105020-82105042 CAGGAACACCAATTATTCTTAGG + Intergenic
910323614 1:85977745-85977767 CAGGAACACCAATTATTCTTAGG - Intronic
910618709 1:89229392-89229414 CAGGTACACCAATCAAACGTAGG + Intergenic
910627070 1:89318120-89318142 CAGGGACCCCAATCAATTGTAGG - Intergenic
910919440 1:92328279-92328301 CAGGAACACCAATTATTCTTAGG + Intronic
911322581 1:96433290-96433312 CAGGAACACCAATTATTCTTAGG + Intergenic
911530842 1:99041075-99041097 CAGGGACCCCAATCAATCATAGG - Intergenic
911938429 1:104010800-104010822 CAGGTATACCAATTAATCATAGG + Intergenic
912180963 1:107219036-107219058 CAGGAACACCAATTATTCCTAGG + Intronic
912676056 1:111681714-111681736 CAGGTATACCAATCAATCGTAGG - Intronic
913020894 1:114788945-114788967 CAGGTACCCCAATCAATCGTAGG + Intergenic
913143267 1:115962924-115962946 CAGGAACACCAATTATTCTTAGG - Intergenic
913151488 1:116048099-116048121 CAGGAACACCAATTATTCTTTGG - Intronic
913236327 1:116786413-116786435 CAGGAACACCAATTATTCTTAGG - Intergenic
913522534 1:119659429-119659451 GAGGGACACCAAATTATCTAGGG + Intergenic
913972912 1:143429508-143429530 CAGGTACACCAATTAATCTTAGG + Intergenic
914067296 1:144255115-144255137 CAGGTACACCAATTAATCTTAGG + Intergenic
914111857 1:144711239-144711261 CAGGTACACCAATTAATCTTAGG - Intergenic
914399563 1:147305336-147305358 CAGGTACACCAATCAATCGTAGG - Intergenic
914404762 1:147359478-147359500 CAGGTACACCAATCAATTGTAGG - Intergenic
914966986 1:152268773-152268795 CAGGTACACCAATCAATCATAGG + Intergenic
914969386 1:152293344-152293366 CAGGTACACCAATCAATCATAGG - Intergenic
915663768 1:157425775-157425797 CAGGTACACCAGTCCATCGTAGG - Intergenic
916916254 1:169409403-169409425 CAGGTACACCAATCAAACGTAGG - Intronic
917011606 1:170480675-170480697 CAGGGATACCAATGAATCATAGG + Intergenic
917357913 1:174145382-174145404 CAGGTACACCAATCAAACGTAGG - Intergenic
917383197 1:174437582-174437604 CAGGTACACCAATTACACGTAGG - Intronic
918360237 1:183750187-183750209 CAGGTACACCAATCAAACGTAGG + Intronic
919281385 1:195494350-195494372 CAGGAACACCAATTATTCTTAGG + Intergenic
919397641 1:197070488-197070510 CAGGAACACCAATTATTCTTAGG - Intergenic
920625170 1:207589972-207589994 CAGGTACACCAATCAAACGTAGG - Intronic
921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG + Intronic
921626344 1:217381160-217381182 CAGGTACACCAATGAAACGTAGG - Intergenic
922066366 1:222147286-222147308 CAGGTACACCAATCAAACGTAGG - Intergenic
922253267 1:223869772-223869794 CAGGTACACCAATCAATCATAGG + Intergenic
922379865 1:225012588-225012610 CAGGTACACCAATCAAACGTAGG + Intronic
923874836 1:238035780-238035802 CAGGAACACCAATTATTCTTAGG - Intergenic
923960984 1:239083801-239083823 CAGGAACACCAATTATTCTTAGG + Intergenic
924483581 1:244458998-244459020 CAGGAACTCCAAGTTATCTTGGG + Intronic
1063095573 10:2905777-2905799 CTGGGACACCCATTAATTGTTGG + Intergenic
1063338145 10:5236283-5236305 CAGGTACACCAATCTAATGTAGG - Intergenic
1063561159 10:7129445-7129467 CAGCAACACCAATTTTTCTTAGG + Intergenic
1064789336 10:18938148-18938170 CAGGTACACCAATCAAACGTAGG + Intergenic
1064908002 10:20369133-20369155 CAGGAACACCAATTATTCTTAGG + Intergenic
1065907802 10:30273624-30273646 CAGGGACCCCAATCAATCATAGG - Intergenic
1066747227 10:38612783-38612805 CAGGTACACCAATTAGTCTTAGG - Intergenic
1068516869 10:58035970-58035992 CAGGTACACCAATCAAACGTAGG + Intergenic
1068575307 10:58677561-58677583 CAGGTACACCAATCAAACGTAGG - Intronic
1069146228 10:64895368-64895390 CAGGAACACCAATTATTCTTAGG + Intergenic
1070213329 10:74348927-74348949 CAGGTACACCAATCAATCATAGG - Intronic
1071001866 10:80840378-80840400 CAGGGACCCCAATCAATTGTAGG + Intergenic
1071356989 10:84807111-84807133 CAGGAACCCCAAGTTATCTTGGG - Intergenic
1071761424 10:88611783-88611805 CAGGGACACCAATTATTCTTAGG - Intergenic
1071910779 10:90230371-90230393 CAGGAACACCAATTATTCTTAGG - Intergenic
1072381631 10:94878506-94878528 CAGGAACACCAATTATTCTTAGG + Intergenic
1072815032 10:98499018-98499040 CAGGAACACCAATTATTCTTAGG - Intronic
1074136029 10:110627048-110627070 CAGGGACACCAAGGTGTTGTTGG + Intergenic
1074807995 10:117073226-117073248 CAGGAACACCAATTATTCTTAGG - Intronic
1076376015 10:129985519-129985541 CAGGAACACCAATTATTCTTAGG - Intergenic
1076402220 10:130191700-130191722 CAGGGACACTCATTCAGCGTAGG - Intergenic
1078100741 11:8328979-8329001 CAGGGACACAAATGAATCATCGG - Intergenic
1078751271 11:14166000-14166022 CAGGAACCCCAAGTTATCTTGGG - Intronic
1079316691 11:19413438-19413460 CAGGTACACCAATCAAACGTAGG - Intronic
1079868059 11:25759820-25759842 CAGGTACACCAATCAAACGTAGG - Intergenic
1080672410 11:34393698-34393720 CAGGAACACCAATTATTCTTAGG + Intergenic
1081166203 11:39811483-39811505 CAGGTACACCAATCAATCATAGG - Intergenic
1083499333 11:63088938-63088960 CAGGGACACCAATTTATCGTAGG - Intronic
1085850233 11:80110857-80110879 CAGGTACTCCAATCAATCGTAGG - Intergenic
1086315556 11:85588313-85588335 CAGGAACACCAATTATTCTTGGG + Intronic
1086422064 11:86646565-86646587 CAGGTACACCAATCAAACGTAGG - Intronic
1086513985 11:87590474-87590496 CAGGTACACCAATCAATTGTAGG - Intergenic
1086844558 11:91732124-91732146 CAGGAACACCAATTATTCTTAGG - Intergenic
1087427930 11:98013884-98013906 CAGGTACACCAATCAATCATGGG - Intergenic
1087639721 11:100743690-100743712 CAGGAACACCAGTTTTTCTTAGG + Intronic
1087695154 11:101368420-101368442 CAGGTACACCAATCTAACATAGG + Intergenic
1087830827 11:102818516-102818538 CAGGTACACCAATCAAACGTAGG + Intergenic
1087907825 11:103719925-103719947 CAGGAACACCAATTATTCCTAGG - Intergenic
1088017271 11:105076186-105076208 CAGGAGCTCCAATTTATCTTGGG + Intronic
1088387362 11:109274571-109274593 CAGGAACACCAATTATTCTTAGG + Intergenic
1089765876 11:120765084-120765106 CAGGTACACCAATCAAACGTAGG + Intronic
1090545391 11:127760572-127760594 CAGGAACACCAATTATTCTTAGG - Intergenic
1090688360 11:129150186-129150208 CAGGAACACCTATTTTTCTTAGG - Intronic
1091213373 11:133883886-133883908 CAGGTATACCAATCAATCGTAGG + Intergenic
1092060186 12:5543916-5543938 CAGGAACACCAATTATTCTTAGG - Intronic
1092320876 12:7473088-7473110 CAGGTACACCAATCAATCATAGG - Intronic
1092604498 12:10103669-10103691 CAGGAACACCAATTATTCTTAGG - Intronic
1093105020 12:15075760-15075782 CAGGAACACCAATTATTCTTTGG - Intergenic
1093172726 12:15877064-15877086 CAGGAACACCAATTCTTCTTAGG - Intronic
1093409086 12:18843885-18843907 CAGGAACACCAATTATTCTTAGG + Intergenic
1093599057 12:21000126-21000148 CAGGAACACCAATTATTCTTAGG + Intergenic
1093835458 12:23823743-23823765 CAGGTACACCAATCAAACGTAGG + Intronic
1094060923 12:26314942-26314964 CAGGTACACCAATAAATCGTAGG + Intergenic
1094100374 12:26755893-26755915 CAGGAACCCCAAGTTATCTTGGG + Intronic
1094579162 12:31718045-31718067 CAGGTACACCAATCAATCGTAGG + Intronic
1095176419 12:39096978-39097000 CAGGAACACCAATTATTCTTAGG - Intergenic
1095406446 12:41871666-41871688 CAGGTACACCAATCAAGCGTAGG - Intergenic
1095831334 12:46590304-46590326 CAGGGACCCCAATCAATTGTAGG + Intergenic
1095920471 12:47525210-47525232 CAGGTACACCAATCAATTGTAGG + Intergenic
1096348019 12:50867492-50867514 CAGGAACACCAATTATTCTTAGG - Intronic
1097488581 12:60236162-60236184 CAGGTACACCAATCAAACGTAGG - Intergenic
1097619659 12:61924102-61924124 CAGGTACACCAATGAAACGTAGG - Intronic
1098654590 12:73012177-73012199 CAGGAACACCAATTATTCTTAGG + Intergenic
1098707036 12:73703832-73703854 CAGGTACACCAATCCATCATAGG - Intergenic
1098780309 12:74677843-74677865 CAGGTACACCAATCTAACATAGG - Intergenic
1098982543 12:76973191-76973213 CAGGTACACCGATTAATCTTAGG + Intergenic
1099344399 12:81480035-81480057 CAGGTACACCAATCAAACGTAGG + Intronic
1099809070 12:87557685-87557707 CAGGTACACCAATCAATTGTAGG - Intergenic
1101472513 12:105012118-105012140 CAGGTACACCAATCAAACGTAGG + Intronic
1101595999 12:106164960-106164982 CAGGTACACCAATCAATCATAGG - Intergenic
1101783492 12:107860877-107860899 CAGGTACACCAATCAAACGTAGG - Intergenic
1103169008 12:118797761-118797783 CAGGTACACCAATCAATCGGAGG + Intergenic
1103760967 12:123250001-123250023 CAGGAACACCAATTATTCTTAGG + Intronic
1105286151 13:19006350-19006372 CAGGTACACCAATCAATTGTAGG + Intergenic
1105316628 13:19271344-19271366 GAGGTACACCAATCTATCATAGG - Intergenic
1105350005 13:19606429-19606451 CAGGGACACCCTTTTGTCTTGGG - Intergenic
1105769567 13:23595623-23595645 CAGGGACACCAATAAAATGTAGG - Intronic
1106874158 13:34054180-34054202 CAGGTACACCAATCAATCATAGG + Intergenic
1107289665 13:38838588-38838610 CAGGTACACCAATCAAACGTAGG + Intronic
1107473309 13:40711494-40711516 CAGGTACACCAATCAAACGTAGG + Intergenic
1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG + Intergenic
1108523891 13:51268880-51268902 CAGGAACACCAAGTTATCAGAGG + Intronic
1108791611 13:53975088-53975110 CAGGAACACCAATTATTCTTAGG - Intergenic
1108998456 13:56764651-56764673 CAGGTACACCAATCAAACGTAGG - Intergenic
1109034005 13:57231439-57231461 CAGGTACACCAATCAAACGTTGG - Intergenic
1109058185 13:57579988-57580010 CAGGAACACCAATTATTCTTAGG + Intergenic
1109346106 13:61116480-61116502 CAGGAACCCCAAGTTATCTTGGG + Intergenic
1109457308 13:62610119-62610141 CAGGTACACCAATCAAACGTAGG + Intergenic
1110375847 13:74793217-74793239 CAGGAACACCAATTATTCTTAGG + Intergenic
1111148614 13:84217926-84217948 CAGGAACACCAATTATTCTTAGG - Intergenic
1112068745 13:95824415-95824437 CAGGAACACCAATTATTCTTAGG + Intronic
1112231754 13:97594722-97594744 CAGGTACACCAATTAATCATAGG - Intergenic
1112945460 13:104921347-104921369 CAGGAACACCAATTATTCTTAGG - Intergenic
1113240431 13:108330327-108330349 CAGGAACACCAATTATTCTTAGG - Intergenic
1113330345 13:109320470-109320492 CAGGAAAACCAATTAATCTTAGG - Intergenic
1113845494 13:113387435-113387457 CAGGAACACCAATTATTCTTAGG + Intergenic
1114133387 14:19819313-19819335 CAGGTACACCAATCAAACGTAGG + Intronic
1114360684 14:21968811-21968833 CAGGTACACCAATCAAACGTAGG - Intergenic
1114694179 14:24611333-24611355 CAGGAACACCAATTATTCTTAGG + Intergenic
1114817822 14:25980682-25980704 CAGGTACACCAATCAAACGTAGG - Intergenic
1115124355 14:29973850-29973872 CAGGTACACCAATCAATCATAGG - Intronic
1115281356 14:31667177-31667199 CAGGTACACCAATCAATCGTAGG + Intronic
1115295112 14:31817186-31817208 CAGGTACACCAATGAAACGTAGG - Intronic
1115339236 14:32274213-32274235 CAGGTACATCAATCAATCGTAGG - Intergenic
1115357323 14:32462093-32462115 CAGGTACACCAATCAATCATAGG - Intronic
1115867070 14:37759627-37759649 CAGGTATACCAATCAATCGTAGG + Intronic
1115890678 14:38024682-38024704 CAGGGACACCAATGAGTCATAGG - Intronic
1115974252 14:38979815-38979837 CAGGTACACCAATCGAACGTAGG + Intergenic
1116044744 14:39731087-39731109 CAGCGACACCAATTATTCTTAGG + Intergenic
1116771308 14:49130398-49130420 CAGGCACACCAATCAAACGTAGG + Intergenic
1116781935 14:49245622-49245644 CAGGTACACCAATGAATCGTAGG - Intergenic
1117509996 14:56441738-56441760 CAGGTACACCAATTATTCGTAGG + Intergenic
1118140064 14:63071242-63071264 CAGGAACACCAATTATTCTTAGG + Intronic
1118535534 14:66759230-66759252 CAGGAACCCCAAGTTATCTTGGG - Intronic
1118926848 14:70198898-70198920 CAGGTACACCAATCAATTGTAGG + Intergenic
1120565189 14:86046964-86046986 CAGGTACACCAATCAAACGTAGG + Intergenic
1120777180 14:88450921-88450943 CAGGAACACCAATTATTCTTAGG + Intronic
1122771125 14:104098446-104098468 CAGGGACTCCCATTCACCGTGGG + Intronic
1123576471 15:21675122-21675144 CAGGTACACCAATCAAACGTAGG + Intergenic
1123613095 15:22117590-22117612 CAGGTACACCAATCAAACGTAGG + Intergenic
1124419346 15:29506271-29506293 TAGGTACACCAATCAATCGTAGG - Intronic
1124894109 15:33759658-33759680 CAGGTACACCAATCAAACGTAGG - Intronic
1126264890 15:46742527-46742549 CAGGTACACCAATCAAACGTAGG - Intergenic
1126333386 15:47558745-47558767 CAGGGAAACCCATTTATTGAAGG - Intronic
1126460636 15:48912208-48912230 CAGGAACACCAATTATTCTTAGG + Intronic
1126470604 15:49006375-49006397 CAGGTACACCAATCTAACGTAGG + Intronic
1126554236 15:49967637-49967659 CAGGTACACCAATGAAACGTAGG - Intronic
1127036368 15:54922754-54922776 CAGGAACACCAATTATTCTTAGG + Intergenic
1127056441 15:55136718-55136740 CAGGTACACCAATTAAAGGTAGG - Intergenic
1127373888 15:58364418-58364440 CAGGTACACCAATCAAACGTAGG - Intronic
1128857352 15:71030644-71030666 CAGGTACACCAATCAATCGTAGG + Intronic
1129097457 15:73224433-73224455 CAGGAACACCAATTATTCTTAGG + Intronic
1129138639 15:73576652-73576674 CAGGAACCCCAAGTTATCTTGGG + Intronic
1202985339 15_KI270727v1_random:409367-409389 CAGGTACACCAATCAAACGTAGG + Intergenic
1133080166 16:3312357-3312379 CAGGGACTCCACTGTATGGTAGG - Intronic
1136659707 16:31746742-31746764 CAGGTACTCCAATCAATCGTAGG + Intronic
1136735839 16:32466863-32466885 CAGGTACACCAATTAGTCTTAGG + Intergenic
1137324857 16:47424056-47424078 CAGGTACACCAATCAAACGTAGG + Intronic
1138706315 16:58919297-58919319 CAGGTACACCAATCAAACGTAGG + Intergenic
1139831027 16:69798421-69798443 CATCATCACCAATTTATCGTTGG - Intronic
1140165405 16:72545050-72545072 CAGGTACACCAATCAAACGTAGG - Intergenic
1203017236 16_KI270728v1_random:362711-362733 CAGGTACACCAATTAGTCTTAGG - Intergenic
1203035571 16_KI270728v1_random:635869-635891 CAGGTACACCAATTAGTCTTAGG - Intergenic
1143826478 17:9612355-9612377 GAAGGACACCAGTTTCTCGTAGG + Exonic
1146746519 17:35335272-35335294 CAGGAACACCAATTTTTCTTAGG + Intergenic
1148403097 17:47385271-47385293 CAGGGACCCTAATCAATCGTAGG + Intronic
1149122255 17:53183998-53184020 CAGGAACACCAATTATTCTTAGG + Intergenic
1149168464 17:53781501-53781523 CAGGTACACCAATCAATCATAGG - Intergenic
1149483844 17:57025628-57025650 CAGGGTCCCCAAGTTATCTTGGG - Intergenic
1150528789 17:65954880-65954902 CAGGAACACCAATTATTCTTAGG - Intronic
1151008803 17:70469619-70469641 CAGGAGCAACAATTTATCTTAGG + Intergenic
1151048521 17:70948963-70948985 CAGGAACACCAATTATTCTTAGG - Intergenic
1153069352 18:1088170-1088192 CAGGAACACCAATTATTCTTAGG + Intergenic
1154090148 18:11350587-11350609 CAGGAACACCAATTATTCTTAGG - Intergenic
1156667621 18:39426754-39426776 CAGGAACACCAATTATTCCTAGG - Intergenic
1157541000 18:48506560-48506582 CAGGAACACCAATTATTCTTAGG - Intergenic
1157703156 18:49778166-49778188 CAGGAACACCAATTATTCTTAGG + Intergenic
1158377375 18:56885998-56886020 CAGGAACACCAATTATTCTTAGG - Intronic
1158398886 18:57103082-57103104 CAGGTACACCAATCAAACGTAGG + Intergenic
1160490229 18:79331533-79331555 AAGGGACAACAATTTATCCAAGG - Intronic
1164047336 19:21553952-21553974 CAGGTACACCAATCAATCATAGG + Intronic
1164320048 19:24136408-24136430 CAGGAACACCAATTATTCTTAGG + Intergenic
1165270055 19:34698119-34698141 CAGGGACCCCAGTCAATCGTTGG - Intergenic
1166827103 19:45616512-45616534 CACGTACACCAAGTTGTCGTGGG + Exonic
1167844610 19:52151379-52151401 CAGGAACTCCAAGTTATCTTGGG + Intergenic
1168488730 19:56788775-56788797 CAGGTACACCAATCAAACGTAGG + Intronic
1168530699 19:57126385-57126407 CAGGTATACCAATCAATCGTAGG + Intronic
924992716 2:327666-327688 CAGGAACACCAATTATTCTTAGG + Intergenic
925245156 2:2376056-2376078 CAGGTACACCAATCAAACGTAGG + Intergenic
925467411 2:4119648-4119670 CAGGTACACCAATCAAACGTAGG + Intergenic
926483292 2:13426419-13426441 CAGGTACACCAATCAATCATAGG + Intergenic
926560315 2:14409523-14409545 CAGGAACACCAATTATTCTTAGG - Intergenic
927069805 2:19516081-19516103 CAGGGATACCAATTATTCTTAGG + Intergenic
928249522 2:29662798-29662820 CAGGCACACAAATTTCTCTTGGG - Intronic
928479981 2:31673758-31673780 CAGAAACACCAATTTTTCTTAGG + Intergenic
928488431 2:31755869-31755891 CAGGAACACCAATCAAACGTAGG - Intergenic
928880331 2:36089906-36089928 CAGGTACACCAGTCAATCGTAGG - Intergenic
929064597 2:37961316-37961338 CAGGTACACCAATCAAACGTAGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930574170 2:53126204-53126226 CAGGAACACCAATTATTCTTAGG + Intergenic
930925944 2:56817965-56817987 CAGGTACACCAATCAATCGTAGG - Intergenic
931211944 2:60205966-60205988 CAGGTACACCAATCAAACGTAGG + Intergenic
931548015 2:63409900-63409922 CAGGAACACCAATTATTCTTAGG - Intronic
933166489 2:79082381-79082403 CAGGTACACCAATCAAACGTAGG + Intergenic
933318047 2:80738343-80738365 CAGGTACACCAATCAATTGTAGG - Intergenic
934177608 2:89590464-89590486 CAGGTACACCAATTAATCTTAGG + Intergenic
934187003 2:89755974-89755996 CAGGTACACCAATTAGTCTTAGG + Intergenic
934287907 2:91664765-91664787 CAGGTACACCAATTAATCTTAGG + Intergenic
934309987 2:91853200-91853222 CAGGTACACCAATTAGTCTTAGG - Intergenic
935399589 2:102645816-102645838 CAGGCACACCAATCAATCATAGG - Intronic
935788779 2:106571806-106571828 CAGGGAGATCAAATTATTGTTGG + Intergenic
936769382 2:115893704-115893726 CAGGTACACCAATCAAACGTAGG + Intergenic
937526272 2:122773574-122773596 CAGGGACCCCAATCTATCGTAGG - Intergenic
937781839 2:125847799-125847821 CAGGAACACCAATTATTCTTAGG + Intergenic
938567958 2:132537671-132537693 CAGGTACACCAATCAATCGTAGG + Intronic
938599576 2:132823072-132823094 CAGGGACATCAATTATTCTTAGG - Intronic
939247983 2:139649643-139649665 CAGGTACACCAATCTATTGTAGG - Intergenic
940034571 2:149300692-149300714 CAGGAACACCAATTTTTCTTAGG + Intergenic
940387367 2:153089598-153089620 CAGGAACACCAATTATTCTTTGG + Intergenic
940475127 2:154152559-154152581 CAGGTACACCAATCAAACGTAGG + Intronic
940564993 2:155350137-155350159 AAGGTACACCAATCAATCGTAGG + Intergenic
941088392 2:161145950-161145972 CAGGTACTCCAATCAATCGTAGG + Intronic
941149106 2:161891423-161891445 CAGGTACACCAATCAAACGTAGG + Intronic
941244816 2:163083678-163083700 CAGGAACCCCAAGTTATCTTGGG + Intergenic
941518560 2:166510203-166510225 CCGGTACACCAATCAATCGTAGG + Intergenic
941590096 2:167409378-167409400 CAGGTACGCCAATTAATCATAGG + Intergenic
942726176 2:179010167-179010189 CAGGAACACCAATTATTCTTAGG - Intronic
942898917 2:181090735-181090757 CAGGTACACCAATCAAACGTAGG - Intergenic
942928244 2:181457998-181458020 CAGGGAAACTAACTTATCTTGGG + Intronic
943047501 2:182875985-182876007 CAGGTACACCAATCAAACGTAGG - Intergenic
943074496 2:183178176-183178198 CAGGTACACCAATCAATCGTAGG + Intergenic
943836983 2:192525991-192526013 CAGGTACACCAATCAATCGTAGG - Intergenic
945131979 2:206583486-206583508 CAGGTACACCAATTATTCTTTGG + Intronic
945207384 2:207345963-207345985 CAGGTACACCAATCAAACGTAGG - Intergenic
945210724 2:207379818-207379840 CAGGTACACCAATCAATCATAGG + Intergenic
945481422 2:210350167-210350189 CAGGTACACCAATCAATCTTAGG + Intergenic
945487592 2:210416036-210416058 CAGGGACACCAATGAGTTGTAGG + Intergenic
945536418 2:211023998-211024020 CAGGTACACCAATTATTCTTAGG + Intergenic
945787820 2:214265218-214265240 CAGGAACTCAAATTTATTGTTGG - Intronic
947225698 2:227838309-227838331 CAGGTACACCAATCAAACGTAGG + Intergenic
948576862 2:238957665-238957687 CAGGAACACCAATTATTCTTAGG - Intergenic
948714170 2:239848454-239848476 CAGGAACACCAATTATTCTTGGG - Intergenic
948746405 2:240097309-240097331 CAGGAACACCAATTATTCTTGGG - Intergenic
1169319889 20:4623944-4623966 CAGGCACACCAATCAAACGTAGG + Intergenic
1169397781 20:5249945-5249967 CAGGGACACCAATCATTCTTAGG + Intergenic
1169960191 20:11151411-11151433 CAGGTACACCAATCAAACGTAGG + Intergenic
1170229237 20:14027085-14027107 CAGGTACACCAATCAAACGTAGG + Intronic
1170294391 20:14807957-14807979 CAGGTACACCAATCAATCGTAGG - Intronic
1170496746 20:16932138-16932160 CAGGTACTCCAATCAATCGTAGG - Intergenic
1171001010 20:21415350-21415372 CAGGTACACCAATCCAACGTAGG - Intergenic
1173806689 20:45930621-45930643 CAGGGACACCACTTGAACCTGGG - Intergenic
1175041102 20:56051375-56051397 CAGGTACACCAATCAAACGTAGG - Intergenic
1177174297 21:17688159-17688181 CAGGTACACCAATTTTTCTTAGG + Intergenic
1177511213 21:22090645-22090667 CAGGTACTCCAATCAATCGTAGG + Intergenic
1177943242 21:27436597-27436619 CAGGTACACCAATCAATCATAGG + Intergenic
1178393716 21:32220994-32221016 CAGGTACACCAATCAAACGTAGG - Intergenic
1178864284 21:36315295-36315317 CAGGTACACCAATCAAACGTAGG + Intergenic
1183182566 22:36270554-36270576 CAGGTACACCAATCAATTGTAGG + Intergenic
1183477989 22:38046463-38046485 CAGGGACACCCCTTCATCCTTGG - Intergenic
949222553 3:1653204-1653226 CAGGTACACCAATCAATCATAGG + Intergenic
949222655 3:1654451-1654473 CAGGTACACCAGTTAATCGTAGG - Intergenic
949262342 3:2117176-2117198 CGGGAACACCAATTTATAGCTGG - Intronic
949955208 3:9261713-9261735 CAGGTACACCAATCAAACGTAGG - Intronic
949997807 3:9632449-9632471 CAGGAACACCGAGTTATCTTGGG - Intergenic
951153594 3:19322814-19322836 CAGGAACACCAATTATTCTTAGG + Intronic
951262098 3:20522573-20522595 CAGGAACACCAATTATTCTTAGG + Intergenic
951414981 3:22413184-22413206 CAGGTACACCAATCAATCATAGG + Intergenic
951467937 3:23021874-23021896 CAGGAACACCAATTATTCTTAGG - Intergenic
951687446 3:25361106-25361128 CAGGTACACCAATCAAACGTAGG + Intronic
951832343 3:26944366-26944388 CAGGCACACCAATCAATTGTAGG - Intergenic
953276848 3:41509341-41509363 CAGGAACACCAATTATTCTTAGG - Intronic
953433509 3:42859039-42859061 CAGGTACACCAATCAAACGTAGG - Intronic
953613392 3:44467521-44467543 CAGGAACCCCAAGTTATCTTGGG + Intronic
955175497 3:56610198-56610220 CAGGAACACCAATTATTCTTAGG + Intronic
956157185 3:66311119-66311141 CGGGTACACCAATCAATCGTAGG + Intronic
956259464 3:67322750-67322772 CAGGGATACCATTTTATCTGTGG + Intergenic
956279515 3:67541529-67541551 CAGGTACACCAATCAAACGTAGG - Intronic
957008921 3:74983299-74983321 CAGGTACACCAATCAATCATAGG + Intergenic
957281602 3:78156994-78157016 CAGGGACACCAATTATTCTTAGG - Intergenic
957331508 3:78770201-78770223 CAGGTACACCAATTATTCTTAGG + Intronic
957596456 3:82273030-82273052 CAGGTACACCAATCAAACGTAGG + Intergenic
957921592 3:86755931-86755953 CAGGAACACCAATTATTCTTAGG + Intergenic
957971838 3:87391771-87391793 CAGGAACACCAATTATTCTTCGG - Intergenic
958013955 3:87915723-87915745 CAGGAACACCAATTATTCTTAGG - Intergenic
958088168 3:88839841-88839863 CAGGAACACCAATTATTCTTAGG + Intergenic
958505743 3:94974651-94974673 CAGGAACACCAATTATTCTTAGG - Intergenic
958790102 3:98642622-98642644 CAGGAACACCAATTATTCTTAGG + Intergenic
959092918 3:101923672-101923694 CAGGTACACCAATCAAACGTAGG + Intergenic
959279902 3:104324487-104324509 CAGGAACACCAATTATTCTTAGG - Intergenic
959453916 3:106535553-106535575 CAGGTACACCAATCAATCATAGG - Intergenic
959479515 3:106854398-106854420 CAGGTACACCAATCAATCGTAGG - Intergenic
959506072 3:107157510-107157532 CAGGTACACCAATCAATCATAGG - Intergenic
959828853 3:110835474-110835496 CAGGTACACCAATCAATCATAGG + Intergenic
960177443 3:114533503-114533525 CAGGTACACCAATGAAACGTAGG - Intronic
960654543 3:119988651-119988673 CAGGAATACCAAGTTATCTTGGG + Intronic
960712200 3:120542917-120542939 CAGGAACACCAATTATTCTTAGG + Intergenic
960769689 3:121179954-121179976 CAGGAACACCAATTATTCTTAGG - Intronic
962065877 3:131980319-131980341 CAGGAACACCAATTATTCTTAGG + Intronic
962504813 3:136035848-136035870 CAGGAACACCAATCAATCTTAGG + Intronic
962656110 3:137545212-137545234 CAGGTACACCAATCAAACGTAGG - Intergenic
963023458 3:140895989-140896011 CAGGGAAACCAATTATTCTTAGG + Intergenic
963998406 3:151738621-151738643 CAGGTACACCAATCTAACGTAGG + Intronic
964075800 3:152689799-152689821 CAGGAACACCAATTATTCTTAGG - Intergenic
964232644 3:154488314-154488336 CAGGTACACCAATCAAACGTAGG - Intergenic
964635751 3:158857136-158857158 CAGGAACACCAATTATTCTTAGG + Intergenic
964867500 3:161277324-161277346 CAGGAACACCAATTATTCTTAGG - Intergenic
965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG + Intergenic
965618577 3:170620266-170620288 CAGGTACACCAATCAAACGTAGG + Intronic
967715764 3:192759581-192759603 CAGGTATACCAATCTATCATAGG - Intronic
969901353 4:10353429-10353451 CAGGAACACCAATTATTCTTAGG + Intergenic
970217385 4:13774196-13774218 CAGGAACACCAATTATTCTTAGG + Intergenic
970549165 4:17162541-17162563 CAGGAACACCAATTATTCCTAGG + Intergenic
970658492 4:18259175-18259197 CAGGAACACCAATTATTCTTAGG + Intergenic
971673462 4:29594305-29594327 CAGGTACACCAATCAAACGTAGG + Intergenic
971813975 4:31463259-31463281 CAGGAACCCCAAATTATCTTGGG - Intergenic
972018562 4:34279379-34279401 CAGGAACACCAATTATTCTTAGG + Intergenic
972372303 4:38436828-38436850 CAGGCACACCAATCAATCATAGG + Intergenic
972500499 4:39673651-39673673 CAGGTACACCAATCAAACGTAGG + Intergenic
973069022 4:45834634-45834656 CAGGAACACCAATTATTCTTAGG + Intergenic
973321968 4:48818938-48818960 CAGGTACACCAATCAATTGTAGG - Intronic
973831377 4:54763460-54763482 CAGGAACACCAATTATTCTTAGG + Intergenic
974127266 4:57711261-57711283 CAGGAACACCAATTATTCTTAGG - Intergenic
974271640 4:59657449-59657471 CTGGTACACCAATTAATCATAGG - Intergenic
974801678 4:66827058-66827080 CAGGAACACCAATTATTCTTAGG + Intergenic
975178064 4:71310197-71310219 CAGGGACCCCAATCAATCATAGG - Intronic
975243672 4:72093454-72093476 CAGGAACACCAATTATTCTTAGG + Intronic
975375100 4:73633909-73633931 CAGGAACACCAATTATTCTTAGG - Intergenic
975484031 4:74914821-74914843 CAGGTACACCAATCAAACGTAGG + Intergenic
975614019 4:76228958-76228980 CAGGAACACCAATTATTCTTAGG + Intronic
975899042 4:79128411-79128433 CAGGGACACCAATGAGTCATAGG + Intergenic
976181509 4:82404083-82404105 CAGGCAGAGCAATTTATCCTTGG - Intergenic
976465019 4:85357361-85357383 CAGGAACACCAATTGTTCTTAGG + Intergenic
976716093 4:88123679-88123701 CAGGTACACCAATAAAACGTAGG - Intronic
976907767 4:90261722-90261744 CAGGAACACCAATTATTCTTAGG + Intronic
977733353 4:100381004-100381026 CAGGAACACCAATTATTCTTAGG - Intergenic
977762896 4:100760402-100760424 CAGGAACACCAATTAGTCTTAGG - Intronic
977828870 4:101565994-101566016 CAGGAACACCAATTATTCTTAGG - Intronic
977888034 4:102274465-102274487 CAGGTACACCAATCAAACGTAGG - Intronic
977897672 4:102382937-102382959 CAGGTACACCAATCAAACGTAGG + Intronic
977905834 4:102476790-102476812 CAGGGGCACCAATTATTCTTCGG - Intergenic
978664448 4:111165551-111165573 CAGGTACACCAATCAAACGTAGG - Intergenic
978726549 4:111976566-111976588 CAGGAACACCAATTATTCCTAGG + Intergenic
979434877 4:120675828-120675850 CAGGAACACCAATTATTCTTAGG - Intergenic
979498993 4:121417757-121417779 CAGGAACACCAATTATTCTTAGG + Intergenic
979554824 4:122033296-122033318 CAGGTACACCAATCAAACGTAGG + Intergenic
979591408 4:122484481-122484503 CAGGAACCCCAAGTTATCTTGGG - Intergenic
979705021 4:123710573-123710595 CAGGAACACCAATTATTCTTAGG - Intergenic
979965821 4:127075959-127075981 CAGGTACACCAATCAAACGTAGG + Intergenic
980087651 4:128408485-128408507 CAGGAACACCAATTATTCTTAGG + Intergenic
980100166 4:128534515-128534537 CAGGTACACCAATCAAACGTAGG + Intergenic
980157478 4:129125151-129125173 CAGGTACACCAATCAAACGTAGG + Intergenic
980494028 4:133568942-133568964 CAGGTACACCAATCAATCGTAGG + Intergenic
980633777 4:135472581-135472603 CAGGTACACCAATCAAACGTAGG + Intergenic
980861736 4:138507118-138507140 CAGGTACACCAATCAAACGTAGG + Intergenic
981133829 4:141188475-141188497 CAGGTACACCAACCAATCGTAGG + Intronic
981411409 4:144436442-144436464 CAGGTACACCAATCAAACGTAGG - Intergenic
981796406 4:148600129-148600151 CAGGAACACCAATTATTCTTAGG + Intergenic
982060116 4:151596650-151596672 CAGGTACACCAATTAAACATAGG + Intronic
982119469 4:152127982-152128004 CAGGAACACCAATTATTCTTAGG + Intergenic
982324038 4:154110295-154110317 CAGGTACACCAATCAAACGTAGG - Intergenic
982602908 4:157474246-157474268 CAGGAACACCATGTTATCTTGGG + Intergenic
982800173 4:159696519-159696541 CAGGAACACCAATTATTCTTAGG + Intergenic
983047322 4:163003343-163003365 CAGGTACACCAATTAAACATAGG + Intergenic
983331228 4:166332345-166332367 CAGGGACCCCAATCAATCATAGG + Intergenic
983760478 4:171399930-171399952 CAGAAACACCAAGTTATCTTGGG + Intergenic
983807695 4:172016187-172016209 CAGGGACACCAATTATTCTTAGG + Intronic
984008922 4:174347234-174347256 CAGGTACACCAATCAATCGTAGG + Intergenic
984493821 4:180469900-180469922 CAGGTACACCAATCAATCGTAGG - Intergenic
984721822 4:182979434-182979456 CAGGAACACCAATTATTCTTAGG - Intergenic
985008471 4:185558863-185558885 CAGGAACACCAATTATTCTTAGG + Intergenic
985204626 4:187521994-187522016 CAGGTACACCAATCAAACGTAGG - Intergenic
985326306 4:188775058-188775080 CAGGAACACCAATTATTCTTAGG + Intergenic
986484496 5:8221528-8221550 CAGGTACACCAATCAAACGTAGG - Intergenic
987656685 5:20816125-20816147 CAGGTACACCAATCAAACGTAGG - Intergenic
988289961 5:29271840-29271862 CAGGTACACCAATCAAACGTAGG - Intergenic
988725046 5:33918553-33918575 CAGGAACACCAATTATTCTTAGG + Intergenic
988766866 5:34387820-34387842 CAGGTACACCAATCAAACGTAGG + Intergenic
989533674 5:42538801-42538823 CAGGAACACCAATTATTCTTAGG + Intronic
989562649 5:42869805-42869827 CAGGAACACCAATTATTCTTAGG + Intronic
991414875 5:66381583-66381605 CAGGAACACCAATTATTCTTAGG - Intergenic
991924014 5:71685441-71685463 CAGGAACACCAATTATTCTTAGG - Intergenic
992335903 5:75769452-75769474 CAGGGACACCAATTATTCTTAGG + Intergenic
992723048 5:79579406-79579428 CAGGGATCCCAAGTTATCTTGGG + Intergenic
993587174 5:89745841-89745863 CAGGTACTTCAATTAATCGTAGG + Intergenic
993812256 5:92495949-92495971 AAGAGACACCAGTTGATCGTAGG + Intergenic
994015191 5:94956782-94956804 CAGGTACACCAATCAAACGTAGG - Intronic
994220683 5:97191903-97191925 CAGGAACACCAATTATTCTTGGG + Intergenic
994330002 5:98493333-98493355 CAGGAACACCAATTATTCTTAGG - Intergenic
994344674 5:98670124-98670146 CAGGTACTCCAATCAATCGTAGG - Intergenic
994398948 5:99255445-99255467 CAGGAACACCAATTATTCTTAGG + Intergenic
994642113 5:102422638-102422660 CAGGTACACCAATCAATCATAGG - Intronic
994802431 5:104396278-104396300 CAGGTACACCAATCAATCATAGG - Intergenic
994883491 5:105528644-105528666 CAGGAACACCAATTATTCTTAGG + Intergenic
995326070 5:110891680-110891702 CAGGTACACCAATCAAACGTAGG + Intergenic
995472868 5:112522237-112522259 CAGGAACACCAATTATTCTTAGG + Intergenic
995587671 5:113665067-113665089 CAGGAACACCAATTATTCTTAGG - Intergenic
995727501 5:115196960-115196982 CAGGAACACCAATTATTCTTAGG - Intergenic
995785757 5:115825788-115825810 CAGGGACCCCAGTCAATCGTAGG + Intergenic
995803788 5:116028765-116028787 CAGGGAAATCATTTTATAGTTGG - Intronic
996033031 5:118727941-118727963 CAGGTACACCAATCAAACGTAGG - Intergenic
996242665 5:121222447-121222469 CAGGTACACCAATCAATTGTAGG - Intergenic
996427348 5:123329269-123329291 CAGGAACACCAATTATTCTTAGG + Intergenic
996631972 5:125643790-125643812 CAGGAACACCAATTTTTCTTAGG - Intergenic
996780113 5:127176435-127176457 CAGGAACACCAATTAATCTTAGG + Intergenic
997004963 5:129805729-129805751 CAGGAACACCAATTATTCTTAGG + Intergenic
997030621 5:130123488-130123510 CAGTGACATCAAATTATCATAGG - Intronic
997217695 5:132128035-132128057 CAGGTACACCCATTAATTGTAGG + Intergenic
997647883 5:135493049-135493071 AAGTGACACCAGTTTATTGTGGG - Intergenic
998940988 5:147281624-147281646 CAGGGACACCCATTATTCTTAGG - Intronic
999468811 5:151832663-151832685 CAGGTACACCAACTGAACGTAGG - Intronic
999489685 5:152037970-152037992 CAGGTACACCAATCAAACGTAGG + Intergenic
999502217 5:152158911-152158933 CAGGTACACCAACCAATCGTAGG + Intergenic
999602733 5:153284427-153284449 CAGGTACACCAATAAATCATAGG - Intergenic
999930653 5:156430138-156430160 CAGGAACACCAATTATTCTTAGG + Intronic
1000237805 5:159378658-159378680 CAGGAACACCAATTATTCTTAGG - Intergenic
1000511482 5:162189146-162189168 CAGGAACACCAATTATTCTTAGG + Intergenic
1000525517 5:162352825-162352847 CAGGAACACCAATTATTCTTAGG + Intergenic
1000548219 5:162627252-162627274 CAGGGACCCCAATCAATCGTAGG - Intergenic
1001177022 5:169479884-169479906 CAGGAACACCAATTATTCTTAGG + Intergenic
1001355750 5:171021399-171021421 CAGGTACACCAATCAAACGTAGG + Intronic
1002287225 5:178172118-178172140 CAGGAACCCCAAGTTATCTTGGG - Intergenic
1002673693 5:180891213-180891235 CAGGTACACCAATCAAACGTAGG - Intergenic
1004065360 6:12238639-12238661 CATGGACATCTAGTTATCGTAGG + Intergenic
1004597639 6:17115527-17115549 CAGGGAAAACAGTTTATTGTAGG - Intronic
1004781475 6:18913338-18913360 CAGGGACACAAATGTCTCTTTGG + Intergenic
1004944314 6:20595298-20595320 CAGGTACACCAATCAAACGTAGG + Intronic
1005208383 6:23431389-23431411 CAGGGACAACAATCAAACGTAGG + Intergenic
1005376135 6:25184662-25184684 CAGGGACTCCAAATAATCATAGG + Intergenic
1005780878 6:29190643-29190665 CAGGTACACCAATCAAACGTAGG + Intergenic
1006200156 6:32281040-32281062 CAGGTACACCGATCAATCGTAGG - Intergenic
1008185651 6:48387473-48387495 CAGGAACACCAATTTTTCAAAGG + Intergenic
1008283078 6:49619188-49619210 CAGGGACAGAAATTTAACATTGG - Exonic
1008305461 6:49893448-49893470 CAGGAACACCAATTATTCTTAGG - Intergenic
1008758199 6:54823298-54823320 CAGGTACACCAATCAATCATAGG + Intergenic
1008781381 6:55109737-55109759 CAGGAACACCAATTATTCTTAGG - Intronic
1009193937 6:60662576-60662598 CAGGTACACCAATCAATCATAGG + Intergenic
1009968972 6:70606013-70606035 CAGGAACACCAATTATTCTTAGG - Intergenic
1010801745 6:80185060-80185082 CAGGAACACCAATTATTCTTAGG + Intronic
1010879638 6:81152019-81152041 CAGGAACACCAATTATTCTTAGG - Intergenic
1011005385 6:82638628-82638650 CAGGAACACCAATTATTCTTAGG - Intergenic
1011093375 6:83632513-83632535 CAGGAACACCAATTATTCTTAGG + Intronic
1011319843 6:86079452-86079474 CAGGAACACCAATTATTCTTAGG + Intergenic
1011394754 6:86894371-86894393 CAGGAACACCAATTATTCTTAGG - Intergenic
1012273434 6:97243199-97243221 CAGGAACACCAATTATTCTTAGG + Intronic
1012498060 6:99856644-99856666 CAGGTACACCAATCGATCATGGG - Intergenic
1012596967 6:101052783-101052805 CAGGTACACCAATGAAACGTAGG + Intergenic
1012793938 6:103735759-103735781 CAGGAACACCAATTATTCTTAGG - Intergenic
1013682750 6:112542869-112542891 CAGGTACACCAATCAAACGTAGG - Intergenic
1014070535 6:117176391-117176413 CAGGTACACCAATCAAACGTAGG - Intergenic
1014122969 6:117747108-117747130 CAGGTACACCAATCAAACGTAGG - Intergenic
1014225148 6:118839051-118839073 CAGGTACACCAATCAATCGTAGG + Intronic
1014285101 6:119488090-119488112 CAGGTACACCAATTTTTCTTAGG - Intergenic
1014569191 6:122987712-122987734 CAGGTACACCAATCAAACGTAGG - Intergenic
1014864172 6:126507074-126507096 CAGGTACTCCAATCAATCGTAGG - Intergenic
1015222284 6:130817784-130817806 CAGGAACACCAATTATTCTTAGG - Intergenic
1015433062 6:133153689-133153711 CAGGTACCCCAATCAATCGTAGG + Intergenic
1015623232 6:135154963-135154985 CAGGTACACCAATCAAACGTAGG + Intergenic
1015802226 6:137071648-137071670 CAGGTACACCAATCAAACGTAGG - Intergenic
1015849651 6:137559088-137559110 CAGGAACACCAATTATTCTTAGG + Intergenic
1015883128 6:137890014-137890036 CAGGTACACCAATCAAACGTTGG + Intergenic
1016176067 6:141078870-141078892 CAGGAACACCAATTATTCTTAGG - Intergenic
1016289837 6:142517242-142517264 CAGGAACACCAATTATTCTTAGG + Intergenic
1016351618 6:143175428-143175450 CAGGAACACCAATTATTCTTAGG + Intronic
1017214805 6:151898317-151898339 CAGGAACACCAATTATTCTTAGG + Intronic
1017279770 6:152610508-152610530 CAGGTACACCAATCAAACGTAGG - Intronic
1018009540 6:159656792-159656814 CAGGAATACCAATTAATCTTAGG - Intergenic
1018094379 6:160372623-160372645 CAGGTACACCAATCAAACGTAGG + Intronic
1018114552 6:160570997-160571019 CAGGTACACCAATCAAACGTAGG + Intronic
1018507692 6:164489583-164489605 CAGGTACATCAATTTATTGTAGG + Intergenic
1018596861 6:165489961-165489983 CAGGAACACCAATTATTCTTAGG - Intronic
1018797505 6:167198515-167198537 CAGGGACCCCAATTAATTGTAGG + Intergenic
1018805962 6:167259806-167259828 CAGGTACACCAATCAATCATAGG - Intergenic
1019123267 6:169822431-169822453 CAGGAACACCAATTATTCTTAGG + Intergenic
1020169134 7:5831587-5831609 CAGGGACAGGAATATATCCTGGG - Intergenic
1020259258 7:6521493-6521515 CATGGACACCACCTTGTCGTGGG + Exonic
1020367085 7:7392602-7392624 CAGGTACACCAATCAAACGTAGG + Intronic
1020373881 7:7463049-7463071 CAGGAACACCAATTATTCTTAGG - Intronic
1020608465 7:10366359-10366381 CAGGTACACCAATCAATTGTAGG + Intergenic
1020633640 7:10671053-10671075 CAGGTACTCCAATTAATCATAGG + Intergenic
1020753264 7:12169490-12169512 CAGGTACACCAATCAAACGTAGG + Intergenic
1021081664 7:16372065-16372087 CAGGCACACCAATTATTCTTAGG - Intronic
1021322466 7:19228377-19228399 CAGGTACACCAATCAAACGTAGG - Intergenic
1022848306 7:34234160-34234182 CAGGTACACCAATCAAACGTAGG + Intergenic
1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG + Intronic
1023511465 7:40958289-40958311 CAGGTACACCAATTAAGCATAGG + Intergenic
1023657494 7:42439849-42439871 CAGGAACACCAATTATTCTTAGG + Intergenic
1023800659 7:43831424-43831446 CAGGAACACCAAGTTATCTTGGG + Intergenic
1024099666 7:46016929-46016951 CAGGTACTCCAATCAATCGTAGG - Intergenic
1024144454 7:46498959-46498981 CAGGTACACCAATCAAACGTAGG - Intergenic
1024664746 7:51535379-51535401 CAGGTACACCAATCAAACGTAGG + Intergenic
1024703202 7:51927125-51927147 CAGGTACACCAATCAAACGTAGG + Intergenic
1024947021 7:54819079-54819101 CAGGAACACCAATTATTCTTAGG + Intergenic
1025320985 7:58092955-58092977 CAGGTACACCAATCAAACGTAGG - Intergenic
1025714612 7:63943096-63943118 CAGGCACACCAATCAATTGTAGG - Intergenic
1026139061 7:67689286-67689308 CAGGAACACCAATTATTCTTAGG + Intergenic
1027554512 7:79647105-79647127 CAGGGACACCAATAAATCATAGG + Intergenic
1028250804 7:88538426-88538448 CAGGAACACCAATTATTCTTAGG + Intergenic
1028401727 7:90432266-90432288 CAGGAACACCAATTATTCTTAGG - Intronic
1028962093 7:96760777-96760799 CAGGAACACCAATTATTCTTAGG + Intergenic
1029053062 7:97709785-97709807 CAGGAACACCAATTATTCTTAGG - Intergenic
1030325692 7:108216540-108216562 CAGGTACACCAATCAAACGTAGG + Intronic
1030972458 7:116076792-116076814 CAGGAACACCAATTATTCTTAGG - Intronic
1031169320 7:118272596-118272618 CAGGAACACCAATTATTCTTAGG + Intergenic
1031879363 7:127178368-127178390 CAGGAACACCAATTATTCTTAGG - Intronic
1032367881 7:131316971-131316993 CAGATACACCAATCAATCGTAGG - Intronic
1032605139 7:133342646-133342668 CAGGAACACCAATTAATTTTAGG + Intronic
1033259239 7:139828104-139828126 CAGGAACACCAATTATTCTTAGG + Intronic
1033259754 7:139832476-139832498 CAGGAACACCAATTATTCTTAGG - Intronic
1034705361 7:153138439-153138461 CAGGAACACCAATTATTCTTAGG + Intergenic
1035794212 8:2338400-2338422 CAGGTACACCAATCAAACGTAGG - Intergenic
1035798593 8:2383308-2383330 CAGGTACACCAATCAAACGTAGG + Intergenic
1036401714 8:8414587-8414609 CAGGTACACCAATCAAACGTAGG + Intergenic
1036621600 8:10427748-10427770 CAGGGACATCCATTTACCCTCGG + Intronic
1037320688 8:17639901-17639923 CAGGAACACCAATTATTCTTAGG + Intronic
1039123725 8:34176696-34176718 CAGGAACACCAATTATTCTTAGG - Intergenic
1040473187 8:47753474-47753496 CAGGTACACCAATCAAACGTAGG - Intergenic
1041150463 8:54926938-54926960 CAGGAACAGCAATTTTTCTTAGG - Intergenic
1041226153 8:55700840-55700862 CAGGCACCCCAAATTATCTTGGG + Intronic
1041293519 8:56331822-56331844 CAGGAACACCAATTATTCTTAGG + Intergenic
1041583808 8:59493750-59493772 CAGGTACACCAATCAAACGTAGG + Intergenic
1042122684 8:65506039-65506061 CAGGAACACCAATTATTCTTAGG + Intergenic
1042608123 8:70566834-70566856 CAGGAACACCAATTATTCTTAGG - Intergenic
1042926117 8:73970523-73970545 CAGGGACCCCAAATCATCATTGG + Intronic
1042969162 8:74389803-74389825 CAGGTACACCAATCAATTGTAGG + Intronic
1043270841 8:78330778-78330800 CAGGAACACCAATTATTCTTAGG - Intergenic
1043647094 8:82534979-82535001 CAGGTACACCAATCAAACGTAGG + Intergenic
1043987973 8:86716240-86716262 CAGGAACACCAATTATTCTTTGG - Intronic
1044198561 8:89407798-89407820 CAGGGGCCCCAAGTTATCTTGGG + Intergenic
1044267885 8:90204668-90204690 CAGGTACACCAATCAAACGTAGG - Intergenic
1044377977 8:91498979-91499001 CAGGTACACCAATAAATCATAGG + Intergenic
1044595063 8:93951592-93951614 CAGGCACACCAATCAATCATAGG + Intergenic
1044610510 8:94087517-94087539 CAGGTACACCAATCAATCATAGG + Intergenic
1044614510 8:94126078-94126100 CAGGTACACCAATCAATCATAGG + Intergenic
1046067829 8:109217643-109217665 CAGGTACACCAATCAAACGTAGG + Intergenic
1047121462 8:121909444-121909466 CAGGTACACCAATCAATCATAGG - Intergenic
1047592141 8:126337709-126337731 CAGGAACACCAATTATTCTTAGG - Intergenic
1047901707 8:129430371-129430393 CAGGAACACCAATTATTCTTAGG + Intergenic
1047937335 8:129795714-129795736 CAGGAACACCAATTATTCTTAGG + Intergenic
1049295844 8:141836996-141837018 CAGGAACACCAATTTTTCTTAGG + Intergenic
1049872216 8:144989417-144989439 CAGATACACCAATCAATCGTAGG + Intergenic
1050031923 9:1394891-1394913 CAGGTACACCAATCAATCATAGG - Intergenic
1050129998 9:2402297-2402319 CAGGTACACCAATCAATTGTAGG + Intergenic
1050400600 9:5249171-5249193 CAGGAACACCAATTATTCTTAGG - Intergenic
1050492537 9:6204041-6204063 CAGGTACACCAATCTAACGCAGG - Intergenic
1050660899 9:7881380-7881402 CAGGTACTCCAATCAATCGTAGG - Intronic
1050903615 9:10976029-10976051 CAGGAACACCAATTATTCTTGGG - Intergenic
1050963469 9:11767075-11767097 CAGGTACACCAATCAATCATAGG - Intergenic
1051687560 9:19674490-19674512 CAGGAACACCAATTATTCCTAGG + Intronic
1051881308 9:21842285-21842307 CAGGAACACCAATTATTCTTAGG - Intronic
1052336235 9:27323256-27323278 CAGGTACACCAATCAAACGTAGG + Intergenic
1052506452 9:29359907-29359929 CAGGTACACCAATCAATCATAGG - Intergenic
1052694230 9:31855282-31855304 CAGGGACACCAATGAGTCATAGG - Intergenic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053753411 9:41278938-41278960 CAGGTACACCAATTAGTCTTAGG + Intergenic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054258937 9:62843301-62843323 CAGGTACACCAATTAGTCTTAGG + Intergenic
1054332845 9:63776739-63776761 CAGGTACACCAATTAGTCTTAGG - Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1055156448 9:73068083-73068105 CAGGAACACCAATTATTCTTAGG - Intronic
1055210457 9:73784516-73784538 CAGGTACACCAATCAAACGTAGG - Intergenic
1055346851 9:75348984-75349006 CAGGAACACCAATTATTCTTAGG + Intergenic
1057119317 9:92557445-92557467 CAGGAACACCAATTATTCTTAGG + Intronic
1058181362 9:101804280-101804302 CAGTAATACTAATTTATCGTAGG - Intergenic
1058182675 9:101817024-101817046 CAGGTACACCAATCAAACGTAGG - Intergenic
1058308268 9:103470310-103470332 CAGGAACACCAATTCTTCTTAGG + Intergenic
1058540567 9:106008259-106008281 CAGGAACACCAATTATTCTTAGG + Intergenic
1061574822 9:131499610-131499632 CAGGGCCACCAATGTGTAGTTGG + Exonic
1062713743 9:137991438-137991460 CAGGAACACCAATTATTCTTAGG - Intronic
1202799844 9_KI270719v1_random:165050-165072 CAGGTACACCAATTAGTCTTAGG - Intergenic
1186810489 X:13183124-13183146 CAGGGACACCAGTCAATCATAGG - Intergenic
1187156812 X:16727730-16727752 CAGGAACCCCAAGTTATCTTGGG - Intronic
1187752062 X:22477812-22477834 CAGGAACACCAATTATTCTTAGG + Intergenic
1188129859 X:26418390-26418412 CAGGTACACCAATTAAATGTAGG + Intergenic
1188686694 X:33078132-33078154 CAGGAACCCCAAGTTATCTTGGG - Intronic
1188893132 X:35635004-35635026 CAGGTACACCAATCAAACGTAGG + Intergenic
1188915296 X:35903478-35903500 CAGGTACACCAATCAATTGTAGG + Intergenic
1189721707 X:43926422-43926444 CAGGTACACCAATCAAACGTAGG + Intergenic
1189864117 X:45306227-45306249 CAGGGACCCCAAGTTTTCTTGGG + Intergenic
1189937923 X:46088638-46088660 CAGGTACACCAATCAAACGTAGG - Intergenic
1190945982 X:55094534-55094556 CAGGGACCCCAATCAATCATAGG + Intronic
1190995541 X:55605144-55605166 CAGGTACACCAATCTATTGTAGG + Intergenic
1191026656 X:55920788-55920810 CAGGAACACCAATTATTCTTAGG - Intergenic
1191077161 X:56467697-56467719 CAGGGACACCAATTATTCTTAGG + Intergenic
1191100418 X:56720431-56720453 CAGGAACACCAATTATTCTTAGG - Intergenic
1191119873 X:56892137-56892159 CAGGCACACCAATTAATCGTAGG - Intergenic
1191172295 X:57460171-57460193 CAGGGACCCCAATCCATCGTAGG - Intronic
1191174004 X:57480864-57480886 CAGGGACCCCAGTCGATCGTAGG + Intronic
1191208251 X:57856502-57856524 CAGGTACACCAATCAAACGTAGG - Intergenic
1191787897 X:64936286-64936308 CAGGTACACCAATGAAACGTAGG - Intronic
1191944165 X:66513443-66513465 CAGGGATACCAATGAATCCTAGG + Intergenic
1192637013 X:72829750-72829772 CAGGTACACCAATCAAACGTAGG + Intronic
1192644701 X:72891064-72891086 CAGGTACACCAATCAAACGTAGG - Intronic
1192701627 X:73480943-73480965 CAGGTACACCAATCAATCATAGG + Intergenic
1192741172 X:73894030-73894052 CAGGTACACCAATCAAACGTAGG - Intergenic
1192858139 X:75036247-75036269 CAGGTACACCAATCAAACGTAGG + Intergenic
1192883485 X:75312793-75312815 CAGGTACACCAATCAATCATAGG + Intergenic
1192895509 X:75439277-75439299 CAGGAACACCAATTACTCTTAGG + Intronic
1192915900 X:75651082-75651104 CAGGTACTCCAATCAATCGTAGG + Intergenic
1192952077 X:76027620-76027642 CAGGTACTCCAATCAATCGTAGG - Intergenic
1192966385 X:76181907-76181929 CAGGTACACCAATCAATCATAGG + Intergenic
1192968048 X:76201297-76201319 CAGGGACACCGATTATTCTTAGG + Intergenic
1192994148 X:76494154-76494176 CAGGTACACCAATGAATCGTAGG - Intergenic
1192999322 X:76547242-76547264 CAGGTACACCAATCAAACGTAGG + Intergenic
1193055474 X:77144928-77144950 CAGGTACACCAATCAATCATAGG - Intergenic
1193076559 X:77361918-77361940 CAGGAACACCAATTATTCTTAGG + Intergenic
1193113605 X:77754961-77754983 CAGGGACCCCAATCAATCATAGG + Intronic
1193181135 X:78457729-78457751 CAGGAACCCCAAGTTATCTTGGG - Intergenic
1193203208 X:78716369-78716391 CAGGAACACCAATTATTCTTAGG - Intergenic
1193289902 X:79760839-79760861 CAGGAACACCAATTATTCTTAGG + Intergenic
1193341157 X:80351271-80351293 CAGGGACCCCAATCAATCGTAGG + Intronic
1193382001 X:80826802-80826824 CTGGGACCCCAATCAATCGTAGG + Intergenic
1193389365 X:80907952-80907974 CAGGGACCCCAATCAATTGTAGG - Intergenic
1193394376 X:80967122-80967144 CAGGTACACCAATCAAACGTAGG + Intergenic
1193514546 X:82447106-82447128 CAGGTACACCAATAAATCGTAGG - Intergenic
1193570068 X:83130164-83130186 CAGGGACACCAACGTGTCATAGG - Intergenic
1193732088 X:85113878-85113900 CAGGGATCCCAAGTTATCTTAGG - Intergenic
1193784280 X:85740373-85740395 CAGGTACACCAATCAATCATAGG - Intergenic
1193791776 X:85822894-85822916 CAGGAACACCAATTATTCTTAGG - Intergenic
1193817421 X:86121053-86121075 CAGGAACACCAATTATTCTTAGG + Intergenic
1193950837 X:87796136-87796158 CAGGAACACCAATTATTCTTAGG - Intergenic
1193954511 X:87843441-87843463 CAGGAACACCAATTATTCTTAGG + Intergenic
1193991202 X:88309876-88309898 CAGGTACACCAATCAATCGTAGG - Intergenic
1194078366 X:89426477-89426499 CAGAGACACCAATGTGTCATAGG - Intergenic
1194118839 X:89936444-89936466 CAGGTACACCAATCAAACGTAGG + Intergenic
1194208369 X:91038787-91038809 CAGGTACACCAATCAAACGTAGG + Intergenic
1194237332 X:91400298-91400320 CAGGAACACCAATTATTCTTAGG - Intergenic
1194242717 X:91471307-91471329 CAGGTACACCAATCAAACGTAGG - Intergenic
1194286942 X:92021534-92021556 CAGGTACTCCAATCAATCGTAGG - Intronic
1194315131 X:92368121-92368143 CAGGTAAACCAATTCATCATAGG + Intronic
1194354003 X:92857717-92857739 CAGGAACACCAATTATTCTTAGG - Intergenic
1194532943 X:95073090-95073112 CAGGAACACCAATTATTCTTAGG - Intergenic
1194543324 X:95202435-95202457 CAGGAACACCAATTATTCTTAGG + Intergenic
1194643231 X:96428199-96428221 CAGGTACACCAATCAAACGTAGG + Intergenic
1194815935 X:98441160-98441182 CAGGAACACCAATTATTCTTAGG - Intergenic
1194901356 X:99515442-99515464 CAGGGACCCCAGTCAATCGTAGG - Intergenic
1194974710 X:100382289-100382311 CAGGGACTCCAATTTCACTTTGG - Intronic
1195048350 X:101075232-101075254 CAGGAACCCCAAGTTATCTTGGG + Intergenic
1195469193 X:105213491-105213513 CAGGTACACCAATCAATCATAGG - Intronic
1195730112 X:107958511-107958533 CAGAGACCCCAATCAATCGTAGG + Intergenic
1196464966 X:115961923-115961945 CAGGTACACCAATTATTCTTAGG - Intergenic
1196519251 X:116653883-116653905 CAGGAACACCAATTATTCTTAGG + Intergenic
1196631326 X:117943454-117943476 CAGGTACACCAATCTAACTTAGG + Intronic
1197098179 X:122620471-122620493 CAGGTACACCAATTAAATGTAGG + Intergenic
1197191245 X:123649819-123649841 CAGGTACACCAATCAAACGTAGG - Intronic
1197349977 X:125371385-125371407 CAGGTACACCAATCAAACGTAGG + Intergenic
1197506159 X:127307312-127307334 CAGGTACACCAATCAATCGTTGG - Intergenic
1198062758 X:133063242-133063264 CAGGTACCCCAATCAATCGTAGG - Intronic
1198490095 X:137130951-137130973 CAGGTACACCAATCAAACGTAGG - Intergenic
1198753703 X:139960442-139960464 CAGGTGCACCAATCAATCGTAGG - Intronic
1199057699 X:143318011-143318033 CAGGAACACCAATTATTCTTAGG + Intergenic
1199077361 X:143539145-143539167 CAGGAACACCAATTATTCTTAGG - Intergenic
1199121713 X:144061972-144061994 CAGGAACACCAATTATTCTTAGG - Intergenic
1199801378 X:151254243-151254265 CAGGTACACCAATCAATCGTAGG - Intergenic
1199830854 X:151547625-151547647 CAGGTACACCAATCAATCATAGG - Intergenic
1200321461 X:155194622-155194644 CAGGTACCCCAATTATTCGTTGG + Intergenic
1200431007 Y:3082005-3082027 CAGAGACACCAATGTGTCATAGG - Intergenic
1200471716 Y:3594006-3594028 CAGGTACACCAATCAAACGTAGG + Intergenic
1200604485 Y:5246094-5246116 CAGGTACTCCAATCAATCGTAGG - Intronic
1200623183 Y:5479658-5479680 CAGGTAAACCAATTAATCATAGG + Intronic
1200662358 Y:5974783-5974805 CAGGAACACCAATTATTCTTAGG - Intergenic
1201391699 Y:13504414-13504436 CAGGAACACCAATTATTCTTAGG - Intergenic
1201462416 Y:14240825-14240847 CAGATACACCAATCTATCGTAGG - Intergenic
1201591364 Y:15618267-15618289 CAGGTACACCAATCAATTGTAGG - Intergenic
1201750374 Y:17424987-17425009 CAGGAACCCCAAGTTATCTTGGG + Intergenic