ID: 1083511542

View in Genome Browser
Species Human (GRCh38)
Location 11:63213424-63213446
Sequence TACTGGACCTTCATGGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083511542 Original CRISPR TACTGGACCTTCATGGCCTT AGG Intronic
902490401 1:16776833-16776855 TTCTGACCCTTCATTGCCTTTGG + Intronic
904196966 1:28793076-28793098 TTCTGGCCCTTCATTCCCTTTGG + Intergenic
904422401 1:30402665-30402687 TAATGGACCTTCATGACCCGTGG - Intergenic
905911968 1:41661652-41661674 GACTGAAACTGCATGGCCTTGGG + Intronic
906823403 1:48952962-48952984 TACTGAACATTCCTGGACTTTGG + Intronic
910208504 1:84771784-84771806 TTCTGGATCCCCATGGCCTTTGG + Intergenic
914224118 1:145706399-145706421 GACTGGACAATCATGGCCTGAGG + Intronic
916189049 1:162161088-162161110 TCCTGCACCTCCATCGCCTTTGG + Intronic
917279180 1:173363673-173363695 AACTGAACCATCAGGGCCTTAGG - Intergenic
921784835 1:219217807-219217829 TACTTCAACTTCCTGGCCTTAGG - Intergenic
923530039 1:234805697-234805719 TTCTGACCCTTCATTGCCTTTGG - Intergenic
924767453 1:247047033-247047055 AAGTGGACTCTCATGGCCTTGGG + Intronic
1067039334 10:42940679-42940701 TCCTGGTCCATCAAGGCCTTGGG + Intergenic
1067269430 10:44776621-44776643 TACTGCTCTTTCATGGGCTTTGG + Intergenic
1073287380 10:102397036-102397058 TACTGGGCAGTCATGTCCTTGGG - Exonic
1076817543 10:132922287-132922309 TTCTGGAGCCTCCTGGCCTTTGG + Intronic
1077133253 11:985500-985522 TGCTGGACCTTCTTCGACTTGGG - Exonic
1080539019 11:33248901-33248923 GACTGGACCTGCATGGTCTTGGG + Intergenic
1080628895 11:34054197-34054219 TACTTGAATTTCATGGACTTGGG + Intronic
1083511542 11:63213424-63213446 TACTGGACCTTCATGGCCTTAGG + Intronic
1088593100 11:111420008-111420030 TTCTGGACCTGCCTGTCCTTGGG - Intronic
1089796239 11:120983460-120983482 TACTGGGCCTTATTGGACTTTGG + Intronic
1090277197 11:125428730-125428752 TACTGAACCATCTTGGTCTTGGG + Intronic
1091183198 11:133626079-133626101 TTCTGGCCCTTCATGGGATTTGG - Intergenic
1091568488 12:1664156-1664178 GACTGGCCCACCATGGCCTTGGG + Intergenic
1105702213 13:22942117-22942139 TCCTGGACACTCATGGCCATTGG - Intergenic
1107432085 13:40349356-40349378 TTCTGCAACTTGATGGCCTTGGG - Intergenic
1110535619 13:76647599-76647621 CACTGGTCCTTCCTTGCCTTAGG + Intergenic
1111258304 13:85701183-85701205 TATTGCATCTTCATGGCCTTGGG - Intergenic
1112345123 13:98582989-98583011 TACTGTGCCTTCTTGCCCTTTGG - Intergenic
1112581773 13:100682382-100682404 TACATGACCTTCTAGGCCTTGGG - Intergenic
1119360215 14:74043073-74043095 TGCTGCAGCTTCATGGCATTGGG + Intronic
1122407071 14:101507021-101507043 TGCTGGACCTGCATGTCCGTGGG - Intergenic
1124591912 15:31061224-31061246 TCCTGGACCATCATGGGCTGAGG - Intronic
1127215433 15:56818502-56818524 GACTGGCCCTTAATGTCCTTTGG - Intronic
1127461683 15:59204957-59204979 TACAGGTCCTTCAGGGCCTCAGG - Intronic
1131363555 15:91817675-91817697 TTCTGGATCTTTATGGCTTTGGG - Intergenic
1131715408 15:95105317-95105339 TACTGCGACTTCATGGCCTCAGG - Intergenic
1135073761 16:19375449-19375471 TACTGCACCTTCCTGGGCCTTGG - Intergenic
1136228324 16:28873232-28873254 TCCTGCACCCTCATGCCCTTCGG + Intronic
1137557768 16:49483638-49483660 CACTGGACCTCCCTGGACTTGGG - Intergenic
1139393664 16:66622598-66622620 TACTGCAACTTCAGGGCCTCTGG + Intronic
1141127867 16:81413949-81413971 CACTGCATCTTCTTGGCCTTGGG + Intergenic
1141331311 16:83113879-83113901 TGCTGGATCTTCCTGGCCTTAGG + Intronic
1143612501 17:8027340-8027362 TGCTGGATCTTCATTCCCTTTGG - Intergenic
1149418459 17:56484919-56484941 GCTTGGACCTTCAGGGCCTTAGG - Intronic
1149612782 17:57969899-57969921 TACTTGACCTTCATGGTCCAGGG + Intergenic
1151349994 17:73526065-73526087 TACAGGACCGTAATGGCCCTGGG + Intronic
1152326437 17:79642237-79642259 AACCGGACCTTTATGTCCTTTGG - Intergenic
1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG + Intergenic
927089567 2:19700324-19700346 TACTGTCCCCTCATGCCCTTTGG - Intergenic
928867297 2:35932406-35932428 TTCTTGACCTTTCTGGCCTTGGG - Intergenic
930838696 2:55823519-55823541 TACAGGACCTCCAAGACCTTGGG + Intergenic
933466268 2:82656634-82656656 TATTTCACCTTCATGACCTTGGG + Intergenic
936918302 2:117662269-117662291 GCCTGGACCTGCCTGGCCTTGGG - Intergenic
938341050 2:130536819-130536841 CACTGGTCCCTCAGGGCCTTGGG + Intergenic
938348780 2:130583890-130583912 CACTGGTCCCTCAGGGCCTTGGG - Intronic
1169614067 20:7418959-7418981 TCCTTGTCTTTCATGGCCTTGGG + Intergenic
1170617937 20:17969019-17969041 TTCTGGACCTGCTTTGCCTTAGG + Exonic
1179022866 21:37656009-37656031 TCCTGGACCCTCATGGACTTAGG + Intronic
1181849732 22:25741576-25741598 TTCTGGCTCTCCATGGCCTTGGG + Intergenic
1184918250 22:47588069-47588091 GCCTGGACCTTGGTGGCCTTGGG - Intergenic
949760740 3:7467429-7467451 TACTTGACTTTCCTGGACTTGGG - Intronic
951306461 3:21068903-21068925 CACTGGGCCTTCATGGGCTCTGG - Intergenic
954087428 3:48256408-48256430 AACAGGGCGTTCATGGCCTTGGG - Intronic
954718515 3:52539466-52539488 TACTGGAGCTTCATCCCCATGGG + Intronic
956374242 3:68597065-68597087 CACTTGACCTTCATGGCTTATGG - Intergenic
958669106 3:97180264-97180286 TACTCGTCCTTCAGGGCATTGGG + Intronic
960860956 3:122153498-122153520 TACTGACCCTTCACGGCATTAGG - Intergenic
961424006 3:126830754-126830776 TGCTGGATATTCATGTCCTTTGG + Intronic
963515738 3:146306165-146306187 AGGTGGACTTTCATGGCCTTGGG + Intergenic
964197964 3:154086729-154086751 TATTGCACCTGCCTGGCCTTGGG + Intergenic
964260934 3:154835860-154835882 CCCTGGACTTGCATGGCCTTAGG + Intergenic
965452092 3:168850753-168850775 CCCTGGCCCTTCATGGCCTCTGG + Intergenic
967381012 3:188858045-188858067 TTCTTGACCTTTCTGGCCTTTGG - Intronic
968768840 4:2490242-2490264 TACTGGTCCTTCCTGTCCCTAGG - Intronic
970662740 4:18304637-18304659 TTCTTGACCTTTATAGCCTTAGG + Intergenic
972582028 4:40403548-40403570 TACTGGGCCTGCGTGACCTTGGG - Intergenic
972622398 4:40760231-40760253 TGCTGGACCTTTATGACCTAGGG - Intronic
974441399 4:61923057-61923079 CACTTGACCATCTTGGCCTTGGG - Intronic
974745130 4:66062895-66062917 TAATGGAGCTTGGTGGCCTTAGG - Intergenic
975835671 4:78420051-78420073 TACTGGACCTTGATGCCATTTGG - Intronic
976688735 4:87845470-87845492 TACTGGACTTTTCTGGGCTTGGG - Exonic
988999980 5:36749749-36749771 TCCTGCAACTTCATGTCCTTTGG + Intergenic
993465921 5:88247086-88247108 TTCTTGCTCTTCATGGCCTTAGG - Intronic
996411975 5:123168479-123168501 TACTGGACCTTCTTGGGACTCGG + Intronic
998054231 5:139060872-139060894 TCCTGGTGCTTCATGGCCTCAGG - Intronic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
999147998 5:149408345-149408367 TTCTGAACCATGATGGCCTTGGG - Intergenic
1000949727 5:167465927-167465949 CCCTGGACATTCATGGACTTTGG - Intronic
1001221192 5:169902490-169902512 TACTTGACCTTAATAGCCTGTGG - Intronic
1004643551 6:17538665-17538687 TCCTGGACCCTCATTACCTTCGG + Intronic
1006829669 6:36961302-36961324 TCCTGAACCTGCATGGCCTTGGG + Intronic
1007029455 6:38615003-38615025 AACTGGGCCTTCAAGGCCTGTGG + Intronic
1008832327 6:55780765-55780787 TCCTGGACCCTCATGAGCTTGGG - Intronic
1009792439 6:68420409-68420431 TGCTGGGCTCTCATGGCCTTTGG - Intergenic
1010369337 6:75089124-75089146 TACTGGATCTTCAGGACCTCGGG - Exonic
1010824372 6:80454686-80454708 TTCTGGGCCTTCATCTCCTTGGG - Intergenic
1014604308 6:123453174-123453196 TTCTAGACATTCATTGCCTTAGG + Intronic
1015685166 6:135850928-135850950 AACTGGACCTTCATACTCTTTGG + Intergenic
1022442687 7:30446832-30446854 TACTTGACCAACATGGCCCTGGG + Intronic
1022760049 7:33339204-33339226 TATTGGTCCTGCATGGCTTTTGG + Intronic
1024288924 7:47786135-47786157 TACTGAATCTTCATTGACTTTGG - Intronic
1029536661 7:101161270-101161292 TTCTGGACTTTGCTGGCCTTGGG + Exonic
1030144211 7:106336315-106336337 AACTGGACAGTCATGTCCTTGGG + Intergenic
1036684381 8:10899498-10899520 TCCTGGATCTTGTTGGCCTTGGG - Intronic
1038389481 8:27181514-27181536 TACTGGTCCATCATGGCTTGGGG - Intergenic
1040866752 8:52055384-52055406 TACTGGAGCTGCCTGGCCTCTGG - Intergenic
1044378454 8:91503821-91503843 AACTGGTCATTCATGTCCTTCGG - Intergenic
1047324845 8:123826302-123826324 TACTGGACATAGCTGGCCTTTGG - Intergenic
1052341175 9:27365794-27365816 CCCTGGACCTGGATGGCCTTGGG + Intronic
1058371743 9:104276853-104276875 TATTGGACCTTGATCGTCTTTGG - Intergenic
1061738745 9:132683055-132683077 TACTGGACCATGTTGGCCATGGG + Intronic
1062233705 9:135498004-135498026 ACCTGGACCTTCATGGGGTTTGG + Intronic
1186851487 X:13584352-13584374 TTCTGGACCTTCCTGCTCTTTGG + Intronic
1188023155 X:25180725-25180747 AAATGGAACTTCATGGGCTTAGG + Intergenic
1194111690 X:89841756-89841778 TACTGGGGCTTGATGGCCTCTGG - Intergenic
1194912006 X:99657055-99657077 TGCTCAACCTTCATGGCTTTGGG + Intergenic
1195229981 X:102836997-102837019 TTCTGCCCCTTTATGGCCTTAGG + Intergenic
1198570920 X:137955810-137955832 TACTGCACCTTCTTGTCCCTCGG + Intergenic
1198912886 X:141633962-141633984 TAGTGGACTCCCATGGCCTTGGG - Intronic
1199578056 X:149333899-149333921 TACTGGAGCATCCTGCCCTTTGG + Intergenic
1200464352 Y:3496547-3496569 TACTGGGGCTTGATGGCCTCTGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic