ID: 1083512180

View in Genome Browser
Species Human (GRCh38)
Location 11:63220109-63220131
Sequence TACCTTTTGTTGTAAGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083512176_1083512180 26 Left 1083512176 11:63220060-63220082 CCCAAACTTCTCATGTCACAGAC 0: 1
1: 0
2: 0
3: 23
4: 230
Right 1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 155
1083512175_1083512180 27 Left 1083512175 11:63220059-63220081 CCCCAAACTTCTCATGTCACAGA 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 155
1083512177_1083512180 25 Left 1083512177 11:63220061-63220083 CCAAACTTCTCATGTCACAGACT 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083512180 Original CRISPR TACCTTTTGTTGTAAGGTAG AGG Intronic
902091022 1:13903419-13903441 TACCTTTTGTTGTCATCTACAGG + Intergenic
903432030 1:23312023-23312045 AACCTTTTGATGTATGGCAGAGG - Intronic
904641530 1:31934506-31934528 TCCTTTTTGTTGTAATGTGGGGG - Intronic
905238108 1:36564283-36564305 TAACTTTTGGTATAAGGTAATGG + Intergenic
907076974 1:51587831-51587853 TACCTTAGGTTGAAGGGTAGAGG - Intronic
910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG + Intronic
910613172 1:89166732-89166754 TAGCCTTTGTTGCAAGGTTGTGG - Intronic
910640087 1:89451010-89451032 TAGCTTTTGATTTAAAGTAGGGG - Intergenic
910747369 1:90588484-90588506 TACCTTCTGTTGTTAAGTTGGGG - Intergenic
911667862 1:100574519-100574541 AACCTTTTATTTTAAGTTAGGGG - Intergenic
914710098 1:150205342-150205364 TGGCTTTTTTTGTAAGGTTGTGG - Intergenic
916244427 1:162673150-162673172 TAATTTTTCTTGAAAGGTAGGGG - Intronic
918603366 1:186391388-186391410 CACTTTTTTTTTTAAGGTAGTGG + Intronic
923815926 1:237378627-237378649 TACATTTTGATTTATGGTAGTGG - Intronic
924413762 1:243835473-243835495 TAGGTATTGTTCTAAGGTAGTGG - Intronic
924733688 1:246735428-246735450 TTCCTTTTGTCTTCAGGTAGAGG + Intronic
1063276374 10:4572789-4572811 CATCTTTTGTTGTAATGTTGGGG - Intergenic
1064061954 10:12145633-12145655 TTCCTTTTGTTGTAAGTAATAGG + Intronic
1064553354 10:16523511-16523533 TAACTTTTATTTTAGGGTAGTGG + Intergenic
1065104960 10:22373731-22373753 TACCTTTTTTTCTATTGTAGGGG + Intronic
1067214127 10:44286398-44286420 AACCTTCTGTCCTAAGGTAGAGG - Intergenic
1067366358 10:45633105-45633127 TACTTTTTGCTGTAAGAAAGTGG - Intronic
1068529750 10:58172393-58172415 TACATTTTCTTGTACGGTATGGG - Intergenic
1069178567 10:65326517-65326539 TACCTTTTATTTTAAGGAACTGG + Intergenic
1074198586 10:111210613-111210635 TACCTTTTAGTGTTTGGTAGCGG + Intergenic
1074627891 10:115213452-115213474 AACCTTTTGTTCTAAGGATGGGG + Intronic
1080252450 11:30249392-30249414 TGCCTTCTGTTGTTAGGTAGAGG - Intergenic
1081362725 11:42200137-42200159 TAACTTTTGTTTTAAGTTAGGGG - Intergenic
1082777195 11:57255081-57255103 TACCTTTAGTTTTAAGGCAGAGG + Intergenic
1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG + Intronic
1085008598 11:73118625-73118647 TTCTTTTTGGTGTAAGGAAGAGG + Intronic
1085968434 11:81557159-81557181 TATCTTTGGTTGTATGGTAGGGG - Intergenic
1086009803 11:82087084-82087106 TACCATTTCTTGTCAGGTAGTGG - Intergenic
1090022485 11:123140287-123140309 TATCTTTGGTTGTATAGTAGGGG + Intronic
1091957659 12:4660999-4661021 TATGTTTTTTTTTAAGGTAGAGG + Intronic
1092157904 12:6296287-6296309 TACCTTTTTTTATAAAGTGGCGG - Intergenic
1094299287 12:28943671-28943693 TAACTTTTATTTTAAGGTTGGGG + Intergenic
1095204673 12:39425867-39425889 TAGCTCTTGTTATAAGGAAGCGG - Intronic
1095429502 12:42117675-42117697 TACCTTTTGTTCTGAGATGGTGG - Intronic
1098204183 12:68089672-68089694 TACTTTTTGTTCTAAGATAATGG - Intergenic
1098988110 12:77034222-77034244 TACTTTTTTTTTTAAGTTAGTGG + Intronic
1104157502 12:126148027-126148049 TACTTTTTGGTTTCAGGTAGAGG - Intergenic
1104324293 12:127781555-127781577 AACCTTTTGTTCTAAGGAATGGG - Intergenic
1105502285 13:20983026-20983048 TGCATTTTTTTTTAAGGTAGTGG - Intronic
1107522491 13:41197236-41197258 TTGCTTATGGTGTAAGGTAGGGG - Intergenic
1108117954 13:47150493-47150515 TACATTTTTTTTTAATGTAGGGG + Intergenic
1109131048 13:58586444-58586466 CACATTTTGTGGGAAGGTAGAGG - Intergenic
1110528084 13:76563065-76563087 TACCTATTGTTTTAAGGTCACGG - Intergenic
1110907895 13:80916133-80916155 TAACTTTTATTTTAAGGTTGAGG - Intergenic
1114285344 14:21237199-21237221 TACCTTTTGGTGAGAGGAAGGGG - Intronic
1114857602 14:26468061-26468083 TAAATTATGTTGTAGGGTAGAGG + Intronic
1115016029 14:28615547-28615569 TAACTTTTATTTTAAGTTAGGGG + Intergenic
1117924244 14:60760189-60760211 TACCTTTTTTTTTCAGTTAGTGG + Intronic
1121343646 14:93119494-93119516 TACCTTATGAAGTAAGATAGAGG - Intergenic
1121797763 14:96749496-96749518 TTCCTATTGTTGTCAGGTACAGG - Intergenic
1121946476 14:98127668-98127690 TGCATTTTGGTTTAAGGTAGAGG + Intergenic
1127812416 15:62576067-62576089 TATTTTATGTTCTAAGGTAGTGG + Intronic
1129635185 15:77308791-77308813 TAACATTTGTTGAAAGGTACAGG - Intronic
1130282164 15:82527944-82527966 TACCTTTTGGTTTCAGTTAGAGG + Intergenic
1138911666 16:61407953-61407975 TACCTTTGGTTGTATGATTGTGG + Intergenic
1139032950 16:62907491-62907513 TAACTTTTGTTGTAAGTTTATGG - Intergenic
1140760022 16:78101725-78101747 TGCCTTTGGTGGCAAGGTAGAGG + Intronic
1145771493 17:27496522-27496544 TCCCTTCTGTTGGAAGGGAGGGG - Intronic
1148361035 17:47012156-47012178 AACCTTTTATTGTCAGGAAGAGG + Intronic
1148519795 17:48261801-48261823 TTCCTTTTGTTTTATGGTGGGGG + Intronic
1148979823 17:51562822-51562844 TAATTGTTGTTGTAGGGTAGGGG - Intergenic
1155788193 18:29928756-29928778 AACCTTTTCAAGTAAGGTAGAGG - Intergenic
1155832877 18:30540240-30540262 TACTTTTTGCTATAATGTAGAGG + Intergenic
1165141392 19:33702286-33702308 TATGTTTTGTTTTAAGGTAAGGG + Intronic
1168674835 19:58270035-58270057 TACCTTTTTTTTTAAGTTATGGG - Intronic
929693925 2:44098317-44098339 TCCCTTTTGTTGCAGGGTTGTGG - Intergenic
929835931 2:45399540-45399562 TACCTTATGTTGTCAGGTGTGGG - Intronic
933274483 2:80268765-80268787 TTCCTTTTATTGTAATGTTGTGG - Intronic
933478141 2:82818793-82818815 TATCTTTGGTTGTATGCTAGGGG - Intergenic
935124383 2:100210502-100210524 TACCTTTTCTTGCAAGTAAGAGG - Intergenic
935355411 2:102194558-102194580 TACCATGTGTTGTCAGGTATAGG - Intronic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
936922133 2:117699685-117699707 TGCCTTCTGTTGTTTGGTAGAGG + Intergenic
937897809 2:126991627-126991649 GACTTTTAGTTGTAAGGCAGAGG + Intergenic
940070073 2:149677035-149677057 TCTGTTTTGTTTTAAGGTAGAGG - Intergenic
940077542 2:149759966-149759988 TACATTTTGAAGTCAGGTAGTGG + Intergenic
943434747 2:187850511-187850533 TAACTTTTGTTTTAAGTTTGGGG - Intergenic
944160163 2:196651443-196651465 TAGTTTTTCTTGTAAAGTAGTGG + Intronic
944741717 2:202619148-202619170 TATCTTTGGTTATACGGTAGGGG + Intergenic
945771899 2:214054047-214054069 TCCCTTTTGTTGGAGGGCAGTGG + Intronic
1169649945 20:7855801-7855823 TACCTTTTGGTATAATGCAGGGG + Intergenic
1169833327 20:9850024-9850046 TATCTTTTGTTATAAGTTTGTGG + Intergenic
1170069346 20:12348037-12348059 TATCTTTTGTTGTATTGAAGTGG + Intergenic
1171028526 20:21654663-21654685 TGCCTTTTGAGCTAAGGTAGAGG - Intergenic
1171982863 20:31639349-31639371 GACCTTTTGTTCTGAGGTGGAGG + Intronic
1174771422 20:53304276-53304298 AAACTTTTATTGGAAGGTAGAGG + Intronic
1178390470 21:32193893-32193915 CATTTTTTGTTGTAGGGTAGGGG + Intergenic
1182334562 22:29575098-29575120 GACCTTTGGTTTTAATGTAGAGG + Intronic
949643909 3:6071180-6071202 TACCTTTTGTAACAAAGTAGTGG + Intergenic
949913300 3:8934113-8934135 TAGCATATGTTGTGAGGTAGAGG - Intronic
950281099 3:11708656-11708678 TAATTTTTTGTGTAAGGTAGAGG - Intronic
951419292 3:22465094-22465116 TTCCTTTTGTTGAAAGTTACAGG - Intergenic
952354690 3:32573165-32573187 TCCCTATTTTTGTAATGTAGAGG - Intergenic
954824697 3:53362390-53362412 TAACTTTTGTTGTAGAGTCGGGG + Intergenic
955339989 3:58117818-58117840 TTCCTTTTGTAATAAGGAAGGGG - Intronic
955786222 3:62542155-62542177 TCCCTTTTGTAATAAGCTAGAGG + Intronic
956152769 3:66260523-66260545 TACCCTTTGTTGTAATGCATCGG + Intronic
956770700 3:72523465-72523487 TAACTTTTGGTGTAAGTTTGAGG + Intergenic
958997510 3:100922050-100922072 TTTCTTTTGTAATAAGGTAGTGG - Intronic
959252041 3:103961357-103961379 TACCTATTGTAGTATGTTAGTGG - Intergenic
959802550 3:110512534-110512556 TACCTTCTGTTTTCAGGAAGTGG + Intergenic
967078100 3:186023434-186023456 TACCTTTTGTAGTAAGACAGGGG + Intergenic
968320399 3:197762999-197763021 TAACTTTTATTTTAAGGTTGGGG - Intronic
972068925 4:34990139-34990161 TAATTTTTGTTGTAAAGTAGAGG - Intergenic
977423492 4:96834514-96834536 CACTTTTTCCTGTAAGGTAGAGG + Intergenic
980042822 4:127959120-127959142 TACCTTTTGATGTAATGTAGTGG + Intronic
980988330 4:139717324-139717346 TACCTTTTCCTGAAAGGTACAGG - Exonic
981749289 4:148077913-148077935 TGGCTTTTGTTTCAAGGTAGGGG + Intergenic
982186878 4:152811661-152811683 TCTCTTTTGTTCTAAGGTTGAGG - Intronic
983036933 4:162878136-162878158 TTCCTGTTGTAGTAAGTTAGAGG + Intergenic
985944571 5:3167819-3167841 TACCCTTACTTGTAAAGTAGAGG - Intergenic
986951304 5:13088145-13088167 TAACTTTTGTTGTTATTTAGAGG - Intergenic
987581218 5:19795030-19795052 TGCCTTTTGCTGTCAGGTTGTGG - Intronic
993728104 5:91391347-91391369 TACTTTTTTTGGTAAGGTACAGG + Intergenic
994638259 5:102370189-102370211 TACCTTTTATTTTAAGTTCGGGG - Intergenic
995633063 5:114154890-114154912 TAACTTTTATTTTAAGTTAGTGG + Intergenic
995830851 5:116353999-116354021 TACCTTTTCTTCTAGGGCAGAGG + Intronic
996005167 5:118411549-118411571 GCCCTTTTGATGGAAGGTAGAGG - Intergenic
1000578721 5:163009373-163009395 TATCTTTAGTTGTGTGGTAGAGG - Intergenic
1004611668 6:17247167-17247189 TAACTTTTGTTTTAAGTTATGGG - Intergenic
1005271136 6:24164746-24164768 TCTCCTTTGTTGGAAGGTAGAGG - Intergenic
1010808605 6:80269451-80269473 GTCCTTTTGTTTTATGGTAGAGG + Intronic
1012087487 6:94848475-94848497 TATCTTTTGATGTAGGGGAGAGG - Intergenic
1014195683 6:118555657-118555679 TAACTTTTGTTTTAAGTTTGGGG + Intronic
1018116534 6:160591168-160591190 TACATTTTGTTGTAACAAAGTGG + Intronic
1021450738 7:20781834-20781856 TAACTTTTGTTGTTAGGAGGTGG - Intergenic
1021787796 7:24169778-24169800 TAACTTTTGTTTTAGGTTAGGGG - Intergenic
1022104313 7:27187661-27187683 TTCCTTTTGTTCGAAGGTAGGGG - Intergenic
1030414235 7:109220652-109220674 TCCCTTTTGATCTAAGCTAGTGG - Intergenic
1032767354 7:135009993-135010015 TATTTTTTGTTGTAAGGGTGAGG + Intronic
1034142776 7:148837919-148837941 ACCCTTGTGTTGTAGGGTAGAGG - Intronic
1036413681 8:8527045-8527067 TACCTTATGTTCTGATGTAGAGG + Intergenic
1039476953 8:37843993-37844015 GTCCTTTTGTTATGAGGTAGAGG + Exonic
1040377230 8:46838025-46838047 TATCTTTGGTTGTACAGTAGGGG + Intergenic
1040958869 8:53009632-53009654 TAATTTTTGGTGTGAGGTAGGGG + Intergenic
1041152530 8:54950891-54950913 TACTTTTTGTTCTAAATTAGAGG - Intergenic
1044400748 8:91768752-91768774 TACTTTTTCTTGTAAGAAAGTGG - Intergenic
1044667534 8:94645950-94645972 TTCCTCTTGTTTTAAGGCAGTGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047492022 8:125382969-125382991 CTCCTTTTGTTGAAGGGTAGTGG - Intergenic
1052410898 9:28119809-28119831 TACCTATAGTTCTAAGGTAAGGG - Intronic
1053622998 9:39839932-39839954 TAACTTTTATTGTAAGGTCAGGG - Intergenic
1053881875 9:42603295-42603317 TAACTTTTATTGTAAGGTCAGGG + Intergenic
1054220899 9:62410761-62410783 TAACTTTTATTGTAAGGTCAGGG + Intergenic
1054229815 9:62498411-62498433 TAACTTTTATTGTAAGGTCAGGG - Intergenic
1057558398 9:96107945-96107967 GATATTTTGTTGCAAGGTAGGGG - Exonic
1058559323 9:106207819-106207841 TACCATTTTTTGGAGGGTAGAGG + Intergenic
1060654397 9:125359108-125359130 CACATTATTTTGTAAGGTAGAGG - Intronic
1060701327 9:125751434-125751456 TACCTTTTCATATATGGTAGAGG - Intronic
1187383676 X:18828303-18828325 TTATTTTTGTTGTAAGGCAGAGG - Intergenic
1191944509 X:66517227-66517249 TTCGTTTTGTTGAAAGGAAGAGG + Intergenic
1192089230 X:68135095-68135117 TACCTTACTTTGTAAGGTATTGG - Intronic
1193940733 X:87678697-87678719 TAACTTTTGTTTTAAGTTTGGGG - Intergenic
1196047196 X:111268805-111268827 TTTCTTTTGTTGTAAGGTAAAGG + Intronic
1197460026 X:126729762-126729784 TATCTTTGGTTGTATAGTAGGGG - Intergenic
1198605002 X:138327701-138327723 TAACTTCTGTTGTTGGGTAGTGG - Intergenic
1199492753 X:148419062-148419084 GACTTTTTGGTGTAAGGAAGGGG - Intergenic
1199534753 X:148890036-148890058 TCCCTTTTCTTGTAAGGAATGGG + Intronic
1199660845 X:150049108-150049130 TAATTTTTGTTGTAAAGGAGAGG + Intergenic
1200698319 Y:6380742-6380764 TACAGTTTGTTGTATTGTAGAGG + Intergenic
1201035795 Y:9783957-9783979 TACAGTTTGTTGTATTGTAGAGG - Intergenic