ID: 1083518256

View in Genome Browser
Species Human (GRCh38)
Location 11:63281391-63281413
Sequence ATCCATTGGTAGCCTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 1, 2: 9, 3: 112, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083518251_1083518256 4 Left 1083518251 11:63281364-63281386 CCTGGTCTGTGAAGTTTCTGCTA 0: 1
1: 1
2: 13
3: 77
4: 366
Right 1083518256 11:63281391-63281413 ATCCATTGGTAGCCTGATGGGGG 0: 1
1: 1
2: 9
3: 112
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083518256 Original CRISPR ATCCATTGGTAGCCTGATGG GGG Intronic
901905286 1:12403945-12403967 ATCCAATGGGAGCTTGTTGGAGG - Exonic
902458539 1:16553935-16553957 ATCCAGTGGTAGCCTGTTGGAGG - Intergenic
902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG + Intronic
903151729 1:21414694-21414716 ATCCACTGGTAGCCAGTTGGAGG - Intergenic
905982556 1:42242969-42242991 ATCCACTGTTAGTCTGATGAAGG - Intronic
906063176 1:42961442-42961464 CCCCATTGTTAGCCTCATGGAGG + Intergenic
906598463 1:47102679-47102701 ATCTACTGTTAGCCTAATGGAGG + Intronic
906773776 1:48510048-48510070 ATCAAATGGTAGCCTAATTGTGG + Intergenic
909463469 1:75945337-75945359 ATCTACTGTTAGTCTGATGGGGG - Intergenic
909678655 1:78266404-78266426 AGTCATTGGTAGCTTGATGGGGG + Intergenic
909874756 1:80788109-80788131 AGTCAGTGGTAGCTTGATGGGGG - Intergenic
914209328 1:145563715-145563737 ATCCACTGGTAGCCGGTTGGAGG - Intergenic
914268247 1:146056083-146056105 ATCCACTGGTAGCCGGTTGGAGG - Intergenic
914368851 1:147004778-147004800 ATCCACTGGTAGCCGGTTGGAGG + Intergenic
916252268 1:162750597-162750619 AGTCATTGGTAGCTTGATGGGGG - Intronic
916469058 1:165104761-165104783 AGTCGTTGGTAGCTTGATGGGGG + Intergenic
918408084 1:184230479-184230501 AGTCATTGGTAGCTTGATGGGGG + Intergenic
918778180 1:188665356-188665378 ATCCATTAGTAGACAGGTGGAGG - Intergenic
918859346 1:189802221-189802243 ATACATTGGTTACCTGAAGGAGG - Intergenic
919152552 1:193719404-193719426 AGTCATTGGTAGCTTGATGGGGG + Intergenic
922139701 1:222871330-222871352 AGTCATTGGTAGCTTGATGGGGG + Intergenic
923422484 1:233831667-233831689 ATCCACTGGTAGTCTTATGTAGG + Intergenic
924066009 1:240222531-240222553 AGTCAATGGTAGCTTGATGGGGG + Intronic
1066007873 10:31164467-31164489 ATCTACTGGTAGCCTTATTGAGG + Intergenic
1067357140 10:45540152-45540174 AGTCATTGGTAGCTTGATGGGGG - Intronic
1068178810 10:53495540-53495562 AGTCATTGGTGGCTTGATGGGGG + Intergenic
1068390264 10:56386839-56386861 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1068525926 10:58129655-58129677 AGTCAATGGTAGCTTGATGGGGG - Intergenic
1069260331 10:66386547-66386569 AGTCATTGGTAGCTTGATGGGGG - Intronic
1072025893 10:91456112-91456134 AGCCATTGGTAGCCTGATGGGGG + Intronic
1075936293 10:126344562-126344584 AGTCATTGGTAGTTTGATGGGGG + Intronic
1075947314 10:126446414-126446436 ATCAGCTGATAGCCTGATGGAGG - Intronic
1076272444 10:129166138-129166160 TTGCAGTGGTAGCCAGATGGTGG + Intergenic
1076663269 10:132069379-132069401 ATCCAGTACTATCCTGATGGTGG + Intergenic
1077449624 11:2630940-2630962 ATCCACTGATAGCCTTATGGAGG + Intronic
1078028237 11:7720539-7720561 AGTCGTTGGTAGCTTGATGGGGG - Intergenic
1079640949 11:22804771-22804793 AGTCATTGGTAGGCTGATGGAGG + Intronic
1080817779 11:35775007-35775029 AGTCATTGGTAGCTTGATTGGGG + Intronic
1081099137 11:38979882-38979904 ATACATTGATAGTCTTATGGTGG - Intergenic
1081879735 11:46438448-46438470 ATCGATTTGTAGCCTGTTGCTGG + Intronic
1082908039 11:58334049-58334071 ATCCATTGGTAGTCTAATGGAGG + Intergenic
1083518256 11:63281391-63281413 ATCCATTGGTAGCCTGATGGGGG + Intronic
1086207268 11:84274554-84274576 CTCCATTTGTACCCTGATGATGG + Intronic
1087925641 11:103915543-103915565 AGTCAATGGTAGCTTGATGGGGG - Intronic
1088490656 11:110384324-110384346 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1089118777 11:116117452-116117474 TTCCCTGGGTAGCCTAATGGTGG - Intergenic
1089815793 11:121173729-121173751 AGTCATTGGTAGCTTGATGGGGG + Intronic
1089881985 11:121782960-121782982 AGTCAATGGTAGCTTGATGGGGG + Intergenic
1092278176 12:7078364-7078386 TTCCATTTGTAGCCAGGTGGTGG - Intergenic
1094273090 12:28638966-28638988 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098151444 12:67551248-67551270 AGTCAATGGTAGCTTGATGGGGG + Intergenic
1098634102 12:72759361-72759383 ATCCACTGTTAGTCTGATGGGGG - Intergenic
1098699848 12:73610284-73610306 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1099217047 12:79865920-79865942 ACTCAGTGGTAGCTTGATGGGGG - Intronic
1100087391 12:90928393-90928415 AGTCAATGGTAGCTTGATGGGGG - Intronic
1101284678 12:103298557-103298579 AGTCATTGGTAGATTGATGGGGG - Intronic
1102352121 12:112200689-112200711 GTCCTTCGGTAGCCTGCTGGGGG + Exonic
1102700440 12:114834617-114834639 ATTCAGTGGGAGCCTCATGGGGG + Intergenic
1106348987 13:28909229-28909251 AGTCATTGGTAGCTTAATGGGGG + Intronic
1108187181 13:47899801-47899823 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1109071711 13:57777812-57777834 ATCCACTGTTAGTCTGATGGGGG + Intergenic
1109371280 13:61423152-61423174 ATCCATGGCTAGCCTAATTGAGG - Intronic
1109725648 13:66337836-66337858 ATGCATTTTTAGCCTGATGTTGG + Intronic
1110919422 13:81065632-81065654 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1112206719 13:97331387-97331409 ATCCGTTGGTAGGAGGATGGAGG - Intronic
1112854235 13:103746661-103746683 AGTCATTGGTAGCTTGATGGCGG + Intergenic
1113245904 13:108395129-108395151 ATCTATTGGTAGGTTAATGGTGG - Intergenic
1113703594 13:112408816-112408838 AGTCATTGGTAGCTTGATGGGGG - Intronic
1115325500 14:32133125-32133147 AGTCATTGGTAGCTTGATGGGGG + Intronic
1116279656 14:42887995-42888017 AGTCAGTGGTAGCTTGATGGGGG - Intergenic
1117005254 14:51414694-51414716 AGTCATTGGTAGTTTGATGGGGG + Intergenic
1117759543 14:59012845-59012867 ATCCACTATTAGTCTGATGGAGG + Intergenic
1118066731 14:62200660-62200682 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1119072789 14:71604757-71604779 ATCCACTGTTAGTCTGATGGGGG + Intronic
1120777860 14:88457264-88457286 AGTCATTGGTAGCTTGATGAGGG + Intronic
1123170937 14:106372304-106372326 ATTCCTGGGTAGCCTGATGAGGG + Intergenic
1125210903 15:37214184-37214206 AGTCAATGGTAGCTTGATGGGGG - Intergenic
1125319626 15:38470884-38470906 ATTAATTAGTACCCTGATGGGGG + Intronic
1127065553 15:55234098-55234120 ATCCATTGTTGGCCTGAAGCAGG - Intronic
1130200620 15:81823147-81823169 AGTCATTGCTAGCTTGATGGGGG - Intergenic
1130727403 15:86453506-86453528 ATATTTTGGTAGCTTGATGGAGG + Intronic
1131004984 15:88970656-88970678 ATCCACTGTTAGTCTAATGGCGG + Intergenic
1132188741 15:99829495-99829517 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1137467510 16:48723902-48723924 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1138005485 16:53332052-53332074 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1138841781 16:60517743-60517765 ATCCACTGTTAGTCTAATGGGGG - Intergenic
1140675637 16:77326627-77326649 ACACTTTGGGAGCCTGATGGGGG - Intronic
1143563265 17:7707516-7707538 ATTCAGTGGTGGCCTGAAGGAGG + Intronic
1144603154 17:16637318-16637340 AGTCATTGGTAGCTTGATGGGGG - Intronic
1145845660 17:28036705-28036727 AGTCATTGGTAGCTTGTTGGGGG - Intergenic
1146462854 17:33060700-33060722 AGTCATTGGTAGCTTGATGGGGG + Intronic
1148346791 17:46908625-46908647 TTTCATTGGCAGCCAGATGGCGG - Intergenic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1155088195 18:22477689-22477711 ATCCACTGTTAGTCTGATGGGGG + Intergenic
1155414197 18:25579899-25579921 ATCCATGGATAGTCTAATGGAGG + Intergenic
1155415009 18:25588698-25588720 AAAGATTGTTAGCCTGATGGTGG + Intergenic
1156343710 18:36236671-36236693 AGGCATTGGTAGCCTGATGGGGG + Intronic
1156653360 18:39253621-39253643 ATCCACTGTTATTCTGATGGAGG - Intergenic
1156734091 18:40231356-40231378 AGTCATTGGTAACTTGATGGGGG + Intergenic
1156887264 18:42149876-42149898 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1158017073 18:52796679-52796701 GTCCACTGTTAGTCTGATGGAGG + Intronic
1159569825 18:70100119-70100141 AGTCATTGGTAGCTTGATGAAGG + Intronic
1160543160 18:79636471-79636493 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1164384588 19:27762047-27762069 ATCCTTAGATAGCCTGAAGGCGG + Intergenic
1202708994 1_KI270714v1_random:6174-6196 ATCCACTGGTAGCCGGTTGGAGG + Intergenic
927691026 2:25208274-25208296 AGCTATTGGGAGTCTGATGGGGG + Intergenic
928067254 2:28177186-28177208 ATCTCTTGTTAGTCTGATGGAGG - Intronic
928878115 2:36065119-36065141 AGTCATTGGTAGCTTGACGGGGG - Intergenic
929838441 2:45430244-45430266 AGTCAGTGGTAGCTTGATGGGGG - Intronic
931811027 2:65855279-65855301 ATCCATTAGTAGCCTTAATGAGG + Intergenic
932070513 2:68615190-68615212 AGTCATTGGTAGCTTGATGGGGG + Intronic
934152820 2:89164821-89164843 AGTCAATGGTAGCTTGATGGGGG + Intergenic
934214422 2:90017111-90017133 AGTCAATGGTAGCTTGATGGGGG - Intergenic
935923967 2:108047354-108047376 ATTCCTTGGTGGCCTGTTGGTGG + Intergenic
936150518 2:110018452-110018474 AGTCATTGGTAGCTTGATGGGGG - Intergenic
936194158 2:110352918-110352940 AGTCATTGGTAGCTTGATGGGGG + Intergenic
938822549 2:134974358-134974380 ATCCACTGTTAGTCTGATGGGGG + Intronic
938862607 2:135385443-135385465 AGTCATTGGTAGCTTGATGGGGG - Intronic
939184124 2:138840632-138840654 ATCCAAAGGCAGCCTGCTGGAGG + Intergenic
939231284 2:139429297-139429319 ATAACTTGGTGGCCTGATGGAGG - Intergenic
939357938 2:141128090-141128112 ATCCTTTGGGAGCCTGAGGCAGG - Intronic
940232511 2:151471909-151471931 AGTCCTTGGTAGCTTGATGGGGG + Intronic
940557849 2:155255007-155255029 GTTCATTGTTAGTCTGATGGGGG + Intergenic
940684492 2:156828900-156828922 ATTCACTGTTAGTCTGATGGCGG - Intergenic
943262492 2:185683894-185683916 AGTCAGTGGTAGCTTGATGGGGG + Intergenic
944346381 2:198670929-198670951 AATCATTGGTAGCTTGATGGGGG - Intergenic
944393186 2:199241138-199241160 AGTCATTGGTAGCTTGTTGGGGG + Intergenic
945256410 2:207807050-207807072 GTCCATTGTGAGGCTGATGGGGG + Intergenic
946532740 2:220589820-220589842 ATTCATTGGTAGCATGAAGCTGG + Intergenic
948040397 2:234896892-234896914 ATCCATTCGTGGTCTGGTGGAGG - Intergenic
1174989497 20:55494034-55494056 AGTCAATGGTAGCTTGATGGGGG + Intergenic
1177910645 21:27026678-27026700 ATCCATTGATGGCCTGAAGAGGG + Intergenic
1178226833 21:30729263-30729285 AGTCAATGGTAGCTTGATGGGGG - Intergenic
1179945715 21:44673181-44673203 ATCCACTGTTAGTCTGATGGGGG - Intronic
1180897414 22:19346953-19346975 ATCAAATGGTAGCCTGTTTGTGG + Intronic
1181435482 22:22908019-22908041 ATCCATTGGTTGTCTGATGGAGG + Intergenic
1182313669 22:29427483-29427505 ATCCATTGGTTGTCTGATGGAGG - Intergenic
949595760 3:5545630-5545652 ATTCACTGATAGCCTTATGGAGG + Intergenic
951286208 3:20816942-20816964 AGTCATTGGTAGCTTGATGGGGG + Intergenic
951317092 3:21201424-21201446 ATCCACTGTTATTCTGATGGGGG + Intergenic
952603081 3:35108378-35108400 AGTCATTGGTAGCTTGATGGGGG - Intergenic
952864369 3:37842838-37842860 AGTCATTGGTAGCTTGATGGGGG - Intergenic
953046965 3:39302360-39302382 ATCCACAGTTAGTCTGATGGGGG - Intergenic
955425119 3:58779990-58780012 ATCCACTGTTAGTCTGATAGGGG - Intronic
956156917 3:66308040-66308062 AGTCAATGGTAGCTTGATGGGGG + Intronic
957881943 3:86227674-86227696 ATCTATTGGTTGCTTGATGGTGG - Intergenic
957887100 3:86301620-86301642 AGTCATTGGTAGCTTGATGGGGG - Intergenic
958547218 3:95569083-95569105 GTCCATTGTTAATCTGATGGGGG - Intergenic
958621687 3:96570830-96570852 AGTCAGTGGTAGCTTGATGGGGG + Intergenic
958626076 3:96625923-96625945 AGTCATTGGTAGCTTGATGGGGG - Intergenic
959004488 3:101004712-101004734 AGTCATTGGTAGCTTGATGGGGG + Intergenic
959210895 3:103379121-103379143 ACACATTGGTAGCTTGATGGGGG - Intergenic
960276345 3:115733678-115733700 AGTCATTGGTAGCTTGATGGAGG + Intergenic
962604207 3:137018730-137018752 AGTCGTTGGTAGCTTGATGGGGG + Intergenic
962847445 3:139284469-139284491 ATCCATCTGTAGGCTGAGGGAGG - Intronic
963453337 3:145513846-145513868 AACCAGTGGTAGACTGAAGGGGG + Intergenic
964521089 3:157568132-157568154 ATCCACTGATAGTCTCATGGGGG + Intronic
964839670 3:160980108-160980130 ATTCATCGGTAGCATGCTGGTGG + Intronic
966150145 3:176858997-176859019 AGCCAATGAAAGCCTGATGGGGG + Intergenic
966395299 3:179495743-179495765 ATCCACTGATAGCCTTATGTGGG - Intergenic
966567017 3:181395044-181395066 ATTTACTGGTAGCCTTATGGAGG + Intergenic
971442128 4:26698464-26698486 AGTCAGTGGTAGCTTGATGGGGG - Intronic
971475910 4:27071775-27071797 AGTCATTGGTAGCTTGATGGGGG + Intergenic
973000583 4:44944175-44944197 GTCCATTGGCAGCCTGATCTTGG - Intergenic
975616510 4:76252231-76252253 AGCCTTTGGTATCCAGATGGCGG + Intronic
976328789 4:83803792-83803814 ATCCACTGGTAGCTTCATGAAGG - Intergenic
977346910 4:95827843-95827865 AGTCATTGGTAGCTTGATGGGGG - Intergenic
977538213 4:98281149-98281171 AGTCATTGGTAGCTTGATGGGGG + Intronic
977671805 4:99703654-99703676 AGTCAATGGTAGCTTGATGGGGG - Intergenic
979176303 4:117668187-117668209 AGTCATTGGTAGCTTGATGGGGG + Intergenic
979190564 4:117851458-117851480 ATCTACTGTTAGTCTGATGGAGG - Intergenic
979850900 4:125570176-125570198 AGTCATTGGTAGCTTGATGGAGG + Intergenic
982190786 4:152853517-152853539 ATCCACTGATAGTCTTATGGGGG + Intronic
982575619 4:157106258-157106280 ATCCACTGATAGTCTTATGGAGG + Intronic
982826181 4:160006585-160006607 AGTCAATGGTAGCTTGATGGGGG - Intergenic
983131450 4:164024365-164024387 ATCTACTGTTAGCCTGATGGGGG - Intronic
983593875 4:169443802-169443824 AGCCATTGTTAGTCTGTTGGGGG - Intronic
983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG + Intergenic
983967132 4:173825573-173825595 ATCCATAGATAGCCAGATGTTGG + Intergenic
984014810 4:174413437-174413459 AGTCATTGGTAGCTTGATGGAGG + Intergenic
987713530 5:21535283-21535305 ATCCACTGGTTGCCTTATAGAGG - Intergenic
988176450 5:27731798-27731820 AATCATTGGTAGCTTGATGGGGG + Intergenic
988187442 5:27885431-27885453 AGTCATTGGTAGCTTGATGGGGG + Intergenic
989211866 5:38864615-38864637 ATTCATTGTTAGTCTGATGGGGG + Intronic
989214919 5:38893953-38893975 GTCCACTGTTAGCCTGATGGGGG - Intronic
991425001 5:66481737-66481759 AGTCATTGGTAGCTTGATGGGGG + Intergenic
992050682 5:72937769-72937791 AAACTTTGGTAGCCTGATTGAGG - Intergenic
993474698 5:88350251-88350273 AGTCATTGGTAGCTTGATGGGGG - Intergenic
993609885 5:90041095-90041117 AATCATTGGTAGTTTGATGGGGG + Intergenic
993960515 5:94291651-94291673 AGTCAATGGTAGCTTGATGGGGG + Intronic
994230153 5:97302515-97302537 AGTCATTGGTAGCTTGATGGGGG + Intergenic
994249065 5:97515453-97515475 AGTCATTGGTAGCTTGATGGGGG + Intergenic
994369984 5:98956834-98956856 AGTCATTGGTAGCTTGATGGGGG + Intergenic
995631856 5:114142817-114142839 AGTCATTGGTAGCTTGATGGCGG - Intergenic
995669103 5:114580157-114580179 ATCTATTGGTAGCCTGACGTGGG - Intergenic
996980706 5:129490440-129490462 ATGCATTGGTAGCCTGCTAGGGG + Intronic
997648437 5:135497343-135497365 ATCCACTGGTGGCCTTCTGGAGG + Intergenic
998886422 5:146699481-146699503 ATTCATTCGTAGAATGATGGGGG - Intronic
999109032 5:149100371-149100393 GTCCATTGTTAGTCTGATGGGGG - Intergenic
1000031283 5:157403684-157403706 ATCCACTGTTAGTCTGATGAGGG - Intronic
1000545399 5:162594054-162594076 TTCCATTGGTGGCCACATGGAGG + Intergenic
1001317382 5:170653499-170653521 ATTCATTTGTAGCCTGAGGCTGG - Intronic
1007349777 6:41261713-41261735 GTCCACTGTTAGACTGATGGGGG - Intergenic
1009003188 6:57746614-57746636 ATCCACTGGTTGCCTTATAGAGG + Intergenic
1009278871 6:61721318-61721340 AGTCACTGGTAGCTTGATGGGGG + Intronic
1010553914 6:77256106-77256128 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1010861079 6:80912638-80912660 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1010902032 6:81439687-81439709 ATCCACTGTTAGTCTGATAGGGG + Intergenic
1011392351 6:86867840-86867862 TTCCATTGTTAGTCTGAGGGTGG - Intergenic
1011527925 6:88286458-88286480 ATCCACTGGTAGCCTTATGGAGG + Intergenic
1012208884 6:96495896-96495918 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1013868015 6:114722264-114722286 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1013873957 6:114801449-114801471 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1015007332 6:128299323-128299345 AGTCATTGGTAGCTTGATGGGGG - Intronic
1015107939 6:129558768-129558790 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1015194373 6:130509043-130509065 CTCCATTGGTATCTTGATGGAGG + Intergenic
1017536780 6:155355578-155355600 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1017925872 6:158911441-158911463 AAACTCTGGTAGCCTGATGGCGG + Intergenic
1018394029 6:163363438-163363460 ATCCTTTAGTTGTCTGATGGTGG - Intergenic
1018458777 6:163977532-163977554 AGTCATTGGTAGCTTGGTGGGGG + Intergenic
1018676248 6:166224628-166224650 AGTCATTGGTAGCTTGATAGGGG - Intergenic
1019905380 7:4058627-4058649 ATCCACTGTTAGTCTGATGGGGG - Intronic
1020325507 7:6971520-6971542 AGTCATTGGTAACTTGATGGGGG + Intergenic
1024206267 7:47164259-47164281 AGTCATTGGTAGCTTGATGGAGG - Intergenic
1024397246 7:48883879-48883901 AGTCATTGGTAGCTTGATGTGGG + Intergenic
1025072746 7:55915075-55915097 ATACTTTGGGAGGCTGATGGGGG - Intronic
1026651045 7:72216166-72216188 ATGCATTAGGAGGCTGATGGGGG + Intronic
1028188779 7:87821492-87821514 AGTCATTGGTAGCTTGATGGGGG - Intronic
1028275872 7:88856144-88856166 AGTCATTGGTAGCTTGATGGGGG + Intronic
1029817450 7:103111211-103111233 AGTCAATGGTAGCTTGATGGGGG - Intronic
1029869495 7:103675489-103675511 AGTCATTGGTAGCTTGATGGGGG - Intronic
1030588492 7:111450162-111450184 AGTCATTGGTAGCTTGATGGGGG - Intronic
1031810146 7:126357475-126357497 AGCCATTTGTAGGATGATGGGGG - Intergenic
1033677254 7:143555150-143555172 ATTCACTGTTAGTCTGATGGGGG + Intergenic
1033694581 7:143774286-143774308 ATTCACTGTTAGTCTGATGGGGG - Intergenic
1033893863 7:146047268-146047290 ATGCATTTTTAGCCTGATGTTGG - Intergenic
1033951764 7:146793491-146793513 ATTCATTTATAGCCTGGTGGTGG + Intronic
1034722954 7:153311883-153311905 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1035493723 7:159302964-159302986 AGTCATTTGTAGCTTGATGGGGG - Intergenic
1036410145 8:8492367-8492389 ATCCGCTGCTAGCCTGCTGGAGG - Intergenic
1038642867 8:29341528-29341550 ATCCATTTATATCCTGAGGGAGG - Intronic
1038997700 8:32944179-32944201 ATCCACTGTTAGTCTGATGGGGG + Intergenic
1039625711 8:39050122-39050144 ATCCACTAATGGCCTGATGGGGG + Intronic
1040090380 8:43392616-43392638 AGTCATTGGTAACTTGATGGGGG + Intergenic
1040097004 8:43455459-43455481 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1042069199 8:64912184-64912206 AGTCATTGATAGCTTGATGGGGG - Intergenic
1042633468 8:70846079-70846101 ATCCACTGTTCACCTGATGGGGG - Intergenic
1043212995 8:77549337-77549359 GTCCACTGTTAGCCTGATGAGGG + Intergenic
1043569108 8:81581607-81581629 ATCCACTGTTAATCTGATGGGGG - Intergenic
1044509791 8:93061402-93061424 ATCCATTGATAGAATTATGGGGG - Intergenic
1046267654 8:111852035-111852057 ATCTACTGATAGCCTAATGGGGG + Intergenic
1047159415 8:122360712-122360734 GTCTGTTGTTAGCCTGATGGGGG + Intergenic
1047819508 8:128503157-128503179 AGCCATTGGTAGCATGAAGGAGG - Intergenic
1048796789 8:138157900-138157922 AGTCATTGGTAGCTTGATGAGGG - Intronic
1049210653 8:141385039-141385061 CTCCATGGGGAGCCTGGTGGGGG - Intergenic
1050401086 9:5255753-5255775 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1050410567 9:5360595-5360617 TCCCATTGGTAGCCTGAAGTTGG - Intronic
1050897473 9:10901301-10901323 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1051885855 9:21891903-21891925 GTCCATTGTTAGCCTGATGGGGG - Intronic
1052958130 9:34270743-34270765 ATTAAGTGGTAGGCTGATGGTGG - Intronic
1053088212 9:35246890-35246912 AGTCATTGGTAGCTTGATGGGGG + Intronic
1054808522 9:69415308-69415330 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1055902867 9:81261358-81261380 AGTCAGTGGTAGCTTGATGGGGG - Intergenic
1056931919 9:90885813-90885835 ATCCACTGTTAGTCTAATGGTGG - Intronic
1057102177 9:92372785-92372807 ATCCACTGTTAGTCTGATTGAGG + Intronic
1059967743 9:119632634-119632656 ATCCATTGGTAGTCTCAAGTAGG + Intergenic
1061453964 9:130683885-130683907 AGGCATTGGGAGCCTAATGGTGG - Intergenic
1185828374 X:3274784-3274806 AGTCATTGGTAGCTTGATGGAGG + Intronic
1186122213 X:6375340-6375362 CTCCATTGGGAGCCTTAAGGAGG - Intergenic
1186956158 X:14684355-14684377 AGGCATTGGTAGCTTGATTGGGG + Intronic
1187660254 X:21538295-21538317 ATCCACTGTTATTCTGATGGAGG + Intronic
1187946076 X:24427369-24427391 ATCCTTTGGTGGCTTGAGGGTGG - Intergenic
1188155112 X:26732154-26732176 AATCAGTGGTAGCTTGATGGAGG + Intergenic
1189188659 X:39076092-39076114 ATCCATTTGCAGCATGCTGGTGG - Intergenic
1189734166 X:44052409-44052431 AGTCAATGGTAGCTTGATGGGGG + Intergenic
1190004067 X:46717898-46717920 AGTCATTGGTAGCTTGATTGGGG - Intronic
1191028897 X:55946087-55946109 AGTAATTGGTAGCTTGATGGGGG - Intergenic
1191756921 X:64602982-64603004 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1191794406 X:65005183-65005205 AGTCAATGGTAGCTTGATGGGGG - Intronic
1191798823 X:65054626-65054648 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1192822632 X:74660371-74660393 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1193074243 X:77338553-77338575 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1193085651 X:77446487-77446509 GGCCATTGGAAGCCTGGTGGGGG - Intergenic
1193203355 X:78718770-78718792 AGTCATTGGTAGCTTGATGAGGG - Intergenic
1193553086 X:82923299-82923321 GTCCACTGTTAACCTGATGGGGG + Intergenic
1193594912 X:83434375-83434397 ATCCACTGTTAGTCTGATGGTGG + Intergenic
1193923292 X:87455454-87455476 GTCCATTGTTAGTCTGATGTAGG - Intergenic
1195414634 X:104606839-104606861 AGTCAGTGGTAGCTTGATGGGGG - Intronic
1195518724 X:105807018-105807040 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1195611884 X:106876808-106876830 TTCCCTTGGTGGCCTGATAGTGG - Intronic
1196998733 X:121414606-121414628 ATCCACTGTTAGTCTGATGAGGG + Intergenic
1197076192 X:122356058-122356080 ATCCCTTGGTACACTGTTGGTGG + Intergenic
1197447039 X:126563212-126563234 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1197913459 X:131510952-131510974 ATCCACTATTAGCCTGATGGGGG + Intergenic
1198281293 X:135145452-135145474 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1198289666 X:135227064-135227086 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1198619065 X:138486934-138486956 ATCCCTGGGTGGCCTGACGGAGG + Intergenic
1198659463 X:138952029-138952051 AGTCATTGGTAGCTTGATGGGGG - Intronic
1199051898 X:143245526-143245548 AGTCATTGGTAGCTTGATGGGGG + Intergenic
1199060983 X:143355038-143355060 AGTCATTGGTAGCTTGATGGGGG - Intergenic
1199841768 X:151656394-151656416 AGTCATTGGTAGCTTGATGGGGG + Intronic
1200413192 Y:2881777-2881799 AACCACTGGTTGCCTGCTGGTGG + Intronic
1202036829 Y:20644778-20644800 CTCCCTTGGTAGCCTGTTTGAGG + Intergenic
1202052326 Y:20794141-20794163 AGTCATTGGTAGCTTGATGGGGG + Intergenic