ID: 1083518531

View in Genome Browser
Species Human (GRCh38)
Location 11:63283771-63283793
Sequence ACCCTTTTCCTACACTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083518529_1083518531 -3 Left 1083518529 11:63283751-63283773 CCACTGGGGATCTCTAACTTACC 0: 1
1: 4
2: 19
3: 43
4: 149
Right 1083518531 11:63283771-63283793 ACCCTTTTCCTACACTGCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083518531 Original CRISPR ACCCTTTTCCTACACTGCGG AGG Intronic
901526288 1:9824851-9824873 AGGCCTTTCCTCCACTGCGGGGG - Intergenic
908181977 1:61614820-61614842 TCCTTCTTCCTACACTGTGGAGG + Intergenic
915038742 1:152949903-152949925 ATCCTTTTCCTCTACTGCGCAGG - Intergenic
918967410 1:191369480-191369502 ACCATTTTCAAACACTGCTGAGG + Intergenic
919021344 1:192109787-192109809 AGCCTTATCCTACACTTCTGAGG - Intergenic
919084950 1:192910578-192910600 TCCCTTCTCCAACACTGCTGGGG - Intergenic
923083182 1:230679691-230679713 ACCCTTATCATACACTGCATTGG + Intronic
1069997061 10:72348895-72348917 ACCCTCTTCCTACAGTGGGGTGG - Intronic
1074159944 10:110829153-110829175 GCCCCTCTCCTATACTGCGGGGG + Intronic
1075025462 10:118980319-118980341 ACCCGTTTCCCACAGGGCGGGGG - Intergenic
1076809985 10:132881443-132881465 ACACCTTTCCTACCCTGCAGAGG - Intronic
1077475589 11:2788861-2788883 ACCCTGTTCCTGCACAGGGGTGG + Intronic
1077577889 11:3398285-3398307 ACCCATTTCCTAAGCTGGGGTGG - Intergenic
1083518531 11:63283771-63283793 ACCCTTTTCCTACACTGCGGAGG + Intronic
1084887176 11:72218435-72218457 ACCCTGTTCCTTCAATGCTGGGG - Intronic
1094117283 12:26930722-26930744 ACACTTTTACTGCACTGCAGAGG + Intronic
1095349240 12:41189094-41189116 CCCCTTTGCTTACCCTGCGGTGG - Exonic
1096828199 12:54295211-54295233 ACCCTGTTCCTGCTCTGCTGGGG + Exonic
1096996538 12:55841736-55841758 AACCTTCTCCTACTCTGTGGAGG + Intronic
1097925933 12:65126261-65126283 ACCCCTGTACTACACTGCTGTGG + Intergenic
1121903039 14:97711888-97711910 ACCCTTCCCCCAAACTGCGGAGG - Intergenic
1122789336 14:104177733-104177755 GCCCTTTTCCACCACAGCGGTGG + Exonic
1130319224 15:82826242-82826264 ACCCTCATCATAGACTGCGGAGG + Intronic
1133859534 16:9581250-9581272 ACACTTTTCCTACAATTTGGGGG - Intergenic
1135788215 16:25369404-25369426 ACCCTGTTACTACACTTCTGGGG + Intergenic
1147367691 17:39970155-39970177 CCCCTTTTCCTCCAGTTCGGGGG - Intronic
1152153231 17:78616017-78616039 ACCTTCTTCCTACACTGCCTGGG + Intergenic
1160865071 19:1252779-1252801 GCCCTTTCCCTACATCGCGGGGG + Intronic
1163376832 19:16938309-16938331 CCCCCTTTCCCACACTGTGGGGG - Intronic
928791341 2:34958649-34958671 AACATTTACCTACACTGTGGAGG + Intergenic
938822855 2:134976397-134976419 ACCCTTTCCCCACACTAGGGAGG + Intronic
939111195 2:138009500-138009522 ACCCTCATCATACACTGAGGGGG - Intronic
1174175209 20:48640285-48640307 TCCCTTTCCCTACACAGAGGAGG + Intronic
1175746348 20:61459858-61459880 TCCCTTTTCCTGCCCTGGGGTGG - Intronic
1175942680 20:62545207-62545229 ACCCTGTACCTACACAGCTGTGG + Intergenic
1176781626 21:13201730-13201752 ACCCCTGTCCTACAATGAGGAGG + Intergenic
1182349118 22:29688792-29688814 ACACTTATCCTACACAGAGGTGG - Intronic
949965666 3:9353973-9353995 ACCCTTGTCTCACAGTGCGGGGG + Intronic
967141449 3:186564697-186564719 AACCTTTTTCTACTCTGAGGGGG + Intronic
967916977 3:194586018-194586040 GCACTTTACCTACACTGGGGAGG - Intergenic
970908520 4:21246205-21246227 ACCCTTTCCCTACACACAGGTGG + Intronic
975701219 4:77068548-77068570 ACCCTTTTCTTACTCTGCAGAGG - Intronic
979304928 4:119131535-119131557 TCTATTTTCCTACACTGAGGAGG - Intergenic
987766035 5:22230843-22230865 ACCCTTTTCTTACAATAGGGTGG - Intronic
990558286 5:56957986-56958008 ACCCTTTTCCTGCTCTGCTCTGG - Intronic
992444381 5:76820438-76820460 ACCCTTTTCCCTAACTGCAGAGG - Intronic
997699593 5:135887691-135887713 GCCCTTTTCCTTCTCTGTGGTGG + Intronic
1007209272 6:40178778-40178800 TCCCTTTTCCTCCACTGCCTTGG + Intergenic
1011366815 6:86591398-86591420 ACCCTTCTCTTAGACTGAGGAGG - Intergenic
1016583460 6:145656339-145656361 ACCCTTTCTCCACACTGTGGAGG - Intronic
1020451289 7:8323264-8323286 TCCCCTTTCCTCCACTGAGGTGG - Intergenic
1022174609 7:27861234-27861256 ATCCTTTTACTACTGTGCGGGGG + Intronic
1032501649 7:132404298-132404320 CCCCTTTTCCTAGACTATGGGGG + Intronic
1034669627 7:152848250-152848272 GCCCCTCTCCTACACTGCGGTGG + Intronic
1035752423 8:2005620-2005642 ACCTTTTTCCTACACAGTGTTGG - Exonic
1040598671 8:48863730-48863752 ACCCTTTTTAAACATTGCGGGGG - Intergenic
1040920931 8:52616013-52616035 ACCCTTTTCTTAGACTGCTCTGG - Intergenic
1048857606 8:138697733-138697755 AGCCTCTTCCTGCACTGCAGGGG + Intronic
1050405215 9:5301713-5301735 ACCCTTCACCTAGACAGCGGTGG + Intronic
1053104313 9:35397190-35397212 ACTCTTTTCCTGCTCTGTGGTGG + Exonic
1062145500 9:134987502-134987524 ACCCTTTCCCTTCACTAAGGGGG - Intergenic
1185545981 X:946131-946153 AGCCTCTTCCTACCCTGCTGTGG - Intergenic
1192393356 X:70753759-70753781 ACCCTTGTCCTATCCTGCTGTGG - Intronic
1194176384 X:90653944-90653966 ACCATTTGATTACACTGCGGGGG + Intergenic
1194532478 X:95068715-95068737 ACCAATGTCCTACACTGCTGTGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic