ID: 1083526595

View in Genome Browser
Species Human (GRCh38)
Location 11:63372065-63372087
Sequence TTCCCAGGACAGTATCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083526595_1083526601 24 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526601 11:63372112-63372134 GATCACAGGGTGGTAAAAGAAGG 0: 1
1: 0
2: 3
3: 11
4: 191
1083526595_1083526598 11 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526598 11:63372099-63372121 ACCAATTTTAATAGATCACAGGG 0: 1
1: 1
2: 1
3: 20
4: 232
1083526595_1083526603 26 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526603 11:63372114-63372136 TCACAGGGTGGTAAAAGAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 251
1083526595_1083526597 10 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526597 11:63372098-63372120 GACCAATTTTAATAGATCACAGG 0: 1
1: 0
2: 0
3: 7
4: 118
1083526595_1083526604 30 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526604 11:63372118-63372140 AGGGTGGTAAAAGAAGGGGTAGG 0: 1
1: 0
2: 2
3: 36
4: 371
1083526595_1083526602 25 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526602 11:63372113-63372135 ATCACAGGGTGGTAAAAGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 230
1083526595_1083526600 14 Left 1083526595 11:63372065-63372087 CCTCTGTGATACTGTCCTGGGAA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 1083526600 11:63372102-63372124 AATTTTAATAGATCACAGGGTGG 0: 1
1: 0
2: 2
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083526595 Original CRISPR TTCCCAGGACAGTATCACAG AGG (reversed) Intronic
902212108 1:14911727-14911749 TCCCTAGGACAGTTTCCCAGTGG + Intronic
905394923 1:37660930-37660952 TTCCCAGGAGAGCAGCCCAGAGG + Intergenic
905773001 1:40650239-40650261 TTCCCAGGACAGGGTCACCATGG + Intronic
906273124 1:44497025-44497047 TCCCTAGGCCAGTGTCACAGAGG - Intronic
906372069 1:45262489-45262511 GCTCCAGGACAGTATGACAGAGG - Intronic
908439675 1:64141414-64141436 TCCCAAGGACAGTACCACGGGGG + Intronic
915784383 1:158593234-158593256 TGCCCAGGCCAGTATCACAAGGG - Intergenic
917456048 1:175186940-175186962 TTGCCAGCACAGCATAACAGTGG - Intronic
918436544 1:184519597-184519619 TACCCAGAACAATAACACAGTGG + Intronic
919963139 1:202492535-202492557 TTCCCCCCACAGTGTCACAGGGG - Intronic
923180986 1:231519335-231519357 TTACCAGGAGAGTATGAAAGGGG + Intergenic
924243571 1:242061479-242061501 TTACCAAGAGAATATCACAGAGG - Intergenic
1063087069 10:2829926-2829948 CTCGCAGGACAGTAGGACAGTGG + Intergenic
1063448308 10:6134219-6134241 AGCCCAGGACAGTGTCACAGGGG - Intergenic
1064722989 10:18248832-18248854 TTCCCAGGAAAATAAGACAGAGG - Intronic
1066746223 10:38605428-38605450 TTCCCAGCTCAGTACCAAAGAGG + Intergenic
1067241343 10:44497308-44497330 TTCCCTGTCCAGTAGCACAGGGG + Intergenic
1067535086 10:47103150-47103172 TTCCCAGGATGGTATTTCAGTGG + Intergenic
1069864296 10:71491981-71492003 TGCCCAGCACAGCTTCACAGTGG + Intronic
1074060907 10:109964742-109964764 TTCCCAGGACAGCAAGAAAGTGG + Intergenic
1074547998 10:114416782-114416804 TTCCTATGACATTATCACAATGG - Intergenic
1076071204 10:127491215-127491237 TTCCCATTACAGTCTCCCAGAGG - Intergenic
1077718027 11:4600686-4600708 TTCCCAGGACGATATTATAGCGG + Exonic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1079623232 11:22581352-22581374 TTTCCAGCAAAGTATCACAGAGG + Intergenic
1080781579 11:35434607-35434629 TCCCCAGGTCAGTAACACAGTGG + Exonic
1082088075 11:48066494-48066516 TTCCCAGGAAACAGTCACAGTGG - Intronic
1082748130 11:56989711-56989733 TTCCCAGGAAAATATGAAAGTGG + Exonic
1082751123 11:57018889-57018911 TTCCCAGGAGAATATGAAAGTGG + Intergenic
1083526595 11:63372065-63372087 TTCCCAGGACAGTATCACAGAGG - Intronic
1085866532 11:80301374-80301396 TTGCCAAGACAGAATGACAGAGG - Intergenic
1089014903 11:115157758-115157780 TTCCCAGGACAGAAGCACAGAGG - Intergenic
1089360532 11:117883219-117883241 TTCCAAGGAAGGTATAACAGTGG + Intergenic
1092168881 12:6360841-6360863 TTGCAAGGACATTATAACAGGGG + Intronic
1092436241 12:8449019-8449041 TATTCAGAACAGTATCACAGGGG - Intergenic
1093333221 12:17868757-17868779 TTCCCATGACAGTGTTAAAGAGG + Intergenic
1098691223 12:73490222-73490244 TTTCCAGGAAGGTAACACAGTGG + Intergenic
1100513807 12:95306226-95306248 TGCCCAGTACAGAATGACAGTGG - Intergenic
1101445904 12:104736659-104736681 TTCACAGGCCAGACTCACAGAGG - Intronic
1104778171 12:131403426-131403448 CTCCCAGGACAGCAGCACACTGG + Intergenic
1105048753 12:133028886-133028908 TTCCCAGTACAGCAACACTGGGG + Intergenic
1105927565 13:25020979-25021001 TTCACAGCACAGCCTCACAGTGG - Intergenic
1105952783 13:25245837-25245859 TTCCCAGGACAGAGTTAAAGTGG - Intergenic
1106184280 13:27395194-27395216 TTCCCAGGACTGGATCACCTGGG - Intergenic
1106459563 13:29957089-29957111 TTCCCAGGCATGTATCTCAGAGG - Intergenic
1106562288 13:30857152-30857174 TCCCCAGGCCAGCATCTCAGTGG - Intergenic
1108066797 13:46586291-46586313 TGCCCAGGAAGGTCTCACAGAGG + Intronic
1108080552 13:46730455-46730477 TCCCCAGGAGAGCCTCACAGTGG + Intronic
1108177224 13:47805098-47805120 TTCTCAGCAAAGTATCACACAGG + Intergenic
1109355396 13:61226756-61226778 TTCTAGGAACAGTATCACAGGGG + Intergenic
1112426550 13:99306904-99306926 TTCTCAGGATAGAATCTCAGGGG - Intronic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG + Intergenic
1115936730 14:38560822-38560844 TCACAAGGACAGTACCACAGGGG + Intergenic
1116251495 14:42489193-42489215 CTCCCAGGAGAGCACCACAGCGG + Intergenic
1117168610 14:53067047-53067069 TTCCCAGGATAGTATCAAGTAGG + Intronic
1119607798 14:76035715-76035737 TTCCCAGAAAGGTGTCACAGAGG + Intronic
1119610659 14:76059107-76059129 TCCAGAGGACAGCATCACAGAGG - Intronic
1121678823 14:95776022-95776044 TCGCGAGGACAGTACCACAGGGG + Intergenic
1121946428 14:98127036-98127058 TTACAATTACAGTATCACAGTGG + Intergenic
1202854464 14_GL000225v1_random:42240-42262 TTGCCAGGACAGTCTCACACAGG - Intergenic
1123508143 15:20966516-20966538 TTCCTAGAACAGAATGACAGTGG + Intergenic
1123565363 15:21540263-21540285 TTCCTAGAACAGAATGACAGTGG + Intergenic
1123601626 15:21977553-21977575 TTCCTAGAACAGAATGACAGTGG + Intergenic
1124500097 15:30220826-30220848 TTCCCACAACAATGTCACAGTGG - Intergenic
1124743478 15:32317840-32317862 TTCCCACAACAATGTCACAGTGG + Intergenic
1125318551 15:38458186-38458208 TTTCCAGGCCAGTACCCCAGTGG - Intronic
1126984216 15:54284435-54284457 CTCCCAGGACACTTTCACACAGG + Intronic
1127642583 15:60929826-60929848 TTCCCAGGTCCGTATCTCTGGGG - Intronic
1127964989 15:63916581-63916603 TTCCCAGGAAAGGAGCACATGGG + Intronic
1131111658 15:89768236-89768258 ATCCCAGGGCAGGAACACAGGGG - Intronic
1131308809 15:91269249-91269271 TTCAGAGGACAGTTTCAAAGAGG - Intronic
1202973734 15_KI270727v1_random:267353-267375 TTCCTAGAACAGAATGACAGTGG + Intergenic
1132502216 16:289592-289614 TCCCCAGGACAAGATCGCAGAGG - Exonic
1133800931 16:9084737-9084759 TTCCCAGGTCAGAAACAAAGCGG + Intergenic
1134075823 16:11290643-11290665 TTCTCAGCACAGGAGCACAGGGG - Intronic
1139975717 16:70808509-70808531 TTTCCAGTACAGTATTAGAGTGG - Intronic
1141014997 16:80440917-80440939 TTCAAAGGACAGAATCCCAGTGG + Intergenic
1142163720 16:88573512-88573534 ATCCCCAAACAGTATCACAGGGG - Intronic
1145997571 17:29113423-29113445 TGCCCAGGACACTAGCACAAAGG + Intronic
1146662240 17:34672514-34672536 TTCCCAGGACATGAGCAGAGGGG + Intergenic
1147411520 17:40256252-40256274 AGCCCTGGACTGTATCACAGTGG + Intronic
1149089631 17:52762687-52762709 TTCCAGGAAAAGTATCACAGTGG + Intergenic
1151323490 17:73365328-73365350 TTCCCAGGACACATTCACTGAGG + Exonic
1152000506 17:77642307-77642329 TTTCCATGACATTGTCACAGAGG + Intergenic
1152418768 17:80180508-80180530 GGCCCAGGACAGTGACACAGAGG - Intronic
1153954755 18:10086832-10086854 TCACCAGGTCATTATCACAGTGG - Intergenic
1156872096 18:41956947-41956969 TGCACAGGATACTATCACAGAGG - Intronic
1158964482 18:62611191-62611213 TTCACCGGTCAGTGTCACAGGGG + Intergenic
1161963862 19:7537110-7537132 TTCCCAAGTCAATATCTCAGAGG + Intronic
1163642702 19:18470492-18470514 TCCCCAGGACATTCTCTCAGGGG - Intronic
1164254776 19:23517981-23518003 TTGCAAGGACAGTTGCACAGGGG - Intergenic
1164565043 19:29319711-29319733 TCCCCAGGTCCGCATCACAGCGG + Intergenic
1165190752 19:34061322-34061344 CTCCCAGGATAGGATCACAAAGG + Intergenic
1166245518 19:41522849-41522871 TTTCAAGAACAATATCACAGGGG + Intergenic
925571633 2:5318564-5318586 TTCTCAGGACAGTCTTTCAGGGG + Intergenic
927156328 2:20223712-20223734 TTCCCAGGAAAGGGTTACAGGGG + Intronic
928086359 2:28348538-28348560 CTCCCAGGCAGGTATCACAGCGG + Intergenic
928744812 2:34399539-34399561 TTCCCTGGGCAGAATTACAGGGG + Intergenic
934158503 2:89225758-89225780 TTCCCAATACAGCAGCACAGTGG + Intergenic
936946669 2:117937298-117937320 TTCCCAGGACTGTATCATTGGGG - Intronic
938138966 2:128781311-128781333 TTCCCATGCCTGTGTCACAGTGG - Intergenic
938161154 2:128985619-128985641 TTCCCAGGACAGAAACACAGTGG - Intergenic
939994459 2:148907168-148907190 TTCACAGGACAGCAGCAAAGAGG - Intronic
940984584 2:160039874-160039896 TTCCAATGACAGTTTCCCAGTGG - Intronic
944414348 2:199467899-199467921 TTCCCAGGCCAGAATCGCAGGGG - Intronic
944599155 2:201285515-201285537 TTCCCAGGTCAGTTACAAAGTGG + Intronic
949034577 2:241810616-241810638 TGCCCAGGCCAGAATCTCAGAGG - Intronic
1169535763 20:6538113-6538135 CTCCCAGTTCAGTATGACAGAGG - Intergenic
1171389265 20:24790665-24790687 GTCCCAGGACAGAATGACACTGG + Intergenic
1172511826 20:35505984-35506006 TTCCCAGTACAGCCTCCCAGTGG - Intronic
1173954838 20:47023166-47023188 TTCCCACGAAATTATTACAGTGG - Intronic
1174830211 20:53805460-53805482 TCCCCAGGATGGCATCACAGAGG - Intergenic
1175682528 20:61000806-61000828 TTCTCTGGCCAGTGTCACAGGGG + Intergenic
1175916487 20:62428350-62428372 TTCCCTGGACAGCAACACTGTGG + Intergenic
1177012656 21:15747075-15747097 TTCACAGAAAAGAATCACAGTGG - Intronic
1180232412 21:46435104-46435126 GTCCCAGTACAGGACCACAGGGG + Intronic
1181850734 22:25748224-25748246 TCCCCAGGACAGTCACACAGTGG - Intronic
1181982741 22:26777395-26777417 ACCCCAGGACAGGGTCACAGTGG + Intergenic
949885041 3:8685767-8685789 TATTCAGCACAGTATCACAGGGG + Intronic
953837300 3:46357873-46357895 TTCACAGGGCTGTATCACATCGG + Exonic
954220558 3:49151021-49151043 TTCCCAGGACAGTATGGGAAAGG - Intergenic
955572929 3:60327257-60327279 TCCCCAGGACTGGATGACAGAGG + Intronic
956764162 3:72470046-72470068 TTCCCAGGACAGAATCTGATTGG - Intergenic
956835974 3:73096492-73096514 TTTCCAGGACAGAGTCACAAAGG - Intergenic
959749225 3:109813323-109813345 TTCACAGGATAGATTCACAGTGG + Intergenic
961507242 3:127378185-127378207 TTCTCAGGACAGGCTCTCAGGGG + Intergenic
962711292 3:138088568-138088590 TACCCAGAACAGTGTCAGAGGGG + Intronic
962887668 3:139642512-139642534 TTCCCAGGGCAGCGCCACAGTGG - Intronic
962956780 3:140274080-140274102 CTCCCAGGACACTGTCTCAGAGG - Intronic
968030539 3:195482156-195482178 TTCCCTGTATAATATCACAGAGG + Intergenic
968030785 3:195486857-195486879 TTCCCTGTATAATATCACAGAGG + Intergenic
969364670 4:6687264-6687286 GTCTCAGGACATTCTCACAGGGG - Intergenic
969994931 4:11302288-11302310 TCCCCAGGAAAGCATCACCGGGG - Intergenic
971761244 4:30768528-30768550 TTAGCAGGACTGAATCACAGGGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972395799 4:38658647-38658669 ATCCAAGGACAGTGGCACAGTGG - Intergenic
973015502 4:45132774-45132796 TTCACAGGAGAGTATTAGAGAGG - Intergenic
973640256 4:52895434-52895456 TTCTCAGCAAAGTATCACAAAGG - Intronic
975853262 4:78595431-78595453 TGCCCAGGTCAGTAACAAAGCGG + Exonic
984150072 4:176118692-176118714 TTTCCAGGACAGTAGCACAGTGG + Intronic
990502466 5:56410187-56410209 TCCCAAGGACAGCATCACAAGGG - Intergenic
992789366 5:80199824-80199846 TTCCCACCACAGTACCACAGTGG + Intronic
993126170 5:83838334-83838356 TTCACAGGCCTGTATGACAGGGG + Intergenic
1003651877 6:7968479-7968501 TTCCCAGGTCACTGTCACTGCGG + Intronic
1004089573 6:12487410-12487432 TTGCTAGGCCAGTATCTCAGAGG - Intergenic
1011528284 6:88290765-88290787 TTGCCAGGGTAGTTTCACAGAGG + Intergenic
1015550101 6:134402960-134402982 TTCCCAGGACAATACTCCAGGGG + Intergenic
1017849735 6:158294769-158294791 TTCCCAGGCCTGGAGCACAGTGG + Intronic
1018335266 6:162780020-162780042 TTCACAGGACAGTATGACACAGG + Intronic
1019647777 7:2140215-2140237 TCCCCAGGCCAGTGTCCCAGAGG + Intronic
1021639672 7:22725251-22725273 TTCCCAGGCTAGGATAACAGAGG + Intergenic
1022416880 7:30186407-30186429 CTCACAGGTCAGTATCACTGGGG + Intergenic
1023073440 7:36460231-36460253 CTCCCAGAACAGTATAATAGTGG + Intergenic
1026548667 7:71347720-71347742 TTCCCAGGCCTGGATCAGAGGGG + Intronic
1029158963 7:98538150-98538172 TTCCCAGGTAAGTTTCAGAGAGG - Intergenic
1032695194 7:134329880-134329902 CTCCCAGGACAAACTCACAGTGG - Intergenic
1032786546 7:135205297-135205319 TTCCCAAGACTTTACCACAGTGG + Intronic
1034281198 7:149855697-149855719 TTCACAGGGGAGTATCACACTGG + Intronic
1034479879 7:151311416-151311438 TTCCCAGGACAGTGCCCTAGTGG + Intergenic
1037689667 8:21171390-21171412 TTATTAGAACAGTATCACAGTGG + Intergenic
1039954205 8:42194953-42194975 TGCCGAGGGCAGGATCACAGAGG - Intronic
1041111487 8:54487102-54487124 TTCCCAGGTCAAAGTCACAGAGG - Intergenic
1041698545 8:60762955-60762977 ATCACATGACAGTAGCACAGAGG + Intronic
1041713323 8:60912187-60912209 TTCACAGGGCAGTCTCAAAGGGG + Intergenic
1041906984 8:63044048-63044070 TTCTCAGGCCAGGAACACAGTGG - Intergenic
1042612472 8:70614165-70614187 TTGCCAGGCCAGTATGACAAAGG + Intronic
1043321807 8:78996143-78996165 TTGCAAGGACAGTACCAAAGGGG + Intergenic
1043940720 8:86192789-86192811 TTCCCATGACAGAATTTCAGTGG + Intergenic
1047127949 8:121983996-121984018 TTCACAGGGAAGTATCAGAGAGG - Intergenic
1047578802 8:126189695-126189717 TTTCCAGCACAGTTTCTCAGAGG + Intergenic
1048291145 8:133182707-133182729 TTCCCAGGACTGTGACCCAGAGG - Intergenic
1049324524 8:142015086-142015108 GTCCCAGGACAGTCTTGCAGGGG - Intergenic
1051232140 9:14965198-14965220 TTTCAAGAACAATATCACAGGGG + Intergenic
1051259074 9:15244343-15244365 TACCTAGGACAGGAACACAGTGG - Intronic
1052050578 9:23843309-23843331 TTGCCAGGAGAGAATCCCAGAGG + Intergenic
1052549481 9:29929666-29929688 TTTCCAGGCAAGTATAACAGAGG - Intergenic
1056022274 9:82451842-82451864 TTCCCAGAACCTTCTCACAGGGG - Intergenic
1057020100 9:91690753-91690775 GGCCCAGGACAGCTTCACAGTGG + Intronic
1057746979 9:97760170-97760192 TTCCCAGTGCAGTCTGACAGAGG - Intergenic
1059584441 9:115590979-115591001 TCCACAGGACAGTCACACAGTGG - Intergenic
1059957193 9:119529766-119529788 TTACCAAGAAAGTATAACAGAGG - Intergenic
1060016222 9:120088587-120088609 TTTCCAGGAATGCATCACAGTGG + Intergenic
1061380990 9:130257531-130257553 AGCCCAGTGCAGTATCACAGGGG + Intergenic
1186614902 X:11176012-11176034 TTATTAGGACAGTATCCCAGTGG - Intronic
1187506701 X:19884116-19884138 TGCCCAGGACAGTGTCTTAGAGG - Intronic
1189591699 X:42519301-42519323 TTCACACGAAAGTATCACATTGG + Intergenic
1190068508 X:47260194-47260216 ATCCCAGAGCATTATCACAGAGG - Intergenic
1190406209 X:50090375-50090397 TACTCAGGACAGTATGACTGTGG + Exonic
1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG + Intronic
1191111277 X:56804581-56804603 TGCCCAGCACAGGAACACAGAGG - Intergenic
1201176710 Y:11314359-11314381 TTGCCGGGACAGTCTCACACAGG - Intergenic
1201177841 Y:11321006-11321028 TTGCCGGGACAGTCTCACACAGG - Intergenic