ID: 1083528935

View in Genome Browser
Species Human (GRCh38)
Location 11:63398627-63398649
Sequence ATAGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 3, 2: 44, 3: 105, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083528935_1083528948 30 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528948 11:63398680-63398702 GGCAGCCACTGCTGGGAGATGGG 0: 1
1: 4
2: 8
3: 48
4: 381
1083528935_1083528944 22 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528944 11:63398672-63398694 CTGCACCAGGCAGCCACTGCTGG 0: 1
1: 1
2: 19
3: 71
4: 429
1083528935_1083528941 9 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528941 11:63398659-63398681 ACACAAAGATGCCCTGCACCAGG 0: 1
1: 0
2: 1
3: 14
4: 165
1083528935_1083528945 23 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528945 11:63398673-63398695 TGCACCAGGCAGCCACTGCTGGG 0: 1
1: 1
2: 14
3: 68
4: 318
1083528935_1083528947 29 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528947 11:63398679-63398701 AGGCAGCCACTGCTGGGAGATGG 0: 1
1: 1
2: 10
3: 63
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083528935 Original CRISPR ATAGAGAGCACAGTGATTGT GGG (reversed) Intronic