ID: 1083528935

View in Genome Browser
Species Human (GRCh38)
Location 11:63398627-63398649
Sequence ATAGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 3, 2: 44, 3: 105, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083528935_1083528947 29 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528947 11:63398679-63398701 AGGCAGCCACTGCTGGGAGATGG 0: 1
1: 1
2: 10
3: 63
4: 542
1083528935_1083528941 9 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528941 11:63398659-63398681 ACACAAAGATGCCCTGCACCAGG 0: 1
1: 0
2: 1
3: 14
4: 165
1083528935_1083528945 23 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528945 11:63398673-63398695 TGCACCAGGCAGCCACTGCTGGG 0: 1
1: 1
2: 14
3: 68
4: 318
1083528935_1083528948 30 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528948 11:63398680-63398702 GGCAGCCACTGCTGGGAGATGGG 0: 1
1: 4
2: 8
3: 48
4: 381
1083528935_1083528944 22 Left 1083528935 11:63398627-63398649 CCCACAATCACTGTGCTCTCTAT 0: 1
1: 3
2: 44
3: 105
4: 331
Right 1083528944 11:63398672-63398694 CTGCACCAGGCAGCCACTGCTGG 0: 1
1: 1
2: 19
3: 71
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083528935 Original CRISPR ATAGAGAGCACAGTGATTGT GGG (reversed) Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
905864766 1:41370765-41370787 ATAGAGAGCACCCTGAAGGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909608334 1:77528927-77528949 ATACATACCTCAGTGATTGTTGG + Intronic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910044860 1:82901172-82901194 AGAGAGAGCATAGTGTTGGTAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910467146 1:87512204-87512226 ATAGAAAGCACAGTGCTAATAGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911586999 1:99703031-99703053 ATAGAGAGAAGAGAGATTGATGG - Intergenic
912134700 1:106646545-106646567 ATTGAGAGCAGAGTGGATGTTGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913552305 1:119927493-119927515 ACATTGAGCACAGTTATTGTGGG - Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916427164 1:164691618-164691640 ATAGAGAGCAGAGAGCTTGCAGG + Intronic
916463922 1:165054165-165054187 CTAGAGAGCCCAGTGAGGGTAGG - Intergenic
917047255 1:170874937-170874959 TTAGAGAGCACAGTGGAGGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918688792 1:187453742-187453764 ATAGAGAGAACAGTGTTTATTGG - Intergenic
918755966 1:188339667-188339689 ATAGAGAGAAGAGTGATTACAGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924133785 1:240940879-240940901 ATAGAGTGCAAAGTGTATGTTGG + Intronic
924432198 1:244006801-244006823 ATAGACACCTCAGTGTTTGTGGG - Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065045210 10:21741409-21741431 ATAGAGAACACAGTGCTGGGAGG + Intronic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068302056 10:55156683-55156705 CTAGAGATCACTGTGATTATGGG + Intronic
1068353510 10:55880965-55880987 CTAGAGAGTATAGTGAGTGTTGG - Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070505818 10:77111792-77111814 TTAGAGAGCACAGCCATTGTGGG - Intronic
1070658651 10:78289167-78289189 ATAGATAGCACACTGATGGTGGG - Intergenic
1071185544 10:83039883-83039905 AAAGAGAGCAAATAGATTGTAGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072857504 10:98964548-98964570 ATAGAGAGTAGAGTGATTAGTGG - Intronic
1073650404 10:105352543-105352565 ACAGAGAGTACAGTGGTGGTGGG - Intergenic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074687740 10:115975370-115975392 ATAGAAAGCACAGCCCTTGTGGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078561424 11:12376779-12376801 ATACAAAGCACAGTGTTTGAAGG - Intergenic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080600522 11:33817646-33817668 GCATAGAGCACAGTCATTGTGGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1085777389 11:79379020-79379042 ATAGAGGTTACAGTGCTTGTAGG + Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1092093025 12:5819739-5819761 ATACAGAGAAGAGTGATTATAGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093144095 12:15543839-15543861 ATAAAGAGCATACTGATTGAAGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098085256 12:66835715-66835737 GTAAAAAGAACAGTGATTGTTGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101010156 12:100441149-100441171 AGAGAGAGCACAGAGAAGGTAGG - Intergenic
1101488536 12:105190834-105190856 ACAGAGAGCACAGTATTTGATGG - Intronic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1101948070 12:109153358-109153380 ATAGAATGCATAATGATTGTAGG + Intronic
1104191540 12:126486265-126486287 ATAGAAAACACAGTATTTGTGGG - Intergenic
1104207524 12:126654242-126654264 ATAGAGAACTCAGTAATTGAAGG + Intergenic
1104387235 12:128361554-128361576 AAAGAGTACACAGTGATTGCTGG + Intronic
1107215324 13:37911090-37911112 AAAGAGAGCACAGTGTTACTTGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119211100 14:72832745-72832767 ATAGAGAACATGGTGAGTGTGGG - Intronic
1119222621 14:72921312-72921334 ATAGATGTCACAGTGAGTGTGGG + Intergenic
1119648559 14:76366911-76366933 ACAGTGAGTACAGTGATTGATGG - Intronic
1120012362 14:79431386-79431408 ATAGAGAGTATATTAATTGTTGG + Intronic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121351443 14:93176490-93176512 AAAGAGAGCACAGATTTTGTAGG + Intergenic
1125695935 15:41637314-41637336 ATAGAGATCAGAGGGAATGTTGG + Intronic
1126146379 15:45476633-45476655 ACAGTGATCACAGTGAATGTTGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127985173 15:64064116-64064138 ATAGAAGCCACAGTGAATGTTGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129642266 15:77392965-77392987 AAAGAGAGCACACCGCTTGTGGG + Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136129414 16:28210856-28210878 TTAGAGAGCTGGGTGATTGTAGG - Intronic
1137044912 16:35645657-35645679 ATAGAAAGCCCAGTAATAGTGGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139549021 16:67663339-67663361 ACAGTGAGAACAGTGAGTGTTGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143798573 17:9358759-9358781 ATAGAGAGGACAGTAATTAAGGG + Intronic
1144145178 17:12390301-12390323 ATAGAAATGACATTGATTGTAGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145725065 17:27113012-27113034 CTAGAGATCACTGTGATTATGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146246806 17:31292560-31292582 ATTGAAAGCACAGTATTTGTGGG - Intronic
1147430645 17:40368529-40368551 ATCGAGAGCACAAAGATTCTAGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150202077 17:63368062-63368084 ATAGAGAGCAGAGTGTATGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1154134357 18:11762583-11762605 ATAGAGAGGACAGTGCTTCAGGG + Intronic
1155195958 18:23474769-23474791 ATAGAGAGCTCAGGGACTGATGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
925119992 2:1410903-1410925 ATGGAGAGCAGAGAGATTGCAGG - Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925745724 2:7042001-7042023 ATAGGGACCACAGAGATTCTGGG + Exonic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927002771 2:18816082-18816104 GTAGTGAGCACAGTGGTTCTTGG - Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
930207368 2:48601683-48601705 AAAGAGATCAGAGAGATTGTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932124591 2:69132282-69132304 ATAGAGGCCACAGTGACTGCAGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933061032 2:77736678-77736700 TTAAAGAGCACATTGATTGGTGG - Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
936462933 2:112725211-112725233 GTAGACAGCACAGTGCTGGTGGG - Exonic
939529022 2:143334197-143334219 TTAGAGAGATCTGTGATTGTTGG - Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942199000 2:173552259-173552281 ATAGAGTGAAGAGTGGTTGTAGG + Intergenic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945423917 2:209675042-209675064 ATAGAGTTCACAGTGAATTTAGG - Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947353893 2:229272570-229272592 AGAGAGAACACAATGTTTGTGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170577282 20:17673920-17673942 ATAGTAATCACAGTGATTGAGGG - Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171036407 20:21715531-21715553 GTAGGGAGCACAGGGGTTGTTGG + Exonic
1171567278 20:26207687-26207709 ATAGAGAGCAAAGAAATGGTGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180741708 22:18057626-18057648 ATAGAGACCAAAGTGACTATGGG + Intergenic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
1182611297 22:31549776-31549798 ATAGAGTTCATTGTGATTGTAGG + Intronic
1183852641 22:40604061-40604083 ATAAAGAACAAAGTGATTCTTGG + Intronic
1184382837 22:44156836-44156858 ACAGAGAGCAGAATGATTGGTGG + Intronic
949251471 3:1989554-1989576 ATGGAAAGCACATGGATTGTTGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955038495 3:55292374-55292396 ATAGAGTGCTCTGTGATTCTTGG - Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956064300 3:65380532-65380554 ATAGAAAGCAGAATGATGGTTGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957840577 3:85663528-85663550 TTAGTGAGCACAGAGGTTGTTGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964216188 3:154286195-154286217 ATTGAGAGTAAAGTGTTTGTTGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964494919 3:157278405-157278427 AAAGAGAGCAGAGGGAATGTGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965175394 3:165323770-165323792 TTAGAGAGCCCAGCTATTGTTGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965374001 3:167898830-167898852 ATAGAGAGGACAGAAATTCTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970645197 4:18111913-18111935 CTAATGAGCACAGTGCTTGTCGG - Intergenic
971601163 4:28593807-28593829 TTAAAGAGCCCAGTGATTTTGGG + Intergenic
971616800 4:28800915-28800937 TTGGAGATCACAGTGATAGTAGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976108071 4:81640704-81640726 ATAGAGAGCACTGAGAATATTGG + Intronic
976413414 4:84743647-84743669 TTAGAGAGGAAAGTGATTATAGG + Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979308716 4:119177137-119177159 ATAGTGAGCAAAGGGATTGATGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982690019 4:158538051-158538073 CAAGAGAGAACAGTGTTTGTAGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
983996528 4:174189197-174189219 ATAGAGAGAACATAGAGTGTAGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987069061 5:14318690-14318712 ATTGAGAGGACAGACATTGTGGG + Intronic
987937532 5:24486268-24486290 GTAGAGAGCACACTGATCTTTGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
989068900 5:37490159-37490181 ATAGAGAGCACTGGGGTTGCTGG + Intronic
992535681 5:77700557-77700579 ATAGAGATCACACTGAATGCTGG + Intronic
992586327 5:78244033-78244055 ATAGTGAGCACAGTGAGAATGGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997762549 5:136463484-136463506 ATGCTGAGCACAGTGATTGGAGG - Intergenic
1000209496 5:159096993-159097015 ATCGAGAGGACAGCGTTTGTGGG - Exonic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001327693 5:170741277-170741299 AAAGAGACCACAGTGATTCAAGG + Intergenic
1002332999 5:178457968-178457990 ATAGAGACCACAGTGAATATGGG - Intronic
1005250266 6:23937591-23937613 ATAGAGACCAGAGTGAGTCTTGG - Intergenic
1006531083 6:34654714-34654736 ATAGAGGGCACACTGATGTTTGG + Exonic
1007327006 6:41070279-41070301 ATAAAAAGCAAAGTGTTTGTGGG - Intronic
1007533880 6:42567055-42567077 GTAGAGAAAACAGTGATTGTAGG + Intronic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010341082 6:74753568-74753590 ATACAGGGCACAGTGATGGAGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012111103 6:95234840-95234862 ATAGAGAGTTGAGTGATGGTAGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013626884 6:111947244-111947266 ATAGAGAGCAGAATGAATGGCGG + Intergenic
1013929207 6:115510199-115510221 ATAGAGAGAAAAGTAATCGTTGG - Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1014853788 6:126374073-126374095 ATAGAGATCACAGGGATAGAGGG + Intergenic
1015159969 6:130142190-130142212 ATATAGGGCACCATGATTGTAGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015439065 6:133226379-133226401 ATAAAGAGCAAAGTGAATCTGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016814969 6:148294871-148294893 ATATAGAGCACAGGGAGTGGTGG - Intronic
1018505025 6:164456821-164456843 ATAGAGATATCAGTGATTGAAGG - Intergenic
1019797311 7:3060365-3060387 ATAAAGAGAAGAGTGATTGTTGG - Intergenic
1020470722 7:8531507-8531529 ATAGAGAGTACAGTAACTGAAGG - Intronic
1020750628 7:12136758-12136780 ATAGAGAGGACAGTAAAAGTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022472814 7:30692218-30692240 TTAGAGAGCTCAGTGATGGGAGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022938834 7:35210784-35210806 ATAGAAAGCACATTTCTTGTAGG + Intronic
1023489687 7:40725753-40725775 ATCAAGAACACAGTGATTCTGGG - Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023830996 7:44039001-44039023 ATAGAGAGCCCAGGGAATGAGGG + Intergenic
1024291263 7:47806237-47806259 ATAGGGGGCAGAGTGAATGTAGG - Intronic
1024568985 7:50708997-50709019 GTAGAGAGCATAGTGATTAAGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024882096 7:54098743-54098765 ATAGGGAGCACAGAGATTTTGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1026226047 7:68442052-68442074 ATAAACATTACAGTGATTGTAGG - Intergenic
1026771755 7:73206299-73206321 TTAAAGAGCAGAGTGACTGTGGG + Intergenic
1027012623 7:74759695-74759717 TTAAAGAGCAGAGTGACTGTGGG + Intronic
1027075417 7:75186358-75186380 TTAAAGAGCAGAGTGACTGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029741328 7:102493310-102493332 ATAGAGAGCCCAGTGAATGAGGG + Intronic
1029759318 7:102592479-102592501 ATAGAGAGCCCAGTGAATGAGGG + Intronic
1029776687 7:102688389-102688411 ATAGAGAGCCCAGTGAATGAGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031259169 7:119494593-119494615 ATATATAGCAGAGAGATTGTAGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031886223 7:127248851-127248873 ATGGAGAGCACAGAGCTTGAAGG + Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034450858 7:151136617-151136639 TTACAGTGCACACTGATTGTGGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1037480933 8:19304491-19304513 ATATAGAGAACTGTGATTCTAGG - Intergenic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038098167 8:24339802-24339824 ACACAAAGCACAGTCATTGTTGG + Intronic
1038941956 8:32314862-32314884 ACAGAGAGGACAGTGTTTGATGG - Intronic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1042469936 8:69175271-69175293 TTAGAGAGCACATACATTGTGGG + Intergenic
1042732557 8:71953546-71953568 ATAGACAGCAAAGTGTGTGTTGG - Intronic
1043157912 8:76808740-76808762 TTATAGAACACAATGATTGTGGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043574302 8:81639918-81639940 ATAGAGAGCAGAATGATGGCTGG + Intergenic
1043585233 8:81760899-81760921 AAAGAGAGCAAAGTGGTGGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049725694 8:144144774-144144796 CTAGACAGCACAGTGGCTGTGGG + Intergenic
1050067624 9:1777184-1777206 CCAGAGAGCACAGTAATGGTGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1054991387 9:71331400-71331422 ATAGATGGCACAGTAATAGTTGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056543541 9:87594644-87594666 ATAGAGAGCACAGTAAATACTGG - Intronic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1058979851 9:110159124-110159146 ATAGAGAGCAGATGGATTGCTGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060658219 9:125387531-125387553 ATAAAGGGCACAGGGACTGTGGG - Intergenic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188711338 X:33404296-33404318 AAAGAAAGCACAGTGCTTTTTGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189843212 X:45104543-45104565 ATAGAAAGCAAAGTGATTTAGGG - Intronic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195300339 X:103524160-103524182 TAAGAAAGCACAGTGATTGCTGG - Intergenic
1195303333 X:103554330-103554352 CAAGAAAGCACAGTGATTGCTGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196141469 X:112267483-112267505 ATGGAGATCACAGAGATTGGAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197545475 X:127818414-127818436 ATAGACAACACAGTAATAGTGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199493173 X:148423574-148423596 ATTGAGAGCACAGTGGATTTAGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1202334089 Y:23788261-23788283 TTAGTGAGCACAGTGGTTGCTGG + Intergenic
1202536679 Y:25881798-25881820 TTAGTGAGCACAGTGGTTGCTGG - Intergenic