ID: 1083529775

View in Genome Browser
Species Human (GRCh38)
Location 11:63409166-63409188
Sequence TGTGATATGCACACTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083529769_1083529775 -8 Left 1083529769 11:63409151-63409173 CCCTCCCTGCCCTAGTGTGATAT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 164
1083529767_1083529775 12 Left 1083529767 11:63409131-63409153 CCAAAATTAGGTCTCCTCTTCCC 0: 1
1: 0
2: 3
3: 12
4: 205
Right 1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 164
1083529770_1083529775 -9 Left 1083529770 11:63409152-63409174 CCTCCCTGCCCTAGTGTGATATG 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 164
1083529768_1083529775 -2 Left 1083529768 11:63409145-63409167 CCTCTTCCCTCCCTGCCCTAGTG 0: 1
1: 0
2: 4
3: 59
4: 668
Right 1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083529775 Original CRISPR TGTGATATGCACACTGTTGA AGG Intronic
900922828 1:5684522-5684544 TTTGAGAAGCACAGTGTTGAGGG + Intergenic
901592937 1:10361083-10361105 TGTAACCTGCACACTGTTCAGGG - Intronic
904386372 1:30145050-30145072 TGTGATCTTCACACTGTAGAAGG - Intergenic
905901614 1:41585156-41585178 TGTGCTATGCAAACGGTTGAAGG + Exonic
908138061 1:61153565-61153587 TTTTATATTCATACTGTTGATGG - Intronic
909142359 1:71884274-71884296 TGGGATATGAACATTGTTCAAGG + Intronic
911278943 1:95899486-95899508 TGTGATTAGCTCACTTTTGATGG + Intergenic
913434268 1:118830926-118830948 TTTGAGATGCACACTGAAGAAGG + Intergenic
914332713 1:146687178-146687200 TGTGCTAGGCACAGTGTTGGGGG + Intergenic
914898867 1:151701094-151701116 TGTGACGTGGACAGTGTTGATGG + Intergenic
915578871 1:156801343-156801365 TATGATTTGCACACTGTTTTTGG - Intergenic
919533878 1:198761945-198761967 TGTCATTTGTACACTGTTTAAGG - Intergenic
920028669 1:203021688-203021710 TGTGATATTATCACTGTTCAAGG + Intronic
1065863888 10:29896448-29896470 TGTGCTAGGCACTGTGTTGAGGG + Intergenic
1067829064 10:49599585-49599607 TGTGGGATGCACACAGCTGAAGG + Intergenic
1072446404 10:95502520-95502542 TGTGAGAAGCACACTCTGGAAGG - Intronic
1078287183 11:9968825-9968847 TGAGATATTCACATTGTTAAGGG - Intronic
1080899038 11:36470046-36470068 TGAGAAATGCATACTGCTGAAGG - Intergenic
1082781360 11:57290059-57290081 TGTGTCATGGACACTTTTGAAGG - Intergenic
1083506587 11:63163560-63163582 TATGACATGCATACTCTTGAAGG - Intronic
1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG + Intronic
1084099586 11:66937281-66937303 AGTGGGATGAACACTGTTGAAGG - Intronic
1086353380 11:85966326-85966348 TGTGATATCAACACTTTTGGAGG - Intronic
1087826904 11:102775530-102775552 CATAATATGCACACTGTTTATGG - Intronic
1088159608 11:106854189-106854211 AGTGCTATGCACACTGTCCAGGG - Intronic
1088530702 11:110806118-110806140 TGCCTTATGGACACTGTTGATGG - Intergenic
1093920646 12:24855960-24855982 TCTGATTTGCACATTGTTTAAGG - Intronic
1093950067 12:25155591-25155613 TGTGATCTACAGACTCTTGATGG + Intronic
1094816628 12:34193063-34193085 TGTTATATGCAGAGTATTGAAGG + Intergenic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1098286889 12:68916309-68916331 TGTGATCTGTGCTCTGTTGAAGG + Intronic
1101294918 12:103412326-103412348 TGTGATATACACACATGTGACGG + Intronic
1101553266 12:105783401-105783423 TGTGATTTGCACAGTGAAGAAGG - Intergenic
1103912128 12:124357757-124357779 TGTGCTCTACACAATGTTGAAGG + Intronic
1104238682 12:126964979-126965001 TGTGATGATCAAACTGTTGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106890641 13:34242016-34242038 TGTCATATGCACGCTGTTTTTGG + Intergenic
1108879525 13:55092507-55092529 TGTGATCTGCACAATTTTTATGG + Intergenic
1109755896 13:66760147-66760169 TGATATATGCAGACTGCTGAAGG - Intronic
1109774057 13:67016854-67016876 TGTGATAAGCACACTCTTGAAGG - Intronic
1110379558 13:74834835-74834857 TGTCATTTGCATACTGTTTATGG + Intergenic
1112194834 13:97214979-97215001 AGTGATCTGCCCACAGTTGATGG - Intergenic
1112322002 13:98416368-98416390 TGTAATTTCCCCACTGTTGATGG - Intronic
1112983896 13:105422544-105422566 TGTCATTTGCACACTTTTGATGG - Intergenic
1114291477 14:21292146-21292168 TGTGATATCAACACTTTGGAAGG - Intronic
1121160331 14:91732903-91732925 TGTGTTTTGCACACTGTTTCAGG - Intronic
1123938488 15:25205401-25205423 GGTGAAAGGCCCACTGTTGAGGG + Intergenic
1125251458 15:37709885-37709907 TGTGGTGTGTACACTGTTCAGGG + Intergenic
1126615238 15:50571824-50571846 TGTGATTTGAACAATGTTCACGG - Intronic
1126819379 15:52486881-52486903 TGTCATAGGCACACGGGTGAAGG + Intronic
1127362154 15:58253470-58253492 TTTGATAAGCCCACTGTTTAGGG - Intronic
1130676411 15:85956174-85956196 TCTGCCATGGACACTGTTGAGGG - Intergenic
1130880660 15:88053009-88053031 TGATAAATGGACACTGTTGAGGG - Intronic
1132386940 15:101407459-101407481 TGTGAAAAGCACACTCCTGATGG - Intronic
1138362054 16:56439089-56439111 TGTGATGTGCTAACTGTTAAAGG + Intronic
1140000901 16:71024063-71024085 TGTGCTAGGCACAGTGTTGGGGG - Intronic
1142297091 16:89231413-89231435 CCTGATATGCCCACTGTTGGTGG + Exonic
1144286309 17:13778052-13778074 TAAGACATGGACACTGTTGAGGG + Intergenic
1145029983 17:19497093-19497115 TCGTATATGCACACTCTTGATGG - Intronic
1145260406 17:21351504-21351526 GGGGACATCCACACTGTTGAAGG - Intergenic
1145316213 17:21736439-21736461 GGGGACATCCACACTGTTGAAGG + Intergenic
1145368399 17:22286274-22286296 TCAGATATGGACACTATTGATGG + Intergenic
1145714643 17:27008367-27008389 GGGGACATCCACACTGTTGAAGG + Intergenic
1147052117 17:37803067-37803089 TGTGACATGCACATTGAGGAGGG + Intergenic
1149228651 17:54505642-54505664 TCTCATATGCAAGCTGTTGAGGG - Intergenic
1150803500 17:68300760-68300782 TGTCATATGCCCCCTGTGGATGG + Intronic
1153396337 18:4625605-4625627 AGTGAAATGGACTCTGTTGAGGG + Intergenic
1155866116 18:30966985-30967007 TGAGAGATGCACACCATTGATGG + Intergenic
1157873636 18:51252086-51252108 TGTGATAGGAACACAGATGAGGG - Intergenic
1159337167 18:67083504-67083526 TGTGTTTTGTACACTGTTAATGG - Intergenic
1160982642 19:1823396-1823418 TGTGAAATGGGGACTGTTGAGGG - Intronic
1162574872 19:11493467-11493489 AGTGAGATGCCCACTGTTGATGG + Intronic
924993830 2:339505-339527 TGTCTGATGCACACTTTTGAAGG + Intergenic
930307265 2:49690881-49690903 TGTGATATGTATACTGTTTGTGG - Intergenic
931222895 2:60304356-60304378 TGTGGTATGCACACAGTACACGG + Intergenic
933986717 2:87597792-87597814 TGTTAAATGCATATTGTTGAAGG - Intergenic
936307126 2:111353017-111353039 TGTTAAATGCATATTGTTGAAGG + Intergenic
938494642 2:131787701-131787723 TGTGATATCCCCAATGTTGGTGG - Intergenic
942087319 2:172455483-172455505 TGTGAAATTCACACTCTTGCTGG - Intronic
942648189 2:178137480-178137502 TGTCATATGCATTCTGTTCATGG - Intronic
946624125 2:221592669-221592691 TGTGAAATGACCACTGCTGAAGG - Intergenic
946654686 2:221934041-221934063 TGTGATATGCATATTATTTAAGG + Intergenic
947147962 2:227085929-227085951 TGTGTTTTGCACACTGTATAAGG - Intronic
947225282 2:227833960-227833982 TGTGATATTGACATTGATGATGG - Intergenic
948700476 2:239756653-239756675 TGTGATGTGCCCAGTGTAGAGGG + Intergenic
1169617310 20:7463310-7463332 TGTCATATGCACACTTAGGAGGG - Intergenic
1170497731 20:16942889-16942911 TGAGAATTGCACAATGTTGATGG + Intergenic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1174342069 20:49904109-49904131 TGTGATGTACACAATGTTAAGGG - Exonic
1175341326 20:58231963-58231985 TGTGTTTTGAACACTGTTCATGG - Intergenic
1175541992 20:59753825-59753847 AGTGAAAGGGACACTGTTGAAGG + Intronic
1176613288 21:9006570-9006592 TGTGATATCCCCAATGTTGGTGG + Intergenic
1176946041 21:14982923-14982945 TGTGATATGGGCACAGTTCATGG - Intronic
1177669382 21:24206656-24206678 TGTGATATGCTCACTCATGGGGG + Intergenic
1184472579 22:44704130-44704152 TGTGCTAAGCACTGTGTTGAGGG - Intronic
1185001366 22:48248501-48248523 TGTGACCTGCACTCTGTTTAGGG - Intergenic
954975996 3:54695409-54695431 TGTGATATGCACAAAGATGATGG - Intronic
956331844 3:68118985-68119007 TGTCATTTGTACACTGTTGGTGG - Intronic
956698756 3:71940493-71940515 TTTGCAATGCACCCTGTTGATGG - Intergenic
957622979 3:82619863-82619885 GGTGATATTCACACGGTTCAGGG + Intergenic
959674037 3:109014219-109014241 TGTGATATGTACAATGATAAAGG - Intronic
961955528 3:130798942-130798964 TGTAATTTGCCCACTTTTGATGG - Intergenic
964134094 3:153324919-153324941 TGTGCTTTGCACACTTTTGTGGG + Intergenic
965074602 3:163960087-163960109 TGGGCTATGCACACTGGTGTTGG - Intergenic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
967636732 3:191809734-191809756 TGCCATAGGCACAGTGTTGATGG + Intergenic
969519742 4:7669109-7669131 TGTAAAATGCACACTGTCAAGGG - Intronic
970295814 4:14628239-14628261 TGTGAAATGCACTTTTTTGATGG - Intergenic
970827301 4:20291274-20291296 TGTGGTATGCACATTCTTCAAGG + Intronic
971835434 4:31757000-31757022 TGTGATATGCACACATTAGCTGG - Intergenic
975072354 4:70157804-70157826 TTTGAGATGCACAGTGTTAAAGG + Intronic
976070384 4:81233640-81233662 TGTGTTATTCACACTATTGCTGG - Intergenic
982812347 4:159841752-159841774 TGTCATTTGCCCACTTTTGATGG + Intergenic
988117216 5:26911032-26911054 TGTGAAATGCAAACTCTTTAAGG + Intronic
988118494 5:26927745-26927767 TGTGAAATGCAAACTCTTTAAGG - Intronic
988515456 5:31900378-31900400 TGTGAAGAGCTCACTGTTGATGG + Intronic
992739623 5:79760345-79760367 TATGTTATGTACACTGTTAAAGG + Intronic
993273481 5:85825710-85825732 TGCTATATAGACACTGTTGATGG - Intergenic
994076592 5:95658246-95658268 TTTGATATGCACCATCTTGATGG + Intronic
995355531 5:111233522-111233544 TTTGATATGAACATTGTTCACGG - Intronic
999728196 5:154454632-154454654 TGTCATCTGGACACTGGTGAAGG - Intronic
1000576951 5:162986754-162986776 TATGAGATGGACACTGTAGATGG - Intergenic
1000862897 5:166477434-166477456 TAAGAAATGAACACTGTTGAAGG - Intergenic
1001106337 5:168857850-168857872 CCTGATAGGCACACCGTTGAGGG - Intronic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1003386256 6:5670315-5670337 TGTGATATCCACAATGATCAGGG - Intronic
1010522359 6:76853634-76853656 TGAAATATGAAAACTGTTGAAGG + Intergenic
1016698786 6:147030508-147030530 TGTGATATGCACCTTATTTATGG - Intergenic
1019173106 6:170145963-170145985 GGTGATAAGCACACTGCGGAGGG + Intergenic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1021189111 7:17600247-17600269 TTTGAAATGATCACTGTTGAGGG - Intergenic
1021505775 7:21383347-21383369 TGTGAAATGTACAATGTTGAAGG - Intergenic
1023020786 7:36010275-36010297 TGTGAAATGCCCCCTGTTAATGG + Intergenic
1024288132 7:47778029-47778051 TGTGCTATGCTAAATGTTGATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1032332203 7:130990967-130990989 TCTGCTATGCATACTGTAGAAGG + Intergenic
1032387961 7:131537606-131537628 TGTGATATGCACCTTTTTGGGGG - Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1041100621 8:54393005-54393027 TGTGGGATGCACAGGGTTGAAGG - Intergenic
1041726015 8:61017972-61017994 TGTTTTATGCTCAATGTTGAGGG + Intergenic
1041890897 8:62867373-62867395 TGTGCTAGGCACTATGTTGAGGG - Intronic
1042806930 8:72781043-72781065 TGTCATTTGCCCACTTTTGATGG + Intronic
1043677050 8:82970179-82970201 TGTGAAAGGCACACTGATGCAGG - Intergenic
1043765644 8:84128513-84128535 TGTGATTTGTACACTGTTAGTGG + Intergenic
1044519826 8:93186598-93186620 TATGATATGCACGCTATTCAAGG + Intergenic
1046750191 8:117918881-117918903 TGTGTTAGTCACACTGTTGGAGG + Intronic
1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG + Intronic
1047559079 8:125966825-125966847 TGTGCTATGGACACTAATGATGG - Intergenic
1050759235 9:9045834-9045856 TGAGATATGCAGACTTTTTAGGG + Intronic
1052785389 9:32823344-32823366 TGTGATCTGCACATTCTTCATGG - Intergenic
1053648883 9:40142910-40142932 TGTGATATCCCCAATGTTGGTGG - Intergenic
1053756861 9:41320943-41320965 TGTGATATCCCCAATGTTGGTGG + Intergenic
1054329866 9:63740850-63740872 TGTGATATCCCCAATGTTGGTGG - Intergenic
1054535700 9:66233260-66233282 TGTGATATCCCCAATGTTGGTGG + Intergenic
1055245372 9:74235061-74235083 TGAGATATGAACATTTTTGATGG + Intergenic
1056991742 9:91419672-91419694 TGTGCCAGGCACAGTGTTGAGGG - Intronic
1057514429 9:95709511-95709533 TGATATATGCCCACTGTGGAAGG - Intergenic
1059143614 9:111877217-111877239 TGTGATAGGCACTGTTTTGAGGG - Intergenic
1062553565 9:137102427-137102449 TGTTACATTCACACTGTTGCAGG + Intronic
1062553617 9:137103028-137103050 TGTTACATTCACACTGTTGCAGG + Intronic
1062553628 9:137103141-137103163 TGTTACATTCACACTGTTGCAGG + Intronic
1062553690 9:137103760-137103782 TGTTACATTCACACTGTTGCAGG + Intronic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1190430031 X:50370226-50370248 AGTGATATGGACACTGGTAAGGG - Intronic
1192218508 X:69180548-69180570 TGTGATCTGCACTTTGTAGAGGG + Intergenic
1196979254 X:121193565-121193587 GGTGATATGCATACTCTTAAGGG + Intergenic
1198939936 X:141943031-141943053 GGTGATGTGCACACTTTTGTTGG - Intergenic
1200053639 X:153447248-153447270 TGTGACAGGCACACTGCTCAGGG + Intronic
1200608369 Y:5295038-5295060 TGACATATTTACACTGTTGAAGG - Intronic
1200843151 Y:7804161-7804183 TGGGACTGGCACACTGTTGATGG - Intergenic
1202042290 Y:20697994-20698016 TGAGATGTGCACCCTGTTTATGG + Intergenic
1202047608 Y:20750291-20750313 ACTGAAATGCACACTTTTGAAGG + Intergenic