ID: 1083535155

View in Genome Browser
Species Human (GRCh38)
Location 11:63460374-63460396
Sequence AACCCCATGCTGCTGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083535155_1083535158 25 Left 1083535155 11:63460374-63460396 CCAAGAAGCAGCAGCATGGGGTT No data
Right 1083535158 11:63460422-63460444 GATTCTGCCCAGCTGAAAATTGG No data
1083535155_1083535156 -10 Left 1083535155 11:63460374-63460396 CCAAGAAGCAGCAGCATGGGGTT No data
Right 1083535156 11:63460387-63460409 GCATGGGGTTCACAAATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083535155 Original CRISPR AACCCCATGCTGCTGCTTCT TGG (reversed) Intergenic
No off target data available for this crispr