ID: 1083536227

View in Genome Browser
Species Human (GRCh38)
Location 11:63468985-63469007
Sequence GCTTCAGGTGGGTCACGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083536227 Original CRISPR GCTTCAGGTGGGTCACGTGG GGG (reversed) Intronic
900159518 1:1216811-1216833 GCTGGTGCTGGGTCACGTGGAGG - Intergenic
900192897 1:1358903-1358925 CCCTGAGGTGGCTCACGTGGGGG - Intronic
902504458 1:16930242-16930264 GCATCAGGTTGGGCAGGTGGAGG - Intronic
908606636 1:65804798-65804820 GTTTCAGGTGAGTCATGTCGTGG + Intronic
914989632 1:152487108-152487130 GCATCAGGGGTGTCATGTGGAGG - Intergenic
920296766 1:204962322-204962344 GTTTGAGGTGGCTCACCTGGTGG + Intronic
1063072370 10:2679796-2679818 GCTCAAGGTGGGCCACGAGGGGG - Intergenic
1069298128 10:66872712-66872734 GATTCAGGTGGTACACGTGAAGG + Intronic
1069735170 10:70649256-70649278 GGCTCAGGTGGGGCACCTGGAGG + Intergenic
1069852824 10:71421335-71421357 TCCTCAGGTGGGGCAGGTGGTGG - Intronic
1072254388 10:93607237-93607259 GATTCAGGTGGTACACGTGTAGG - Intergenic
1072742339 10:97917015-97917037 GCTTCAGCTGGGTCCCGTCTCGG - Intronic
1074251997 10:111760346-111760368 GCTTCAAGTGGTTCACATGCAGG + Intergenic
1075081305 10:119385712-119385734 GCTGCAGGAGGGTCACCTTGTGG + Intronic
1077018435 11:407046-407068 GCTTCCGGTGGGTCCCGCGCGGG - Exonic
1079505084 11:21144216-21144238 GCCTCAGGTGGGCCAAGTGATGG + Intronic
1081155211 11:39681401-39681423 TCTTCATGTGTGTCCCGTGGGGG - Intergenic
1083536227 11:63468985-63469007 GCTTCAGGTGGGTCACGTGGGGG - Intronic
1083762327 11:64825470-64825492 GATCCTGGTGGGTCACCTGGAGG + Intronic
1088805850 11:113351458-113351480 GCTACAGGAGGGACAGGTGGAGG + Intronic
1089882465 11:121787843-121787865 ACATCAGCTGGGTCACTTGGTGG + Intergenic
1090805594 11:130200131-130200153 GATTCAGGTGGGTCTCTGGGTGG + Exonic
1094843247 12:34350658-34350680 GCGGCAGGTGGGTCACGGTGCGG + Intergenic
1100613556 12:96212782-96212804 GCTACCGGTGAGCCACGTGGCGG + Intronic
1103811000 12:123613717-123613739 GCCAAAAGTGGGTCACGTGGTGG + Intronic
1104243381 12:127013581-127013603 GCTTCAGGTGGCTAACGGGTGGG + Intergenic
1114904675 14:27112187-27112209 GCTTCAGGGGGAACACGTGCAGG + Intergenic
1116496154 14:45563179-45563201 TTTTCAGGTGGGTCTTGTGGTGG + Intergenic
1118302339 14:64626708-64626730 GCTTCAAGAGGGTGAGGTGGAGG + Intergenic
1122587599 14:102820153-102820175 GTTTCAGGTGAGCCACATGGGGG + Intronic
1126480308 15:49111224-49111246 GCTTCAGGTGGGTCATTTCTTGG - Intronic
1130051493 15:80487387-80487409 GGTTCAGATGGGGCGCGTGGAGG + Intronic
1130708589 15:86256997-86257019 CCTTCAGGTAGATCATGTGGAGG - Exonic
1131397227 15:92096220-92096242 GCTTCAGGGGTGTCACGGTGAGG - Intronic
1137951187 16:52785014-52785036 GATTCAGGTGGCACACGTGCAGG - Intergenic
1139540449 16:67611321-67611343 GTTTCAGGTGGTTAAAGTGGGGG + Exonic
1141282274 16:82639430-82639452 GCTGCAGGTGGGTCACGCCCAGG - Exonic
1141719332 16:85747000-85747022 GCTTCCTGTGGGCCAGGTGGAGG - Intronic
1144239951 17:13300839-13300861 GCTTTAAGTTGGTCACCTGGTGG - Intergenic
1144721143 17:17470710-17470732 TCTTTAAGTGGGTCAGGTGGAGG - Intergenic
1148155877 17:45425144-45425166 GCTGCAGGTGAGTCACCGGGAGG + Intronic
1148189233 17:45667144-45667166 TTTTCAGGTGGGTCACGTGGGGG + Intergenic
1152183497 17:78840237-78840259 GCTTCTGGCGGGTGGCGTGGGGG - Intronic
1158009531 18:52712897-52712919 GCTTCAGGTGAGACACAAGGAGG - Intronic
1160329360 18:77977794-77977816 GCTTCGAGGGGGTCACCTGGAGG - Intergenic
1161802886 19:6425626-6425648 GCTTCAAGCGGGCCACGTGCCGG - Intergenic
1161843692 19:6697636-6697658 GCTCAAGGTGGGTCCCGGGGTGG - Exonic
1162054435 19:8054208-8054230 GGGGCAGGTGGGTCAGGTGGGGG - Intronic
1167433917 19:49468353-49468375 GGGACAGGTGGGTCACGTGTGGG - Intronic
925374926 2:3377632-3377654 GTTCCAGGTGGGTCACTGGGAGG - Exonic
927637191 2:24825101-24825123 GCTGCAGGTCTGTCTCGTGGAGG + Intronic
927981736 2:27378767-27378789 GCTTCAGGTGGCTCGAGTAGTGG + Exonic
929491498 2:42400541-42400563 GCTTCAGGTGGGTGACAAGGAGG - Intronic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
934657205 2:96122616-96122638 CCTTCTGGAGGGTCACGTGCTGG - Intergenic
935640350 2:105284185-105284207 GCTTCAGGTGGATACGGTGGGGG - Intronic
938686630 2:133744132-133744154 GCGTCAAGTGGGGCACCTGGTGG - Intergenic
945190020 2:207178344-207178366 CCTTCAGGTGGGTTGCATGGGGG - Intergenic
946269951 2:218583093-218583115 GCTTTGGGTGAGTCACTTGGGGG + Intronic
947795809 2:232893343-232893365 GCTTCAGAAGGGTCCCCTGGGGG + Intronic
948679378 2:239622422-239622444 GATTCAGGGGGTTCACGTGCAGG + Intergenic
948981528 2:241497153-241497175 GCTCCAGGTGGGGCTCCTGGAGG + Intronic
1168928053 20:1598996-1599018 GCCTCAGGTGGGGTAAGTGGGGG - Intronic
1173097363 20:40048419-40048441 GTTGCAGGGGGATCACGTGGTGG + Intergenic
1176181949 20:63753622-63753644 GCTTCAGGTGGGTCTCCCGTAGG - Intronic
1176257201 20:64158685-64158707 GGGTCAGGTGGGGCAGGTGGTGG - Intronic
1176954182 21:15081583-15081605 GCTTCAGGTGGGGCTGGTGTAGG + Intergenic
1178974537 21:37209648-37209670 GCTTAAGGAAGGTCACATGGAGG - Intergenic
1181435870 22:22910496-22910518 GCTTCAGGTGGGGGATGGGGAGG + Intergenic
1182796836 22:32997054-32997076 GCTTCAGGTGGGAGAGGTTGGGG + Intronic
1184587341 22:45456958-45456980 GGTTCAGGAGAGTCACGTGGTGG - Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
953206648 3:40836918-40836940 GCTTCATGTGGGTCCCTTGCTGG - Intergenic
956290526 3:67655096-67655118 GCTTCAGGTGAGTCAAGGAGAGG + Intergenic
961361570 3:126371291-126371313 GCTTCAGGTGGGCTGCGTCGGGG + Intergenic
966046315 3:175554563-175554585 TCTTCTGGTGGGTTACATGGGGG + Intronic
966852829 3:184175162-184175184 GCGCCAGGCGGGTCAGGTGGAGG - Intronic
968477997 4:821388-821410 GCTTCAGGTGGGACACGGCTTGG - Intronic
969341120 4:6542136-6542158 GCTTCAGTTTGTTCACATGGTGG - Intronic
973203726 4:47535286-47535308 GGTTCAGGTGGTACACGTGCAGG - Intronic
978224418 4:106316588-106316610 GCTTCATGTGAGTGACGTCGTGG + Exonic
980704485 4:136475157-136475179 CCTGCAGGTGGGGCACTTGGTGG - Intergenic
982297709 4:153846986-153847008 GCTACAGGTGGGTGAAGTAGTGG + Intergenic
982725962 4:158906623-158906645 ACTACAGGTGGGTCACATGTGGG + Exonic
990852636 5:60224443-60224465 GCTTCCCTTGGGTCACTTGGTGG + Intronic
991704624 5:69346328-69346350 GCTTCAGGTGGGGGGCGCGGGGG + Intergenic
1004287904 6:14339617-14339639 GCACCAGGTGGGTCAGGGGGAGG - Intergenic
1004516381 6:16325588-16325610 GCCCCAGGTGGGTCAGGAGGTGG - Intronic
1009651383 6:66481113-66481135 GGTGCAGGTGGGGCACCTGGAGG - Intergenic
1014924057 6:127249703-127249725 ACTTCAGGTGGGTCAAGAGTTGG - Intergenic
1019141250 6:169945298-169945320 GGGGCAGGTGTGTCACGTGGTGG + Intergenic
1019257356 7:60862-60884 TCTCCAGGTGGGGCACATGGAGG + Intergenic
1019262176 7:87833-87855 GGGGCAGGTGGGTCACCTGGTGG - Intergenic
1019900080 7:4013731-4013753 ACTTCAGGTGGGTCACGGTCTGG - Intronic
1020100300 7:5390569-5390591 GCTCCAGGTGGTTCAGGTGGAGG + Exonic
1020154448 7:5710815-5710837 GCTTCCAGTGGGTCAGGTGTTGG - Intronic
1021154067 7:17187438-17187460 GCTTCAGGGGGGTTATGAGGGGG + Intergenic
1022094640 7:27130939-27130961 GCTGCACGTGGGGCACGGGGCGG - Intronic
1023967170 7:44969098-44969120 GCTTCAGGCTGGTGATGTGGGGG - Intronic
1024171991 7:46798350-46798372 TCTTCAGGTTGTTCATGTGGTGG + Intergenic
1031319801 7:120310656-120310678 GGTTGTGGTGGCTCACGTGGTGG + Intronic
1036157599 8:6357094-6357116 GCTTGATGTGGGTCAGTTGGTGG - Intergenic
1036800290 8:11786048-11786070 GGTCCTGGTGGATCACGTGGTGG + Exonic
1037311183 8:17558391-17558413 TCCTCAGGTGAGTCACCTGGTGG + Exonic
1039291616 8:36101313-36101335 GCTTCAGTTGGGTGATTTGGAGG + Intergenic
1049397839 8:142409888-142409910 GCTTCTGGTGGCTCAGCTGGAGG - Intergenic
1054943482 9:70769897-70769919 GCTTTAGGTGGGTGACCAGGCGG + Intronic
1056692852 9:88823054-88823076 GCTTAAGGAGGGACACGGGGTGG - Intergenic
1056732513 9:89178235-89178257 GTTTCAGGTGGGACACCTTGTGG + Exonic
1062396427 9:136354677-136354699 GCTTCAGCTGGGCCCCTTGGGGG + Intronic
1188216208 X:27480520-27480542 GCTTCAGGTGGGTCTCTTGGCGG + Intergenic
1189507059 X:41622713-41622735 GCTTCTGGTGGCTCATGTAGTGG - Intronic
1193298854 X:79865014-79865036 GCATGAGGTGGGTCAAGGGGTGG - Intergenic
1198178795 X:134183884-134183906 GAGTCACGTGGGTCACGTGGTGG + Intergenic
1200066838 X:153508008-153508030 GTCTCAGGTGGGTCAGGTTGAGG - Intronic
1201891119 Y:18945132-18945154 GCTTAAGGTGGGCAAGGTGGGGG + Intergenic