ID: 1083538019

View in Genome Browser
Species Human (GRCh38)
Location 11:63490072-63490094
Sequence GGGTGATAACAGATGGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083538019_1083538034 20 Left 1083538019 11:63490072-63490094 CCCAGTACCATCTGTTATCACCC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1083538034 11:63490115-63490137 CTTGCTGGGTACCGGCTGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 109
1083538019_1083538028 12 Left 1083538019 11:63490072-63490094 CCCAGTACCATCTGTTATCACCC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1083538028 11:63490107-63490129 GCCTTCCCCTTGCTGGGTACCGG 0: 1
1: 0
2: 2
3: 19
4: 198
1083538019_1083538030 16 Left 1083538019 11:63490072-63490094 CCCAGTACCATCTGTTATCACCC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1083538030 11:63490111-63490133 TCCCCTTGCTGGGTACCGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 88
1083538019_1083538026 6 Left 1083538019 11:63490072-63490094 CCCAGTACCATCTGTTATCACCC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1083538026 11:63490101-63490123 ACACCAGCCTTCCCCTTGCTGGG 0: 1
1: 0
2: 0
3: 23
4: 217
1083538019_1083538025 5 Left 1083538019 11:63490072-63490094 CCCAGTACCATCTGTTATCACCC 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1083538025 11:63490100-63490122 CACACCAGCCTTCCCCTTGCTGG 0: 1
1: 0
2: 4
3: 27
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083538019 Original CRISPR GGGTGATAACAGATGGTACT GGG (reversed) Intronic
902099051 1:13970186-13970208 GGCTGAGAACAGATGGTATTTGG - Intergenic
903356231 1:22749524-22749546 GGGTGACAACAGGTGTTTCTTGG + Intronic
907561221 1:55390138-55390160 GAGTGAGAACATATGGTATTTGG + Intergenic
909504524 1:76373106-76373128 TTGTGATAACAGATGGTAACAGG + Intronic
911556665 1:99353407-99353429 GAGTGATAACATGTGGTGCTTGG + Intergenic
913384140 1:118241302-118241324 GAGTGATAACATATGATGCTTGG - Intergenic
914905958 1:151744275-151744297 GGGTGAAAAGACAAGGTACTGGG - Intergenic
916612129 1:166402518-166402540 GGGTGAGAACACATGGTGTTTGG + Intergenic
917292635 1:173487139-173487161 TGGTGATAACAGGTGCTACAGGG + Intronic
919226943 1:194716340-194716362 AAGTGATAACATATGGTATTTGG + Intergenic
920741393 1:208584414-208584436 TGGTGATAACATATTGCACTAGG + Intergenic
921631799 1:217442249-217442271 GAGTGAGAACATATGGTGCTTGG - Intronic
923089796 1:230731332-230731354 GTGTGATAACAGATGGAAGGGGG - Intergenic
923748449 1:236724809-236724831 TGGTCATCACAGATGGTGCTGGG + Intronic
1065753073 10:28906238-28906260 AGGTGATAGCAGATGAAACTCGG + Intergenic
1065894736 10:30153485-30153507 GGGTGACAACAGCTGTTACAAGG - Intergenic
1069461084 10:68595272-68595294 AGTTTATAATAGATGGTACTTGG + Intronic
1071020181 10:81044708-81044730 AGGTGAGAACATATGGTATTTGG + Intergenic
1075688772 10:124381482-124381504 GGGTGATGACAGAGGCTTCTGGG - Intergenic
1076183049 10:128425506-128425528 AGGTGATCACAGAAGGAACTGGG - Intergenic
1077463706 11:2723447-2723469 AGGTGAGACCAGGTGGTACTTGG + Intronic
1078461767 11:11520027-11520049 GGGTGCAAACAGCTGGCACTGGG + Intronic
1078484767 11:11711519-11711541 GAGTGAGAACATATGGTATTTGG + Intergenic
1078641214 11:13098441-13098463 GGGTCAGAACAGATGGTAGTGGG + Intergenic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1084602051 11:70151630-70151652 GGGTGATAACCGAAGTCACTGGG + Intronic
1088042318 11:105402196-105402218 AAGTGATAACACATGGTATTTGG + Intergenic
1090813836 11:130272796-130272818 GCTTTTTAACAGATGGTACTGGG - Intronic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1093418610 12:18949090-18949112 GAGTGAGAACATATGGTATTTGG - Intergenic
1093475054 12:19545521-19545543 GGGTCATGTCAGATGGGACTGGG - Intronic
1094279234 12:28716950-28716972 GAGTGATAAAACATGGTATTTGG - Intergenic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1095104952 12:38222087-38222109 GAGTGATAACAGATGGATCCGGG + Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099603988 12:84778382-84778404 GGGTGCTAACAGTTGGCACCTGG - Intergenic
1105922219 13:24973747-24973769 GAGTGAGAACATATGGTATTTGG - Intergenic
1107163846 13:37263201-37263223 GGGTGATTACATTTGGTAATAGG + Intergenic
1107487711 13:40845720-40845742 GAGTGAGAACAAATGGTATTTGG - Intergenic
1110037044 13:70700849-70700871 GGGTGATTACTGATGGTTATGGG + Intergenic
1110544747 13:76744042-76744064 GGGTGAGAACATATGATATTTGG - Intergenic
1110822664 13:79934686-79934708 GGGTGAGAACAGGCGGTATTTGG - Intergenic
1110896092 13:80754345-80754367 GGGTGAAAAGAGATAGTATTTGG + Intergenic
1116181015 14:41535707-41535729 ATGTGATAACATGTGGTACTTGG + Intergenic
1116319499 14:43442223-43442245 GAGTGATAACATATGGTATTTGG + Intergenic
1119271529 14:73309479-73309501 GAGTGAGAACAGGTGGTATTTGG - Intronic
1120224385 14:81774144-81774166 GGGTCATAATAGATTGCACTGGG - Intergenic
1121415557 14:93777073-93777095 GGCAAATAAGAGATGGTACTTGG + Intronic
1122675704 14:103411433-103411455 GGGAGAGAACTGATGGTTCTGGG - Intronic
1124894562 15:33764335-33764357 GAGTGAGAACATGTGGTACTTGG - Intronic
1125058058 15:35386080-35386102 GGGTGAGAACATATGGTGTTTGG + Intronic
1126761938 15:51977474-51977496 GGGCGATAACAGATGGGGGTTGG - Intronic
1128377873 15:67090109-67090131 GGGTGGTGACAGGTGGCACTGGG + Intronic
1128745882 15:70113824-70113846 GGGTGACAAGAGGTGGGACTGGG - Intergenic
1132818309 16:1846708-1846730 GAGTGAGAACATATGGTATTTGG - Intronic
1134851877 16:17485416-17485438 GAGTGATAACATGTGGTGCTTGG + Intergenic
1135862076 16:26065380-26065402 GAGTGAGAACATATGGTATTTGG - Intronic
1138298620 16:55908279-55908301 GGATGCTGACAGATGGGACTGGG - Intronic
1141123747 16:81385189-81385211 GGGTGCTAACAGATTGTCATTGG - Exonic
1141208491 16:81954568-81954590 GAGTGAGAACATATGGTATTTGG + Intronic
1142106327 16:88304960-88304982 GGGGGATTCCAGATGGAACTTGG - Intergenic
1143934516 17:10468796-10468818 GGGTGATAAGTGGCGGTACTGGG + Intronic
1144818795 17:18056422-18056444 GGGTGGGCGCAGATGGTACTAGG - Intronic
1146951871 17:36912582-36912604 GGATGATGAGAGATGTTACTGGG + Intergenic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1150954970 17:69847865-69847887 GAGTGATAACAAATGATATTTGG - Intergenic
1156543931 18:37945022-37945044 GAGTGATAACAGGAGGTTCTGGG + Intergenic
1156803928 18:41153139-41153161 TGGAGATAACAGCTGTTACTGGG - Intergenic
1157560468 18:48641884-48641906 AGGGGATAACAGATGGTAGGTGG + Intronic
1163844352 19:19629957-19629979 GGGTGGTCAGAGATGGTCCTCGG + Exonic
1165757906 19:38304800-38304822 GGGAGAGAAGAGATGGTTCTGGG - Intronic
926498445 2:13620863-13620885 GGAGGATAAAAGATGGTACCAGG + Intergenic
926782999 2:16492672-16492694 GGGTGAGAACATGTGGTATTTGG - Intergenic
929300802 2:40301768-40301790 TGGGGAAAACAGGTGGTACTTGG + Intronic
929380302 2:41342413-41342435 GAGTGAGAACATATGGTATTTGG - Intergenic
930551957 2:52847106-52847128 GAGTGAGAACATATGGTATTTGG + Intergenic
933391368 2:81672647-81672669 GTGTGATAACAGATGGCTCTGGG + Intergenic
936174014 2:110203179-110203201 GAGTGAGAACATATGGTATTTGG - Intronic
938575801 2:132603283-132603305 GAGTGAGAACATGTGGTACTTGG - Intronic
943111819 2:183616242-183616264 GAGTGAGAACAGATGGTGTTTGG + Intergenic
943443713 2:187955852-187955874 GGGTGAAAACATGTGGTATTTGG - Intergenic
944170338 2:196769168-196769190 TGGTGATAACAGTTGAAACTAGG - Intronic
944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG + Intronic
945503968 2:210614792-210614814 GAGTGAGAACATGTGGTACTTGG - Intronic
946542556 2:220700865-220700887 GAGTGAGAACAAATGGTATTTGG + Intergenic
947261473 2:228228165-228228187 GGGAGATAAAAGGTGGGACTGGG + Intergenic
1169930348 20:10826095-10826117 GGGTGACAACAGATGAAACGTGG - Intergenic
1174708381 20:52679842-52679864 TTGTGATAAGAGAGGGTACTGGG + Intergenic
1175822362 20:61917260-61917282 TGATGGTAACAGATGGTATTTGG - Intronic
1176197073 20:63842346-63842368 GGGTGATGGCAGATGGTTCATGG + Intergenic
1176739474 21:10587452-10587474 GAGTGAGAACATATGGTATTTGG + Intronic
1177734870 21:25076481-25076503 AGGTGATAACATGTGGTATTTGG - Intergenic
1177845062 21:26279472-26279494 GGGTGGTAAGAGTTGGCACTGGG + Intergenic
1178012763 21:28305970-28305992 GGGTGATATCAGAGGTGACTGGG - Intergenic
1182336243 22:29585420-29585442 GGGTGAAAAAAGGTGGTGCTGGG + Intergenic
1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG + Intronic
1183008253 22:34921969-34921991 GAGTGAGAACATATGGTATTTGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
950248654 3:11445439-11445461 AAGTGATAACATATGGTATTAGG - Intronic
951001594 3:17567373-17567395 TGATGGTAACAGATGGTGCTAGG - Intronic
953874217 3:46656453-46656475 GAGTGAGAACATATGGTATTTGG - Intergenic
956859859 3:73311965-73311987 AAGTGAGAACACATGGTACTTGG + Intergenic
957817426 3:85319699-85319721 TTGTGAGAACATATGGTACTTGG - Intronic
958811836 3:98868686-98868708 TTGTGAGAACATATGGTACTTGG + Intronic
959117167 3:102192080-102192102 TGTTGATATCAGGTGGTACTTGG + Intronic
960559844 3:119072354-119072376 GAGTCATAAAAGATGGTAGTGGG - Intronic
960800800 3:121537531-121537553 GAGTGAGAACATGTGGTACTTGG + Intronic
960908490 3:122625086-122625108 GGGTAATAATAGAAGGTAATAGG - Intronic
962932905 3:140053987-140054009 GGGTCATCACAGCTGGTCCTCGG + Intronic
963246230 3:143066080-143066102 GAGTGTTAATAGATGTTACTTGG + Intergenic
964805384 3:160604000-160604022 GGGTGAGAACACATGGTGTTTGG + Intergenic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
965425159 3:168513982-168514004 GTTTGACAACAGATGGTAGTGGG + Intergenic
966421233 3:179736428-179736450 GGGTGTTAGCAGATGGGACCAGG + Intronic
970269879 4:14334762-14334784 AAGTGATAACAGGTGGTATTTGG - Intergenic
972203586 4:36745398-36745420 GAGTGAGAACATATGGTATTTGG - Intergenic
973158093 4:46982848-46982870 TGGTGATAACAGCTTGGACTAGG + Intronic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
974084796 4:57248351-57248373 GAGTGAGAACATATGATACTTGG - Intergenic
974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG + Intergenic
975943374 4:79675202-79675224 GGGTGAGAACATGTGGTATTTGG - Intergenic
978067071 4:104418264-104418286 GAGTTATGACAGATGGCACTAGG - Intergenic
978271575 4:106896457-106896479 GAGTGAGAACATATGGTATTTGG - Intergenic
978390151 4:108216635-108216657 AAGTGAGAACATATGGTACTTGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981412208 4:144445653-144445675 GAGTGATAACACATGGCATTTGG - Intergenic
981773012 4:148331808-148331830 CAGTAATAAGAGATGGTACTTGG - Intronic
982332231 4:154193334-154193356 GGGTGATACCAGGTGGTACTGGG - Intergenic
983753237 4:171302224-171302246 AAGTGAGAACAGGTGGTACTTGG + Intergenic
983972921 4:173896284-173896306 GAGTGATTACAGATGCTATTAGG - Intergenic
985993971 5:3586295-3586317 AGGTGATTATAGATGGTAGTGGG + Intergenic
985993985 5:3586385-3586407 AGGTGATTATAGATGGTAGTGGG + Intergenic
985993990 5:3586415-3586437 AGGTGATCATAGATGGTAATGGG + Intergenic
985994005 5:3586506-3586528 AGGTGATCATAGATGGTAGTGGG + Intergenic
985994028 5:3586627-3586649 AGGTGATTATAGATGGTAGTGGG + Intergenic
985994033 5:3586657-3586679 AGGTGATTATAGATGGTAGTGGG + Intergenic
985994058 5:3586809-3586831 AGGTGATTATAGATGGTAGTGGG + Intergenic
986321483 5:6635465-6635487 GGGTCATGACTGATGGGACTAGG - Intronic
988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG + Intergenic
990233173 5:53737362-53737384 GGGTGAGAACACATGGTGTTTGG - Intergenic
990641686 5:57792559-57792581 GGCTGATAACTGATGGAACTGGG + Intergenic
990791712 5:59488082-59488104 GGGTGAAAACTGAGGGAACTAGG - Intronic
993014742 5:82522494-82522516 AGGTTATAGCAGAGGGTACTAGG - Intergenic
993212759 5:84975628-84975650 GAGTGAGAACAGGTGGTATTTGG + Intergenic
993403220 5:87478445-87478467 GAGTGAGAACATATGGTATTTGG - Intergenic
993923532 5:93837196-93837218 AGGTGAGAACATATGGTATTTGG + Intronic
994619001 5:102140513-102140535 GAGTGAGAACATATGGTATTTGG + Intergenic
996018661 5:118568651-118568673 GGGTGATAACAGGGGTTGCTGGG - Intergenic
997759373 5:136430277-136430299 GGGTGATGACAGATTCTATTTGG + Intergenic
999603104 5:153288831-153288853 GAGTGATAACATGTGGTATTTGG - Intergenic
1001611345 5:173004617-173004639 GGGTCATAATAGATGGTCCTGGG + Intronic
1004254793 6:14053050-14053072 GGGAGGCAACAGTTGGTACTGGG + Intergenic
1004985739 6:21080161-21080183 GGGTGCTAACATTTGGAACTTGG + Intronic
1008957810 6:57235023-57235045 GTGTGATGACACATGCTACTTGG + Intergenic
1012597847 6:101061037-101061059 GGAAGAAAACAGATGGTTCTGGG + Intergenic
1012992855 6:105944139-105944161 CGCTGATGACATATGGTACTGGG - Intergenic
1014638945 6:123884194-123884216 AAGTGAGAACATATGGTACTTGG + Intronic
1016616310 6:146052541-146052563 AGGTGATACCAGATGATACTAGG - Intronic
1018075523 6:160208960-160208982 GGGTGAGAACATGTGGTATTTGG + Intronic
1018294268 6:162328857-162328879 GGGTGGTACCAGGTGGTGCTAGG + Intronic
1019900309 7:4015354-4015376 TAGTGATTACAGATGGTGCTTGG + Intronic
1022864698 7:34405515-34405537 GGGTGAAAACAAAAGGCACTGGG + Intergenic
1022973246 7:35536111-35536133 GGATTAGAAGAGATGGTACTTGG - Intergenic
1023568631 7:41549814-41549836 GAGTGAGAACAGATGGTGTTTGG + Intergenic
1024572214 7:50732686-50732708 GGGTGTTAATAGATGGTATAGGG - Intronic
1024863127 7:53869452-53869474 TGGGAATAAAAGATGGTACTGGG + Intergenic
1028069405 7:86432534-86432556 GTTTGATAACAAATGTTACTTGG + Intergenic
1028369954 7:90080260-90080282 CGGTGATAAAAAATGTTACTAGG - Intergenic
1028955059 7:96680020-96680042 GGGTCATACCAGAAGATACTGGG + Intronic
1029890018 7:103918438-103918460 AGATGATATCAGATGGTCCTGGG - Intronic
1033117752 7:138640671-138640693 AGGTGAGAACATATGGTATTTGG - Intronic
1034360458 7:150492403-150492425 GAGTGAGAACATATGGTGCTTGG - Intergenic
1035966988 8:4203523-4203545 GTTTAATAACAGAAGGTACTTGG - Intronic
1041220952 8:55650397-55650419 GAGTGAGAACATGTGGTACTTGG + Intergenic
1041962745 8:63637458-63637480 GGATGATGACAGATGTTATTAGG + Intergenic
1043132901 8:76483725-76483747 GGCTGATAACACATGTTACTTGG + Intergenic
1043713952 8:83457615-83457637 AAGTGAGAACATATGGTACTTGG - Intergenic
1044735310 8:95272581-95272603 GAGTGAGAACATATGATACTTGG + Intergenic
1044802556 8:95972272-95972294 GGCTGAAGACAGATGGTGCTGGG - Intergenic
1046053958 8:109057711-109057733 GAGTGAGAACATACGGTACTTGG - Intergenic
1047035900 8:120938045-120938067 GGATGATAACATAGGGTTCTTGG + Intergenic
1047308884 8:123676036-123676058 GGGTGATACCACATGGTCCCTGG + Intergenic
1050697398 9:8294283-8294305 GCGTGATCACAGATGAGACTTGG + Intergenic
1052703654 9:31968113-31968135 AGGTGAGAACATATGGTATTTGG - Intergenic
1052826132 9:33176612-33176634 CGGTGAGAACATGTGGTACTTGG - Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058269278 9:102949686-102949708 AAGTGAGAACATATGGTACTTGG + Intergenic
1059631037 9:116122791-116122813 AAGTGATAACACATGGTATTTGG - Intergenic
1060374506 9:123106411-123106433 GGGTGATGAGAGATGAAACTGGG + Intergenic
1188015543 X:25104119-25104141 GACTGCTAACAGATGGTATTTGG - Intergenic
1188561362 X:31471781-31471803 TGGTGATAAGAGATGTTACTGGG - Intronic
1189548807 X:42072042-42072064 GAGGGAGACCAGATGGTACTGGG - Intergenic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1190012841 X:46800023-46800045 GGGGGAAAACAGATGCTAATAGG + Intergenic
1193289704 X:79757259-79757281 AGGTGAGAACATATGGTAATGGG + Intergenic
1193704393 X:84803429-84803451 AGGTGAGAACACATGGTATTTGG + Intergenic
1193966480 X:87993176-87993198 AAGTGAGAACATATGGTACTTGG + Intergenic
1194126656 X:90026658-90026680 AAGTGAGAACAGATGGTATTTGG - Intergenic
1194163847 X:90489369-90489391 GGGTGATAACAGAGATGACTGGG + Intergenic
1194347086 X:92779240-92779262 AGGTGAGAACACATGGTATTTGG - Intergenic
1194513320 X:94821461-94821483 GGGTGATAACAGAGATGACTGGG + Intergenic
1196710061 X:118753380-118753402 AGCTGAGAGCAGATGGTACTTGG + Intronic
1197837384 X:130709998-130710020 GAGTGAGAACATATGGTATTTGG + Intronic
1199561390 X:149167097-149167119 AAGTGATAACATATGGTATTTGG - Intergenic
1200510110 Y:4067178-4067200 GGGTGATAACAGAGATGACTGGG + Intergenic
1200655412 Y:5895878-5895900 AGGTGAGAACACATGGTATTTGG - Intergenic